spacer gif spacer gif spacer gif spacer gif Propose a workshop for 2011 spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jiménez-Cervantes, C.
Right arrow Articles by García-Borrón, J. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jiménez-Cervantes, C.
Right arrow Articles by García-Borrón, J. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Journal of Cell Science 114, 2335-2344 (2001)
© 2001 The Company of Biologists Limited


RESEARCH ARTICLE

Inhibition of melanogenesis in response to oxidative stress: transient downregulation of melanocyte differentiation markers and possible involvement of microphthalmia transcription factor

Celia Jiménez-Cervantes, María Martínez-Esparza, Cristina Pérez, Nicole Daum, Francisco Solano and José Carlos García-Borrón*

Department of Biochemistry and Molecular Biology, School of Medicine, University of Murcia, Apto 4021, Campus de Espinardo, 30100 Murcia, Spain

*Author for correspondence (e-mail: gborron{at}um.es)

Accepted March 19, 2001


    SUMMARY
 Top
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
H2O2 and other reactive oxygen species are key regulators of many intracellular pathways. Within mammalian skin, H2O2 is formed as a byproduct of melanin synthesis, and following u.v. irradiation. We therefore analyzed its effects on melanin synthesis. The activity of the rate-limiting melanogenic enzyme, tyrosinase, decreased in H2O2-treated mouse and human melanoma cells. This inhibition was concentration- and time-dependent in the B16 melanoma model. Maximal inhibition (50-75%) occurred 8-16 hours after a 20 minute exposure to 0.5 mM H2O2. B16 cells withstand this treatment adequately, as shown by a small effect on glutathione levels and a rapid recovery of basal lipid peroxidation levels. Enzyme activities also recovered, beginning to increase 16-20 hours after the treatment. Inhibition of enzyme activities reflected decreased protein levels. mRNAs for tyrosinase, tyrosinase-related protein 1, dopachrome tautomerase, silver protein and melanocortin 1 receptor also decreased after H2O2 treatment, and recovered at different rates. Downregulation of melanocyte differentiation markers mRNAs was preceded by a decrease in microphthalmia transcription factor (Mitf) gene expression, which was quantitatively similar to the decrease achieved using 12-O-tetradecanoylphorbol-13-acetate. Recovery of basal Mitf mRNA levels was also observed clearly before that of tyrosinase. Therefore, oxidative stress may lead to hypopigmentation by mechanisms that include a microphthalmia-dependent downregulation of the melanogenic enzymes.

Key words: Melanogenesis, Oxidative stress, Hydrogen peroxide, Hypopigmentation, Microphthalmia


    INTRODUCTION
 Top
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Mammalian pigmentation results from the synthesis and accumulation of photoprotective epidermal melanins. Melanins are formed from the amino acid precursor L-tyrosine within specialized cells: the melanocytes. The melanogenic pathway involves the formation and polymerization of reactive o-quinones. Its first and rate-limiting step is the conversion of L-tyrosine into L-dopaquinone (Cooksey et al., 1997). This reaction is catalyzed by tyrosinase (Tyr, monophenol monooxygenase, EC 1.14.18.1), a copper-containing, membrane-bound glycoprotein located in specialized organelles, the melanosomes. In the absence of cysteine or related thiol compounds, dopaquinone is spontaneously converted into L-dopachrome, a semi-stable intermediate whose decarboxylative rearrangement produces 5,6-dihydroxyindole (DHI). Oxidation and polymerization of DHI units yields melanin. However, in the presence of dopachrome tautomerase (Dct, EC 5.3.3.12), L-dopachrome is converted into 5,6-dihydroxyindole-2-carboxylic acid, DHICA (Aroca et al., 1990). In mouse melanocytes, DHICA is oxidized by tyrosinase-related protein 1 (Tyrp1) to an unstable o-quinone that further polymerizes and is incorporated into the eumelanin polymer (Jiménez-Cervantes et al., 1994; Kobayashi et al., 1994).

Tyr, Tyrp1 and Dct are highly related proteins encoded for by homologous genes mapping to the albino, brown and slaty loci, respectively. They share several structural properties, such as the ability to bind metal ion co-factors (Furumura et al., 1998), and the association to the melanosomal membrane. Moreover, a strong intermolecular association involving Tyrp1 and Tyr has been demonstrated (Jiménez-Cervantes et al., 1998) that may have functional effects through the stabilization of Tyr (Kobayashi et al., 1998). Interestingly, the rate of transcription of the Tyr, Tyrp1 and Dct genes is mainly controlled by the microphthalmia basic helix-loop-helix-leucine zipper transcription factor (Mitf), whose function and expression is regulated by several signaling pathways (Hemesath et al., 1994; Hemesath et al., 1998; Bentley et al., 1994; Yasumoto et al., 1994; Bertolotto et al., 1996; Bertolotto et al., 1998a; Price et al., 1998a; Price et al., 1998b). Thus, Mitf plays a key role in melanocyte differentiation, as demonstrated by the acquisition of melanocytic characteristics by fibroblasts transfected with Mitf cDNA (Tachibana et al., 1996).

The polymerization reactions involving quinonic melanogenic intermediates are spontaneous, and lead to the formation of H2O2 as a by-product. In support of this view, several oxidative reactions of melanin precursors are inhibited by catalase (d’Ischia et al., 1991). Moreover, the generation of H2O2 during the oxidation of the melanogenic precursors DHICA and DHI has been demonstrated in vitro (Nappi and Vass, 1996), and H2O2 production by human melanoma cells in culture has also been observed (Bittinger et al., 1998). H2O2 and other reactive oxygen species (ROS) play important roles in the regulation of many intracellular pathways. The mechanisms that underlie this regulatory action are multiple and, often, still poorly understood. ROS have been shown to activate intracellular kinases (Fialkow et al., 1994; Brumell et al., 1996; Bae et al., 1999), to induce protein-tyrosine phosphatases (Keyse and Emslie, 1992), and to control the activity and/or expression of a variety of transcription factors and early-response genes (Brumell et al., 1996; Schreck et al., 1991; Nose et al., 1991; Nose and Ohba 1996; Pinkus et al., 1996). An activation of the ubiquitin-dependent proteolytic pathway after oxidative stress has also been described (Shang et al., 1997). Interestingly, the intracellular levels of H2O2 and other ROS increase in several cellular systems in response to external stimuli, including growth factors such as epidermal growth factor (Bae et al., 1997), platelet-derived growth factor (Sundaresan et al., 1995); cytokines such as tumor necrosis factor {alpha} (TNF{alpha}) and transforming growth factor ß (TGFß) (Meier et al., 1989; Hennet et al., 1993; Thannickal et al., 1993; Ohba et al., 1994; Thannickal and Fanburg, 1995; Lo and Cruz 1995; Chen et al., 1995; Lo et al., 1996). These cytokines are potent inhibitors of melanogenesis in B16 melanoma cells and human melanocytes (Swope et al., 1991; Martínez-Esparza et al., 1997; Martínez-Esparza et al., 1998).

