spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 9 March 2004
doi: 10.1242/jcs.01004


Journal of Cell Science 117, 1675-1685 (2004)
Published by The Company of Biologists 2004
This Article
Right arrow Summary Freely available
Right arrow Full Text
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ohkubo, T.
Right arrow Articles by Ozawa, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ohkubo, T.
Right arrow Articles by Ozawa, M.

The transcription factor Snail downregulates the tight junction components independently of E-cadherin downregulation

Tadashi Ohkubo and Masayuki Ozawa*

Department of Biochemistry and Molecular Biology, Graduate School of Medical and Dental Sciences, Kagoshima University, Kagoshima 890-8544, Japan



View larger version (35K):

[in a new window]
 
Fig. 1. Immunoblot analysis of the changes in cell junction protein expression. MDCK cell lines expressing control neo gene (MDCK-neo), Snail (MDCK-Sna), E-cadherin (MDCK-Ecad), or Snail and E-cadherin together (MDCK-Sna-Ecad) were lysed in SDS sample buffer and subjected to immunoblot analysis. HA-tagged Snail protein and ectopically expressed myc-tagged mouse E-cadherin protein were detected with the indicated antibodies. Myc-tagged E-cadherin migrates more slowly than the endogenous canine E-cadherin. Vinculin serves as an internal control for protein loading.

 


View larger version (69K):

[in a new window]
 
Fig. 2. Immunolocalization of cell junctional proteins. Proteins were detected with the indicated antibodies. Endogenous and ectopically expressed E-cadherin was detected using an anti-E-cadherin antibody. Only ectopically expressed E-cadherin was detected with an anti-myc antibody. Whereas no cell contact staining pattern of tight junctional proteins could be observed in MDCK-Sna cells, the additional ectopic expression of E-cadherin restored a minimal cell contact staining pattern.

 


View larger version (105K):

[in a new window]
 
Fig. 3. Whereas the tight junctional protein occludin was transcriptionally downregulated following Snail expression, claudin-1 and ZO-1 were not. The mRNA expression levels of junctional proteins were detected by RT-PCR/Southern blot analysis using the indicated probes. While the expression of the {alpha}(+) ZO-1 isoform was not changed in each cell, the {alpha}(-) isoform expression levels were elevated in two Snail-expressing cells.

 


View larger version (41K):

[in a new window]
 
Fig. 4. Snail-induced downregulation of occludin expression, but not claudin-1 expression, is ascribed to suppression of promoter activity. (A) Downregulation by Snail of junction protein expression in A431 cells. (B) The promoter region of human E-cadherin, occludin and claudin-1. E-boxes are indicated by open boxes. The putative transcription start point is denoted by +1. For occludin, two putative transcription start points are proposed (Mankertz et al., 2000Go). (C) Repression of the promoter activities of human E-cadherin and occludin, but not that of claudin-1, by Snail in A431 cells. Reporter constructs carrying the human E-cadherin, occludin or claudin-1 promoters were co-transfected with a pCAGGS-Snail vector or an empty pCAGGS vector. Whereas the promoter activities of E-cadherin and occludin were repressed by Snail, that of claudin-1 was not repressed. The results represent the mean±s.d. of two independent experiments.

 


View larger version (43K):

[in a new window]
 
Fig. 5. Pulse-chase analysis of claudin-1 in MDCK cells. Cells were metabolically labeled with [35S] methionine for 16 hours and chased for the indicated periods. Claudin-1 was collected by anti-claudin-1 immunoprecipitation; collected proteins were subjected to gel electrophoresis and autoradiography.

 


View larger version (16K):

[in a new window]
 
Fig. 6. RT-PCR/southern bolt analysis revealed changes in the relative p120 isoform levels in Snail-induced epithelial to mesenchymal transitions. (A) Schematic representation of four possible start sites, resulting from N-terminal splicing variations. The alternatively spliced 407 bp sequence is deleted from the N-terminus in isoform 3 cDNA. The primer positions for RT-PCR and the regions used to synthesize southern blot probes (probe 1, 2) are also depicted. (B) Using probe 1, N-terminally spliced shorter fragments were detected in MDCK-neo cells, while longer fragments derived from the fibroblastic isoform cDNA (isoform 1) were detected in MDCK-Sna and MDCK-Sna-Ecad cells by RT-PCR/Southern blot analysis. Only the longer fragments were detected using a splice region-specific probe (probe 2).

 


View larger version (51K):

[in a new window]
 
Fig. 7. Ectopic E-cadherin cell surface expression and association with catenins. The amount of surface E-cadherin was analyzed biochemically. (A) E-cadherin was detected by immunoblot analysis after trypsin/Ca2+ (TC) or trypsin/EGTA (TE) treatment. E-cadherin expressed on the cell surface was resistant to TC treatment, but sensitive to TE treatment. Only intracellular E-cadherin was detected following TE treatment. (B) E-cadherin was detected by immunoblot analysis after cell surface proteins were biotinylated and collected using avidin beads. After surface biotinylation, cells were lysed. After collection of biotinylated proteins (collected 1), the remaining lysate was re-collected (collected 2). The E-cadherin protein contained in either the collected (1) or remainder (2) portions were subjected to immunoblot analysis using an anti-E-cadherin antibody. To facilitate estimation, dilutions of the materials in each fraction were applied to the gels. (C) Formation of E-cadherin and catenin complexes in MDCK-Sna-Ecad cells. Cells were lysed and subjected to immunoprecipitation with an anti-myc antibody to precipitate ectopically expressed E-cadherin. Immunoprecipitates were subjected to immunoblot analysis using the indicated antibodies.

 


View larger version (82K):

[in a new window]
 
Fig. 8. Cessation of Snail expression reversed the mesenchymal phenotype into an epithelial phenotype. (A) MDCK cells expressing low levels of Snail (MDCK-Sna-L) and revertant cell lines lacking Snail expression were immunostained with the indicated antibodies. (B) Snail and E-cadherin expression were examined by immunoblotting. Owing to low expression levels, HA-tagged Snail proteins were collected with an anti-HA antibody and then subjected to immunoblot analysis. (C) The Snail-HA gene and the positions of the primers used to detect the transgene. The following specific primers were used. Snail 5' primer, ACTATGCCGCGCTCTTTCCTC and HA 3' primer, GTCGTAGGGGTA GCCGATATC. (D) Detection of the transgene. PCR was performed on genomic DNA isolated from the three A431 cell lines indicated. The transgene could not be detected in A431-Sna-L revertant cells.

 





© The Company of Biologists Ltd 2004