(Downloading may take up to 30 seconds.
If the slide opens in your browser, select File -> Save As to save it.)


Fig. 1. Position of primers used for PCR mutagenesis of YPT7 gene. x, indicates the ypt7D129A mutation. The first base of the YPT7 gene (A to ATG codon) is designated +1. Nucleotide positions refer to the first 5' base of oligonucleotide homologous to genomic DNA. For details see Materials and Methods. The sequences of the primers: oRK25: 5'GGAATAACCTCAGAACTCAC3'; oRK26: 5'TTGAAAGGGCCATCACATCC3'; oRK28: 5'TGCTGCCGAAGAATCTAA3' (the changed base is bold and underlined); oYPT1: 5'AATACTTATCATTGACA3'.