Given the involvement of H2O2 in central regulatory processes, and its generation during melanogenesis, as a result of u.v. irradiation (Peus et al., 1999), or in response to the hypopigmenting cytokines, it was of interest to study its effects on melanocytes. We show that a short exposure of melanocytes to H2O2 markedly and transiently decreases the melanogenic activities. Using the well-established B16 mouse melanoma model, we have found that this inhibitory effect is accounted for by decreased protein and mRNA levels. A likely mechanism for the transient reduction of Tyr and other melanocyte-specific proteins is a decreased rate of transcription that results from downregulation of the Mitf transcription factor, although the occurrence of post-translational effects is also possible. This effect of H2O2 probably provides the melanogenic pathway with an internal feedback mechanism that may contribute to the fine tuning of melanin synthesis.


    MATERIALS AND METHODS
 Top
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Cell culture and treatments
B16 mouse melanoma cells were cultured in MEM with 10% FCS (fetal calf serum), 2 mM glutamine, 100 U/ml penicillin and 100 µg/ml streptomycin. The human melanoma cells SCL and BEU (a gift from Prof. G. Ghanem, Free University of Brussels, Belgium) were cultured in HAMS-F10 supplemented with 5% FCS, 5% newborn calf serum, 2 mM glutamine, 100 U/ml penicillin, 100 µg/ml streptomycin sulphate and 100 µg/ml kanamycin sulphate (all from Gibco, Paisley, UK). All cultures were performed in a water-saturated atmosphere with 5% CO2. For H2O2 treatment, semiconfluent cells were washed with Hank's balanced salt solution, and then pulsed with H2O2 diluted in Hank’s solution, at concentrations ranging from 0.1 to 1.0 mM for up to 40 minutes. The H2O2 solution was then removed and cells were further incubated in fresh medium for up to 48 hours. Control cells were treated in parallel with Hank’s solution devoid of H2O2. For treatment with 12-O-tetradecanoylphorbol-13-acetate (TPA), semiconfluent B16 cells were incubated in serum-free medium for 24 hours. Then TPA (40 nM) was added, and the cells were further incubated for the appropriate times.

Determination of total and oxidized glutathione and lipid peroxidation markers
Total, reduced and oxidized glutathione were determined by a kinetic recycling assay based on the Ellman’s reagent (5,5'-dithiobis-2-nitrobenzoic acid, DTNB) and reduction of oxidized glutathione with glutathione reductase in the presence of NADPH (Griffith, 1980).

Lipid peroxidation was assessed by measuring the concentration of malondialdehyde (MDA), as this is, in most instances, the major lipid-derived aldehyde formed upon oxidation of biological samples (Brown and Kelly, 1996). The procedure has been described previously (Yagi, 1984), and involves the formation of a fluorescent adduct between MDA and thiobarbituric acid (TBA). Control and H2O2-treated cells were harvested with trypsin and resuspended in PBS. An aliquot was preserved for protein determination. To prevent further lipid oxidation, 5 µl of butylated hydroxytoluene and 1 µl of 2 mM desferroxiamine were added to 100 µl of the cell suspension placed in sealed glass tubes. After sonication for 5 minutes, and addition of 2 ml of 4 M H2SO4 and 0.25 ml of phosphotungstic acid (10% w/v), samples were vigorously mixed, kept for 5 minutes at room temperature and centrifuged at 2000 g, 10 minutes. The supernatant was removed and the procedure was repeated with 1ml H2SO4 and 0.15 ml of phosphotungstic acid. The resulting pellet was resuspended in 2 ml isotonic NaCl, to which 0.5 ml of the TBA acid reagent (46.5 mM TBA in 50% acetic acid) were added. The capped tubes were vortexed, heated at 95°C for 1 hour and cooled on ice. The reaction mixture was extracted with 2.5 ml of n-butanol. The fluorescence of the butanol phase was measured in a Hitachi F-4500 fluorimeter (excitation at 515 nm and emission at 553 nm). Known amounts of MDA were treated in parallel, and used as standards.

Enzyme activity determinations
Cells were washed with Hank’s solution, trypsin harvested and counted before solubilization in 1% Igepal CA-630, 0.1 mM PMSF in 10 mM phosphate buffer (pH 6.8). Tyrosine hydroxylase activity was determined by a radiometric method (Jara et al., 1988), and dopa oxidase activity according to Winder and Harris (Winder and Harris, 1991). Activity units are defined as the amount of enzyme transforming 1 µmol of substrate/minute.

Immunochemical techniques
Western blotting was performed as described (Martínez-Esparza et al., 1997; Martínez-Esparza et al., 1998), using the specific antisera {alpha}PEP1 (anti-Tyrp1) and {alpha}PEP7 (anti-Tyr), a gift from Prof. V. Hearing (NIH, Bethesda, MD).

Northern blotting
Total RNA was isolated with guanidinium thiocyanate, and purified by cesium chloride gradient centrifugation. Before electrophoresis, RNA was denatured for 1 hour at 55°C with glyoxal and dimethylsulfoxide. Identical amounts (usually 10 µg) were electrophoresed on 1.5% agarose gels in 10 mM sodium phosphate buffer, pH 7.0. Comparable loading was ascertained by Acridine Orange staining of the gels before diffusion blotting to Hybond nylon membrane (Amersham) using 20xSSC (3 M NaCl, 0.3 M sodium citrate). Prehybridization and hybridization conditions, as well as the probes used for detection of Tyr, Tyrp1, Dct and Gapdh gene expression have been described elsewhere (Martínez-Esparza et al., 1997; Martínez-Esparza et al., 1998). The remaining probes were for: the silver locus gene, 839 bp fragment corresponding to the 3' portion of the coding sequence (Martínez-Esparza et al., 1999); Mc1r, 1003 bp fragment covering the complete coding sequence of the receptor gene (Loir et al., 1999); and Mitf, 1.3 kb PCR fragment obtained with primers AAGTGGTCTGCGGTGTCTCC (forward) and AAGGCAGGCTCGCTAACACG (reverse), whose identity was ascertained by restriction mapping. The GAPDH probe was used as control for comparable loading, transfer and normalization of phosphor-imaging data.

Semi-quantitative RT-PCR
First strand cDNA synthesis was performed with the Superscript kit (Gibco) as per instructions, using a starting amount of 0.5 µg of total RNA. Preliminary PCR runs were performed to determine the volume of the different cDNA preparations yielding comparable bands with a commercial primer set that was specific for GAPDH (from Clontech, Palo Alto, CA). Then, the appropriate amounts of cDNA were amplified in parallel with the Mitf-specific primers described above for the preparation of the Mitf probe, and with the GAPDH-specific primers. Care was taken to ascertain that the reactions were run in the exponential phase. Suitable aliquots were electrophoresed in 1% agarose gels and ethidium bromide stained. The intensity of the bands was quantified in a Gel Doc system (BioRad) using the Multi-Analyst software.

Other procedures
Protein concentration was measured with the bicinchoninic acid method using BSA as a standard. Melanin concentrations were determined by hydrolysis in 0.85 N KOH, at 100°C, followed by measurement of absorbance at 400 nm and extrapolation from a calibration curve obtained with synthetic melanin (Sigma, St Louis, MO), that was treated in parallel.


    RESULTS
 Top
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Effects of H2O2 challenge on the tyrosine hydroxylase activity of human and mouse melanoma cells
The effects of a short pulse with H2O2 on the melanogenic pathway were investigated in B16 mouse melanoma cells, and SCL and BEU human melanoma cells. H2O2 inhibited the rate-limiting step of the melanogenic pathway in all three cell lines, although to different extents (Fig. 1). Inhibition was maximal between 8 and 16 hours after the oxidative challenge, and thereafter, the enzymatic activity recovered to reach pre-treatment values (shown below). Although the human melanoma cells were more resistant to H2O2, a reproducible inhibition of the tyrosine hydroxylation rate was also observed. The highly responsive and well-characterized B16 mouse melanoma cells were selected for further study, and all the experiments described below refer to this cell line.



View larger version (15K):
[in this window]
[in a new window]
 
Fig. 1. Inhibition of the tyrosine hydroxylase activity of mouse and human melanoma cells by H2O2. B16 mouse melanoma and SCL and BEU human melanoma cells were exposed to 1 mM H2O2 for 20 minutes, and then allowed to recover in H2O2-free medium for 8 or 16 hours. Cells were harvested, solubilized in 1% Igepal CA-630 and the tyrosine hydroxylase and protein content of the samples was analyzed. Results are expressed as mean±s.d. of three independent experiments. The tyrosine hydroxylase-specific activities (in µU/mg protein) of controls, treated as the 8 hours time point, were: 79±27, 170±22 and 303±27, for BEU, SCL and B16 melanoma cells, respectively.

 
Time and concentration dependence of inhibition by H2O2 of the melanogenic activities
The inhibitory effect of H2O2 on the tyrosine hydroxylase activity of B16 melanoma cells was concentration dependent. It was noticeable at moderate H2O2 concentrations (0.1 mM) and reached a plateau at concentrations higher than 0.5 mM (Fig. 2A). The effect of H2O2 on the dopa oxidase activity was similar (not shown).



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 2. Dose dependence of H2O2 inhibition of tyrosine hydroxylase activity and effect of the length of the oxidative challenge. (A) Semiconfluent B16 melanoma cells were challenged for 20 minutes with varying concentrations of H2O2, and allowed to recover in fresh medium for 16 hours before enzyme activity and protein concentration determinations. Results shown are the mean±s.d. for three independent experiments. (B) Cells were exposed to H2O2 (0.5 mM) for the times shown and allowed to recover for 8 hours before determination of their tyrosine hydroxylase- ({blacksquare}) and dopa oxidase- ({blacktriangleup}) specific activities. Results are the mean±s.d. of at least three independent experiments.

 
We next analyzed the influence of the length of the oxidative challenge. A maximal effect was reached with a 20 minutes treatment, without further inhibition by increasing the incubation time in the presence of H2O2 for up to 40 minutes (Fig. 2B). Again, the decrease of the dopa oxidase and tyrosine hydroxylase activities followed a similar kinetics.

Since tyrosine hydroxylation is the rate-limiting melanogenic step, an inhibition of this reaction should result in a reduced rate of melanin formation. In fact, cell pellets from samples allowed to recover for 16 to 24 hours after the oxidative challenge were consistently found, upon visual inspection, to have a lighter color than the corresponding controls. Therefore, we treated melanocytes with H2O2, and determined the evolution of their melanin contents after the oxidative shock (Fig. 3). Melanin concentration decreased by as much as 75%. This decrease was still observed 24 hours after the treatment. This was not due to artifacts arising from direct bleaching of melanin by H2O2, as model melanin in suspension submitted to an identical treatment before its quantification gave identical results to untreated, control melanin (not shown). The sharp decrease in the cellular melanin to protein ratio observed between 6 and 16 hours can be partially explained by dilution of pre-existing pigment within the cell population, under conditions of drastically reduced de novo pigment formation. Consistent with this possibility, cellular proliferation stopped in H2O2-treated cells within roughly 10 hours of the oxidative shock. Thereafter, the cells recovered a normal growth rate (Fig. 3B). However, the magnitude of the decrease in melanin content suggests the contribution of other effects, such as indirect bleaching by secondary oxidation products arising from the reaction of H2O2 with cellular components, or increased pigment release from H2O2-treated cells.



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 3. Decreased melanin contents in B16 melanoma cells treated with H2O2. (A) Cells challenged with H2O2 (0.5 mM, 20 minutes) were allowed to recover for the times shown. After harvesting with trypsin, the cells were solubilized in 1% Igepal CA-630 and centrifuged at 20,000 g, for 30 minutes. Protein concentration was determined in the supernatant, and total melanin was measured by KOH hydrolysis of the insoluble pellet. Results are the mean±s.d. of three independent experiments. (B) Growth kinetics of H2O2-treated cells. 4x104 cells were seeded in six-well plates, in sets of triplicate wells, and incubated for 24 hours in the complete medium described in Materials and Methods. Then the cells were challenged with H2O2 (0.5 mM, 20 minutes) or with Hank’s solution, and further incubated in complete medium from 1 to 24 hours. After trypsinization, the number of viable cells was determined by Trypan Blue exclusion. Open symbols, H2O2-treated cells; closed symbols, control cells. Results are shown as mean ± s.d. of triplicate wells.

 
Decreased enzyme levels account for the inhibition of melanogenic activities
To analyze a possible relationship between inhibition of the melanogenic activities and decreased enzyme levels, cells were treated with H2O2 and then cultured several times before comparison of enzyme contents by western blot (Fig. 4). Both Tyr and Tyrp1 were decreased by H2O2, to residual levels approximately 30% of control values, after 8 or 16 hours of recovery. These variations in the intracellular levels of the melanogenic enzymes matched reasonably well the observed changes in enzyme activity. Therefore, the inhibition of melanogenic activities by H2O2 most probably results from decreased Tyr and Tyrp1 levels, rather than from a negative modulation of their specific activity. Interestingly, the kinetics of enzyme downregulation were different for Tyr and Tyrp1, in that both the initial decline and the subsequent recovery were faster for Tyr.



View larger version (47K):
[in this window]
[in a new window]
 
Fig. 4. Decreased Tyr and Tyrp1 contents in H2O2-challenged B16 melanoma cells. (A) Cells were challenged with H2O2 (0.5 mM, 20 minutes), allowed to recover for the times shown, trypsin-harvested and solubilized. Equal amounts of protein (30 µg/lane) were electrophoresed on 9% SDS-PAGE gels and transferred to PVDF membranes. The blots were probed with {alpha}PEP1 (anti-Tyrp1, first panel) and {alpha}PEP7 (anti-Tyr, second panel), and stained with a chemiluminescent substrate (Amersham Pharmacia Biotech, Buckinghamshire, UK). Comparable loading and transfer was ascertained by cutting the lower portion of the blot and staining for total protein with Amido Black (lower panel). Similar trends were obtained in three independent experiments. C, control. Separate controls are included for cells grown for 16 and 24 hours after the oxidative challenge, as a density-dependent increase in melanocyte differentiation markers is often observed (Hornyak et al., 2000). (B) Densitometric quantification of immunoblots. Blots were quantified in a laser densitometer. The results shown represent the relative abundance of Tyr (white bars) and Tyrp1 (black bars), with respect to controls collected at 1 (for time points up to 8 hours), 16 and 24 hours, and are the mean±s.d. for three experiments.

 
B16 melanoma cells withstand well the oxidative challenge and can recover their melanogenic potential
Although a variety of cells from different origins have been shown to withstand adequately oxidative treatments similar to those used in this study (Brumell et al., 1996; Bae et al., 1999; Nose et al., 1991; Nose and Ohba, 1996; Pinkus et al., 1996), the possibility that the inhibition of the melanogenic pathway could be a nonspecific effect that is due to extensive cellular damage was considered. We therefore examined the effects of H2O2 challenge on two markers of cellular oxidative stress, namely glutathione (total and oxidized) and the lipid peroxidation product MDA.

The levels of total glutathione in H2O2-challenged melanocytes moderately decreased by about 20% with respect to control values in the first 5 minutes, but recovered rapidly, and were even slightly higher than pretreatment levels by 15 minutes (Fig. 5A). This trend was maintained over the next hours, and values about 250% of pre-treatment levels were reached 6 hours after the challenge. However, the levels of oxidized glutathione were barely detectable by the analytical procedure employed, and never reached 5% of total glutathione. Therefore, the evolution of total glutathione concentration shown in Fig. 5 can be approximately equated to the one of reduced glutathione. The concentration of the lipid peroxidation marker MDA increased approximately twofold 2 hours after the treatment, but pre-treatment levels were subsequently restored (Fig. 5B), and after 24 hours of recovery they were slightly lower than controls. These data, together with the recovery of a normal growth rate soon after the oxidative shock shown in Fig. 3B, show that B16 melanoma cells can rapidly restore the intracellular redox status and even increase their antioxidant defense mechanisms after an oxidative stress.



View larger version (16K):
[in this window]
[in a new window]
 
Fig. 5. Levels of total glutathione and the lipid peroxidation marker MDA in H2O2-treated cells. Cells were pulsed with H2O2 (0.5 mM, 20 minutes), and allowed to recover in H2O2-free complete medium for up to 24 hours. (A) Evolution of total glutathione during recovery after oxidative challenge. H2O2-pulsed cells were harvested by trypsin treatment. An aliquot was saved for solubilization and protein determination. The remaining cell suspension was centrifuged and solubilized in 131 mM 5-sulfosalicylic acid for determination of total, reduced and oxidized glutathione. Results are shown as % values with respect to control cells, harvested with the 5 minutes time point, whose glutathione contents was 29±13 pmol/µg protein, and are the mean±s.d. for at least three independent experiments. (B) Lipid peroxidation in H2O2-challenged cells. Cells were treated with 0.5 mM H2O2 (20 minutes), and allowed to recover for the times shown before determination of their MDA contents. Results are expressed as % of controls treated in parallel, but without H2O2 and are the mean±s.d. for three independent experiments.

 
As the effects of H2O2 treatment on oxidative stress markers were transient, the rate of recovery of the melanogenic activities was also analyzed. Tyrosine hydroxylase and dopa oxidase activities began to increase approximately 16 hours after H2O2 treatment (Fig. 6). This recovery was slow in that both activities remained lower than in control cells 24 hours after the treatment but reached pre-treatment levels 48 hours after the oxidative shock. Moreover, the recovery of the melanogenic activities could be accounted for by the restoration of the intracellular concentration of Tyr protein (Fig. 6, inset).



View larger version (17K):
[in this window]
[in a new window]
 
Fig. 6. Kinetics of downregulation of the melanogenic activities and recovery of basal activity levels 48 hours after the oxidative challenge. Cells were pulsed for 20 minutes with H2O2 (0.5 mM) and allowed to recover in complete medium for up to 48 hours. The dopa oxidase () and tyrosine hydroxylase ({blacksquare}) activities of solubilized extracts were measured. The results shown are the mean±s.d. for three independent experiments. Controls for calculation of the % residual activity were collected with the 8, 16, 24 and 48 hours time points. The inset shows the changes in tyrosinase protein levels at 8 and 48 hours, assessed by western blot with {alpha}PEP7 as primary antibody, after separation by 12% SDS-PAGE.

 
H2O2 downregulates the mRNAs for several melanocyte differentiation markers
We next wanted to examine whether the decrease in the intracellular levels of the melanogenic enzymes was due to an inhibition of gene expression, and whether this possible effect was restricted to Tyr and Tyrp1 or could also be observed for other melanocyte differentiation markers. Therefore, we performed northern blots of total RNA from cells treated with H2O2 and then cultured for 8 or 16 hours. The results are shown in Fig. 7.



View larger version (19K):
[in this window]
[in a new window]
 
Fig. 7. Northern blot analysis of mRNA levels for five melanocyte differentiation markers in H2O2-challenged B16 melanoma cells. (A) Representative blots, performed with 10 µg of total RNA from control cells (C), treated exactly as the 8 hours time point or cells treated with H2O2 (0.5 mM, 20 minutes) and allowed to recover for 8 or 16 hours. The blots were probed for Tyr, Dct, Tyrp1, silver, Mc1r and ODC mRNA, as indicated, as well as for GAPDH (shown below each lane). Blots were performed in triplicate for Tyr, Dct, Tyrp1 and ODC, and in duplicate for the silver locus product and for Mc1r. (B) Quantification of mRNA variations. Northern blots were quantified by phosphorimaging, in a BioRad GS-525 Molecular Imager. The results, corrected for loading by comparison to the GAPDH signal, are shown as % expression with respect to the control untreated cells, and are the mean±s.d. for the mRNA species analyzed in triplicate (Tyr, Dct, Tyrp1 and ODC). For these species, the statistical significance of the variations was analyzed by calculating two-tailed P values by means of an unpaired Student’s t-test, using the Prism software. *, P<0.01. For the species analyzed in duplicate (silver and Mc1r), the values given are the mean±range for the two determinations, and no statistical analysis was performed.

 
Tyr mRNA levels dropped to 65% of controls 8 hours after the H2O2 challenge, and then recovered to 95% by 16 hours. The kinetics for Tyrp1 mRNA changes were different. Tyrp1 mRNA dropped to 60% of controls by 8 hours of recovery and their recovery was slower than for tyrosinase mRNA. H2O2-mediated downregulation of mRNA levels was not restricted to Tyr and Tyrp1. It was also observed for three other melanocyte-specific genes, encoding for Dct, the silver protein gp87, and the Mc1r. Interestingly, the kinetics of the mRNA changes were similar for Tyr and Mc1r on one hand, and for Tyrp1, Dct and the silver protein on the other. The recovery of basal levels for Tyr and Mc1r mRNAs, coupled to the rapid and strong H2O2-mediated upregulation of the mRNA levels for ornithine decarboxylase (Fig. 7) prove that the inhibitory effect on the five melanocyte-differentiation markers is not due to an impairment of the transcriptional machinery or on other nonspecific effects.

H2O2 rapidly and transiently represses Mitf transcription factor mRNA
Mitf has been identified as the major transcriptional regulator of the melanocyte-specific genes encoding for Tyr, Tyrp1 and Dct (Hemesath et al., 1994; Hemesath et al., 1998; Bentley et al., 1994; Yasumoto et al., 1994; Bertolotto et al., 1996; Bertolotto et al., 1998a; Price et al., 1998a; Price et al., 1998b; Tachibana et al., 1996). Therefore, the kinetics of changes in Mitf mRNA levels following an H2O2 challenge were next analyzed by northern blot. For comparison, B16 melanoma cells were treated with TPA. This phorbol ester has been shown to downregulate melanogenesis by decreasing Mitf transactivating activity (Bertolotto et al., 1998b). Moreover, and as a positive control for Mitf responsiveness, B16 melanoma cells were also treated with {alpha}-melanocyte stimulating hormone ({alpha}MSH) or forskolin, two potent inducers of Mitf gene expression (Price et al., 1998b).

The inhibition of the melanogenic activities achieved by TPA treatment was similar to the one observed after H2O2 challenge. Residual tyrosine hydroxylase and dopa oxidase activities were near 30% of controls 16 hours after addition of TPA (not shown). The levels of Mitf mRNA dropped rapidly after H2O2 treatment, to about 30% of control values 1 hour after the challenge, but were already rising after 8 hours of recovery (Fig. 8A). Mitf mRNA downregulation mediated by TPA was quantitatively similar, but the inhibitory effect of TPA was more persistent. Accordingly, the TPA-dependent inhibition of the melanogenic activities was very similar when measured 16, 24 or 48 hours after addition of TPA.



View larger version (32K):
[in this window]
[in a new window]
 
Fig. 8. Downregulation of Mitf mRNA levels in B16 melanoma cells following oxidative stress. (A) B16 cells were challenged with 0.5 mM H2O2 for 20 minutes and allowed to recover in complete medium for up to 8 hours. For TPA treatment, the agent was kept in the medium at a final concentration of 40 nM throughout the experiment, and cells were incubated for times ranging from 0.5 to 8 hours, as indicated on top of each lane. The levels of Mitf mRNA were analyzed by Northern blot. GAPDH mRNA was also analyzed for normalization. C, control untreated cells. Note that the maximal downregulation of Mitf mRNA is similar for TPA and H2O2 treatments. Similar trends were obtained in two independent experiments. (B) Quantification of Mitf mRNA variations. Blots were quantified as described in Fig. 7. The results shown correspond to % expression with respect to control cells, and are the mean±range for two determinations. (C) B16 cells were stimulated with the superpotent {alpha}MSH analogue [Nle4, D-Phe7]-{alpha}MSH (Sigma, St Louis, MO), at a final concentration of 100 nM, or with the adenylate cyclase stimulator forskolin (10 µM). Cells were harvested 2 hours after addition of the agents, and Mitf expression was analyzed by Northern blot. C, control; M, {alpha}MSH-treated cells; F, forskolin-treated cells. (D) Semiquantitative RT-PCR analysis of Mitf mRNA levels in H2O2-challenged B16 cells. Cells were treated with H2O2, as in A, and allowed to recover for 1, 2, 4 and 8 hours, as indicated. Total RNA was extracted, and cDNA was prepared. Equivalent amounts of cDNA were amplified with primers specific for Mitf and Gapdh, as a control for comparable loading of target cDNA. The reaction mixtures were analyzed by agarose gel electrophoresis. C, control; the lane on the right shows markers of the indicated size.

 
Consistent with reports by others, using B16 and human melanoma cells, as well as normal melanocytes (Price et al., 1998b), Mitf mRNA was rapidly upregulated by {alpha}MSH and forskolin (Fig. 8B). This shows that the mechanisms of Mitf regulation operating in normal melanocytes are functional in the B16 mouse melanoma cells used in this study.

As basal levels of Mitf mRNA were quite low and, therefore, further decreases were difficult to quantitate accurately by Northern blot, we wished for confirmation of the data described above by means of a semiquantitative RT-PCR approach. As shown in Fig. 8C, Mitf gene expression dropped strongly and transiently after H2O2 challenge. Maximal inhibition (about 25% residual levels) was observed between 1 and 2 hours after the treatment, and recovery was essentially complete 8 hours after the oxidative challenge. These results fully confirm the decrease in Mitf gene expression observed by northern blot.


    DISCUSSION
 Top
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
ROS play key roles in the regulation of proliferation and differentiation of many cell types. Where epidermal melanocytes are concerned, the potential regulatory roles of ROS might be particularly important, as (1) ROS are generated in epidermal cells following u.v. irradiation (Peus et al., 1999), a normal tanning stimulus but also the main etiological factor for skin cancer; (2) H2O2 is a normal byproduct of the melanogenic pathway (Nappi and Vass, 1996); (3) in several cellular systems, H2O2 acts as an intracellular second messenger for TNF{alpha} and TGFß (Meier et al., 1989; Hennet et al., 1993; Thannickal et al., 1993; Ohba et al., 1994; Thannickal and Fanburg, 1995; Lo and Cruz, 1995; Chen et al., 1995; Lo et al., 1996), two cytokines that have been shown to exert a strong inhibition of melanogenesis in both B16 mouse melanoma cells and normal human melanocytes (Swope et al., 1991; Martínez-Esparza et al., 1997; Martínez-Esparza et al., 1998); and (4) the generation of ROS and/or the resulting increase in lipid peroxidation products have been proposed as etiological factors for de-pigmentary natural processes such as hair graying (Nordlund and Abdel-Malek, 1988), and several pathological conditions, like vitiligo (Passi et al., 1998). Moreover, imbalances of the normal antioxidant mechanisms are common in human melanoma cells (Bravard et al., 1998). However, little attention has been paid to the effects of oxidative stress on the rate of melanogenesis and the expression of specific differentiation markers, using well-defined cellular models.

The results presented here demonstrate that a short pulse with H2O2 inhibits melanogenesis in B16 mouse melanoma cells, as well as in two human melanoma cell lines. In the B16 mouse melanoma model, this inhibition is not related to a severe cellular damage, as treatment conditions with a strong inhibitory action are adequately withstood by the cells. Under the standard conditions employed, cell viability is maintained, oxidized glutathione never exceeds 5% of total glutathione, and normal lipid peroxidation levels are rapidly restored after the oxidative shock. Moreover, B16 melanoma cells appear to respond actively to the oxidative challenge by increasing their intracellular concentration of glutathione, and they are highly resistant to oxidative lysis unless their glutathione pool is depleted prior to an exposure to H2O2 (Peinado et al., 1992). Therefore, B16 melanoma cells and most likely other melanocytes seem to possess active defense mechanisms to prevent oxidative damage. Accordingly, melanoma cells are highly resistant to radiation therapy (Sarna et al., 1986) and to chemotherapy with drugs whose cytotoxic action is dependent on redox cycling (Pezzuto et al., 1988). This resistance of melanocytes to oxidative damage is consistent with the normal generation of ROS in the skin mentioned above, and may make melanocytes a particularly interesting model to study ROS-mediated regulatory pathways.

In addition to the lack of significant cytotoxicity, the range of H2O2 concentrations employed in this report could be physiologically relevant. First, they are similar to those employed in other studies, and shown to activate intracellular signaling pathways and nuclear responses (Brumell et al., 1996; Bae et al., 1999; Nose et al., 1991; Nose and Ohba, 1996; Pinkus et al., 1996). Second, human melanoma cells produce superoxide radicals and H2O2 at a significant rate, even in the absence of stimulating agents. The values reported are 5 nmol H2O2/106 cells/90 minutes (Bittinger et al., 1998), and should be higher under conditions of active melanogenesis, after u.v. irradiation or hormonal stimulation.

Concerning the mechanisms of H2O2-mediated inhibition of melanogenesis, the decreases in Tyr and Tyrp1 proteins following the oxidative challenge adequately account for the reduction in the velocity of the rate limiting step of the pathway. Therefore, inhibition of melanin formation most likely results from decreased enzyme levels, rather than from a modulation of the specific activity of Tyr and/or Tyrp1. In turn, our data suggest that downregulation of the Tyr and Tyrp1 proteins is exerted, at least partially, by transcriptional regulation. Indeed, 8 hours after the treatment, a significant decrease in the corresponding mRNAs was observed. Moreover, Tyr mRNA levels begin to return to control values by 16 hours after the oxidative challenge, thus preceding the recovery of Tyr protein and enzyme activity pre-treatment levels. However, the abundance of Tyr and Tyrp1, and the associated enzymatic activities are reduced rapidly and more strongly than the corresponding mRNA species. Therefore, a comparison of the levels of Tyr and Tyrp1 proteins on one hand, and mRNAs on the other, suggests that post-translational effects such as a decrease in the intracellular stability of the proteins may also contribute to the inhibitory action of H2O2. Consistent with this possibility, the fall in Tyr abundance is rapid, already noticeable 1 hour after the oxidative challenge. Moreover, we have previously found that the hypopigmenting cytokines TGFß and TNF{alpha} decrease the half-life of enzymatically active tyrosinase in B16 melanocytes (Martínez-Esparza et al., 1997; Martínez-Esparza et al., 1998), and H2O2 has been characterized as a second messenger for these cytokines in several cellular systems, as discussed above.

However, several observations point to Mitf downregulation as a mechanism underlying the inhibition of melanogenesis by H2O2. First, Mitf mRNA reduction is strong and observed clearly before the downregulation of the mRNAs for the melanocyte differentiation markers, including Tyr and Tyrp1, as shown both by northern blot and semiquantitative RT-PCR. Second, recovery of normal Mitf levels also precedes the increase in Tyr mRNA, enzyme activity and protein towards pre-treatment levels. Third, the inhibitory effects of H2O2 treatment are observed coordinately for the five melanocyte-specific genes studied in this report: Tyr, Tyrp1, Dct, Mc1r and silver. Mitf has been shown to be a major transactivating factor for the Tyr and Tyrp1 genes (Bentley et al., 1994; Yasumoto et al., 1994; Bertolotto et al., 1996; Bertolotto et al., 1998a; Price et al., 1998a; Aksan and Goding, 1998) and to control the rate of expression of Dct (Bertolotto et al., 1998a) and Mc1r (Moro et al., 1999, Adachi et al., 2000). Although there is no direct evidence for a role of Mitf in the regulation of silver gene expression, our results and the known inducibility by {alpha}MSH and cAMP elevating agents allow us to predict that Mitf-binding elements will be found in the silver gene promoter. Moreover, a possible involvement of Mitf in the regulation of the silver locus gene expression has also been suggested by others (Halaban et al., 1996). And fourth, TPA, which inhibits melanogenesis in B16 melanoma cells through a diminution of Mitf binding to the Tyr promoter (Bertolotto et al., 1998b), reduces Mitf mRNA levels to a similar extent to H2O2. This suggests that the downregulation of Mitf expression reported here is sufficient to decrease its transactivating activity.

Therefore, our data strongly suggest that H2O2-mediated downregulation of Mitf results in a decreased expression of Mitf-controlled melanocyte-specific genes, and hence in an inhibition of melanogenesis. As Mitf probably plays a key role not only in the control of differentiation, but also in melanocyte survival (Tassabehji et al., 1994), it is tempting to speculate that a continued inhibition of its expression by a sustained exposure to ROS may lead to melanocyte death, thus providing a molecular basis for the observed association between vitiligo and oxidative stress (Passi et al., 1998). In any case, this is the first report of a relationship between the redox status of melanocytes and Mitf expression. The nature of the signaling mechanisms leading from H2O2 to decreased Mitf gene expression remains speculative at this stage; however, several observations point to Ras activation as a possible upstream event. Ras is activated by ROS in mouse fibroblasts and other cell types (Abe and Berk, 1999). Infection of murine melanocytes with the v-Ha-Ras oncogene inhibits melanogenesis (Tsukamoto et al., 1992, Halaban et al., 1996), and Mitf has been identified as the transcription factor downregulated in ras-infected melanocytes, and responsible for their amelanotic phenotype (Halaban et al., 1996). Interestingly, Ras activation by ROS is mediated by FYN (Abe and Berk, 1999), a cytosolic tyrosine kinase present in normal melanocytes, and overexpressed in melanomas (reviewed by Easty and Bennett, 2000). Moreover, downstream effectors of Ras include the MAP kinases ERK1 and ERK2, whose specific inhibition triggers differentiation of B16 melanoma cells and increases tyrosinase gene expression (Englaro et al., 1998). However, the possible involvement of Ras as an upstream effector of H2O2-induced downregulation of melanogenesis is, at this stage, a speculation that will be the subject of further studies. It will also be interesting to compare the levels of mRNA and transactivating activity in depigmented lesions and disease-free skin.

Keeping in mind that the highly reactive intermediates of the melanogenic pathway are cytotoxic (Urabe et al., 1994), it is often considered that an uncontrolled activation of melanogenesis is potentially harmful for the melanocytes. Thus, the inhibition of the rate-limiting step in the melanogenic pathway by H2O2 might constitute a protective mechanism. As H2O2 is a by-product of the melanogenic pathway (Nappi and Vass, 1996), it may act as a suitable feedback inhibitor of the first reaction of melanogenesis, thus limiting the accumulation of toxic intermediates. This possible feedback might be particularly relevant under physiological conditions of active melanogenesis, following hormonal stimulation by {alpha}MSH, or after u.v. irradiation of the skin.

In summary, we have described an inhibitory action of H2O2 on melanogenesis. This effect is mediated by a reduction of the intracellular concentration of the melanogenic enzymes, probably achieved, at least partially, at the transcriptional level. These observations might provide the basis for a better understanding, at the molecular level, of several pigmentation disorders. However, it should be kept in mind that most of the experiments described above have been performed using B16 mouse melanoma cells as a model, and that these cells sometimes show different responses from cultured melanocytes. The fact that two human melanoma cell lines also respond to H2O2 by decreasing their melanogenic potential, supports the notion that our results reflect a general behavior of malignant melanocytes. But further work will be needed to ascertain whether our findings can be extrapolated to normal melanocytes.


    ACKNOWLEDGMENTS
 
This work was supported by grant PM99-0138 from the Comisión Interministerial de Ciencia y Tecnología (CICYT), Spain. M. M.-E. is recipient of a fellowship from Caja Murcia, Murcia, Spain and N. D. was holder of an Erasmus fellowship from the EC.


    REFERENCES
 Top
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

Abe, J. and Berk, B. (1999). Fyn and JAK2 mediate Ras activation by reactive oxygen species. J. Biol. Chem. 274, 21003-21010.[Abstract/Free Full Text]

Adachi, S., Morii, E., Kim, D., Ogihara, H., Jippo, T., Ito, A., Lee, Y. and Kitamura, Y. (2000). Involvement of mi-transcription factor in expression of alpha-melanocyte-stimulating hormone receptor in cultured mast cells of mice. J. Immunol. 164, 855-860.[Abstract/Free Full Text]

Aksan, I. and Goding, C. (1998). Targeting of Microphthalmia basic helix-loop-helix-leucine zipper transcription factor to a subset of E-box elements in vitro and in vivo. Mol. Cell. Biol. 18, 6930-6938.[Abstract/Free Full Text]

Aroca, P., García-Borrón, J. C., Solano, F. and Lozano, J. A. (1990). Regulation of distal mammalian melanogenesis. Partial purification and characterization of a dopachrome converting factor: dopachrome tautomerase. Biochim. Biophys. Acta, 1035, 266-275.[Medline]

Bae, G., Seo, D., Kwon, H., Lee, H., Hong, S., Lee, Z., Ha, K., Lee, H. and Han, J. (1999). Hydrogen peroxide activates p70S6k signaling pathway. J. Biol. Chem. 274, 32596-32602.[Abstract/Free Full Text]

Bae, Y. S., Kang, S. W., Seo, M. S., Baines, I. C., Tekle, E., Chock, P. B. and Rhee, S. G. (1997). Epidermal growth factor-induced generation of hydrogen peroxide. J. Biol. Chem. 272, 217-221.[Abstract/Free Full Text]

Bentley, N. J., Eisen, T. and Goding, C. R. (1994). Melanocyte-specific expression of the human tyrosinase promoter: activation by the microphthalmia gene product and role of the initiator. Mol. Cell. Biol. 14, 7996-8006.[Abstract/Free Full Text]

Bertolotto, C., Bille, K., Ortonne, J. P. and Ballotti, R. (1996). Regulation of tyrosinase gene expression by cAMP in B16 melanoma cells involves two CATGTG motifs surrounding the TATA box: implication of the microphthalmia gene product. J. Cell Biol. 134, 747-755.[Abstract/Free Full Text]

Bertolotto, C., Busca, R., Abbe, P., Bille, K., Aberdam, E., Ortonne, J. P. and Ballotti, R. (1998a). Different cis-acting elements are involved in the regulation of TRP1 and TRP2 promoter activities by cAMP: pivotal role of M Boxes (GTCATGTGCT) and of microphthalmia. Mol. Cell. Biol. 18, 694-702.[Abstract/Free Full Text]

Bertolotto, C., Bille, K., Ortonne, J. P. and Ballotti, R. (1998b). In B16 mouse melanoma cells, the inhibition of melanogenesis by TPA results from PKC activation and diminution of microphthalmia binding to the M-box of the tyrosinase promoter. Oncogene 16, 1665-1670.[Medline]

Bittinger, F., González-García J. L., Klein, C. L., Brochhausen, C., Offner, F. and Kirkpatrick, C. J. (1998). Production of superoxide by human malignant melanoma cells. Melanoma Res. 8, 381-387.[Medline]

Bravard, A., Cherbonnel-Lasserre, C., Reillaudou, M., Beaumatin, J., Dutrillaux, B. and Luccioni, C. (1998). Modifications of the antioxidant enzymes in relation to chromosome imbalances in human melanoma cell lines. Melanoma Res. 8, 329-335.[Medline]

Brown R. K. and Kelly F. J. (1996) Peroxides and other products. In Free Radicals, A Practical Approach, pp. 119-131. New York: Oxford University Press.

Brumell, J. H., Burkhardt, A. L., Bolen, J. B. and Grinstein, S. (1996). Endogenous reactive oxygen intermediates activate tyrosine kinases in human neutrophils. J. Biol. Chem. 271, 1455-1461.[Abstract/Free Full Text]

Chen, Q., Olashaw, N. and Wu, J. (1995). Participation of reactive oxygen species in the lysophosphatidic acid-stimulated mitogen-activated protein kinase kinase activation pathway. J. Biol. Chem. 270, 28499-28502.[Abstract/Free Full Text]

Cooksey, C. J., Garratt, P. J., Land, E. V., Pavel, S., Ramsden, C. A., Riley, P. A. and Smit, N. P. (1997). Evidence of the indirect formation of the catecholic intermediate substrate responsible for the autoactivation kinetics of tyrosinase. J. Biol. Chem. 272, 26226-26235.[Abstract/Free Full Text]

d’Ischia, M., Napolitano, A. and Prota, G. (1991). Peroxidase as an alternative to tyrosinase in the oxidative polymerization of 5,6-dihydroxyindoles to melanin(s). Biochim. Biophys. Acta 1073, 423-430.[Medline]

Easty, D. J. and Bennett, D. C. (2000). Protein tyrosine kinases in malignant melanoma. Melanoma Res. 10, 401-411.[Medline]

Englaro, W., Bertolotto, C., Busca, R., Brunet, A., Pages, G., Ortonne, J. P. and Ballotti, R. (1998). Inhibition of the mitogen-activated protein kinase pathway triggers B16 melanoma cell differentiation. J. Biol. Chem. 273, 1-5.[Free Full Text]

Fialkow,L., Chan, C. K., Rotin, D., Grinstein, S. and Downey, G. (1994). Activation of the mitogen-activated protein kinase signaling pathway in neutrophils. Role of oxidants. J. Biol. Chem. 269, 31234-31242.[Abstract/Free Full Text]

Furumura, M., Solano, F., Matsunaga, N., Sakai, C., Spritz, R. A. and Hearing, V. J. (1998). Metal ligand-binding specificities of the tyrosinase-related proteins. Biochem. Biophys. Res. Commun. 242, 579-585.[Medline]

Griffith, O. W. (1980). Determination of glutathione and glutathione disulfide using glutathione reductase and 2-vinylpiridine. Anal. Biochem. 106, 207-212.[Medline]

Halaban, R., Bohm, M., Dotto, P., Moellmann, G., Cheng, E. and Zhang, Y. (1996). Growth regulatory proteins that repress differentiation markers in melanocytes also downregulate the transcription factor microphthalmia. J. Invest. Dermatol. 106, 1266-1272[Medline]

Hemesath, T. J., Steingrimsson, E., McGill, G., Hansen, M. J., Vaught, J., Hodgkinson, C. A., Arnheiter, H., Copeland, N. G., Jenkins, N. A. and Fisher, D. E. (1994). Microphthalmia, a critical factor in melanocyte development, defines a discrete transcription factor family. Genes Dev. 8, 2770-2780.[Abstract/Free Full Text]

Hemesath, T. J., Price, E. R., Takemoto, C., Badalian, T. and Fisher, D. E. (1998). MAP kinase links the transcription factor microphthalmia to c-kit signaling in melanocytes. Nature 391, 298-300.[Medline]

Hennet, T., Richter, C. and Peterhans, E. (1993). Tumour necrosis factor-{alpha} induces superoxide anion generation in mitochondria of L929 cells. Biochem. J. 289, 587-592.

Hornyak, T., Hayes, D. and Ziff, E. (2000). Cell-density-dependent regulation of espression and glycosylation od dopachrome tautomerase/tyrosinase-related protein-2. J. Invest. Dermatol. 115, 106-112.[Medline]

Jara, J. R., Solano, F. and Lozano, J. A. (1988). Assays for mammalian tyrosinase: a comparative study. Pigment Cell Res. 1, 332-339.[Medline]

Jiménez-Cervantes, C., Solano, F., Kobayashi, T., Urabe, K., Hearing, V. J., Lozano, J. A. and García-Borrón, J. C. (1994). A new enzymatic function in the melanogenic pathway. The 5,6-dihydroxyindole-2-carboxylic acid oxidase activity of tyrosinase-related protein-1 (TRP-1). J. Biol. Chem. 269, 17993-18001.[Abstract/Free Full Text]

Jiménez-Cervantes, C., Martínez-Esparza, M., Solano, F., Lozano, J. A. and García-Borron, J. C. (1998). Molecular interactions within the melanogenic complex: formation of heterodimers of tyrosinase and TRP1 from B16 mouse melanoma. Biochem. Biophys. Res. Commun. 253, 761-767.[Medline]

Keyse, S. M. and Emslie, E. A. (1992). Oxidative stress and heat shock induce a human gene encoding a protein-tyrosine phosphatase. Nature 359, 644-647.[Medline]

Kobayashi, T., Urabe, K., Winder, A., Jiménez-Cervantes, C., Imokawa, G., Brewington, T., Solano, F., García-Borrón, J. C. and Hearing, V. (1994). Tyrosinase related protein 1 (TRP1) functions as a DHICA oxidase in melanin biosynthesis. EMBO J. 13, 5818-5825.[Medline]

Kobayashi, T., Imokawa, G., Bennett, D. C. and Hearing, V. J. (1998). Tyrosinase stabilization by Tyrp1 (the brown locus protein). J. Biol. Chem. 273, 31801-31805.[Abstract/Free Full Text]

Lo, Y. Y. C. and Cruz, T. F. (1995). Involvement of reactive oxygen species in cytokine and growth factor induction of c-fos expression in chondrocytes. J. Biol. Chem. 270, 11727-11730.[Abstract/Free Full Text]

Lo, Y. Y. C., Wong, J. M. S. and Cruz, T. F. (1996). Reactive oxygen species mediate cytokine activation of c-Jun NH2-terminal kinases. J. Biol. Chem. 271, 15703-15707.[Abstract/Free Full Text]

Loir, B., Pérez Sánchez, C., Ghanem, G., Lozano, J. A., García-Borrón, J. C. and Jiménez-Cervantes, C. (1999). Expression of the MC1 receptor gene in normal and malignant human melanocytes. A semiquantitative RT-PCR study. Cell. Mol. Biol. 45, 1083-1092.

Martínez-Esparza, M., Jiménez-Cervantes, C., Beermann, F., Aparicio, P., Lozano, J. A. and García-Borrón J. C. (1997). Transforming growth factor-ß1 inhibits basal melanogenesis in B16/F10 mouse melanoma cells by increasing the rate of degradation of tyrosinase and tyrosinase-related protein-1. J. Biol. Chem. 272, 3967-3972.[Abstract/Free Full Text]

Martínez-Esparza, M., Jiménez-Cervantes, C., Solano, F., Lozano, J. A. and García-Borrón J. C. (1998). Mechanisms of melanogenesis inhibition by tumor necrosis factor-{alpha} in B16/F10 mouse melanoma cells. Eur. J. Biochem. 255, 139-146.[Medline]

Martínez-Esparza, M., Jiménez-Cervantes, C., Bennett, D. C., Lozano, J. A., Solano, F. and García-Borrón, J. C. (1999). The mouse si locus encodes a single transcript truncated by the si mutation. Mamm. Genome 10, 1168-1171.[Medline]

Meier, B., Radeke, H. H., Selle, S., Younes, M., Sies, H., Resch, K. and Habermehl, G. G. (1989). Human fibroblasts release reactive oxygen species in response to interleukin-1 or tumour necrosis factor-{alpha}. Biochem. J. 263, 539-545.[Medline]

Moro, O., Ideta, R. and Ifuku, O. (1999). Characterization of the promoter region of the human melanocortin-1 receptor (MC1R) gene. Biochem. Biophys. Res. Commun. 262, 452-460.[Medline]

Nappi, A. J and Vass, E. (1996). Hydrogen peroxide generation associated with the oxidations of the eumelanogenic precursors 5,6-dihydroxyindole and 5,6-dihydroxyindole-2-carboxylic acid. Melanoma Res. 6, 341-349.[Medline]

Nordlund, J. J and Abdel-Malek, Z. (1988). Mechanisms for postinflammatory hyperpigmentation and hypopigmentation. Prog. Clin. Biol. Res. 256, 219-236.[Medline]

Nose, K. and Ohba, M. (1996). Functional activation of the erg-1 (early growth response-1) gene by hydrogen peroxide. Biochem. J. 316, 381-383.

Nose, K., Shibanuma, M., Kikuchi, K., Kageyama, H., Sakiyama, S. and Kuroki, T. (1991). Transcriptional activation of early-response genes by hydrogen peroxide in a mouse osteoblastic cell line. Eur. J. Biochem. 201, 99-106.[Medline]

Ohba, M., Shibanuma, M., Kuroki, T. and Nose, K. (1994). Production of hydrogen peroxide by transforming growth factor-ß1 and its involvement in the induction of egr-1 in mouse osteoblastic cells. J. Cell Biol. 126, 1079-1088.[Abstract/Free Full Text]

Passi, S., Grandinetti, M., Maggio, F., Stancato, A. and de Luca, C. (1998). Epidermal oxidative stress in vitiligo. Pigment Cell Res. 11, 81-85.[Medline]

Peinado, P., Martínez-Liarte, J. H., del Marmol, V., Solano, F. and Lozano, J. A. (1992). Glutathione depletion in mouse melanoma cells increases their sensitivity to oxidative lysis. Cancer J. 5, 348-353.

Peus, D., Vasa, R. A., Beyerle, A., Meves, A., Krautmacher, C. and Pittelkow, M. R. (1999). Reactive oxygen species in cultured keratinocytes. J. Invest. Dermatol. 112, 751-756.[Medline]

Pezzuto, J., Shieh, H., Saughnessy, E. and Beattie, C. (1988) Approaches for drug development in treatment of advanced melanoma. Semin. Oncol. 15, 578-588.[Medline]

Pinkus, R., Weiner, L. M. and Daniel, V. (1996). Role of oxidants and antioxidants in the induction of AP-1, NF-kB, and glutathione S-transferase gene expression. J. Biol. Chem. 271, 13422-13429.[Abstract/Free Full Text]

Price, E. R., Ding, H.-F., Badalian, T., Battacharya, S., Takemoto, C., Yao, T. P., Hemesath, T. J. and Fisher, D. E. (1998a). Lineage-specific signaling in melanocytes. c-kit stimulation recruits p300/CBP to microphthalmia. J. Biol. Chem. 273, 17983-17986.[Abstract/Free Full Text]

Price, E. R., Horstmann, M. A., Wells, A. G., Welbaecker, K. N., Takemoto, C. M., Landis, M. W. and Fisher, D. E. (1998b). {alpha}-Melanocyte-stimulating hormone signaling regulates expression of microphthalmia, a gene deficient in Waardenburg syndrome. J. Biol. Chem. 273, 33042-33047.[Abstract/Free Full Text]

Sarna, T., Pilas, B., Land, E. J. and Truscott, G. (1986). Interaction of radicals from water radiolysis with melanin. Biochim. Biophys. Acta 883,162-167.[Medline]

Schreck, R., Rieber, P. and Baeuerle, P. A. (1991). Reactive oxygen intermediates as apparently widely used messengers in the activation of the NF-kB transcription factor and HIV-1. EMBO J. 10, 2247-2258.[Medline]

Shang, F., Gong, X. and Taylor, A. (1997). Activity of ubiquitin-dependent pathway in response to oxidative stress. Ubiquitin-activating enzyme is transiently upregulated. J. Biol. Chem. 272, 23086-23093.[Abstract/Free Full Text]

Sundaresan, M., Yu, Z., Ferrans, V., Irani, K. and Finkel, T. (1995). Requirement for generation of H2O2 for platelet-derived growth factor signal transduction. Science 270, 296-299.[Abstract/Free Full Text]

Swope, V., Abdel-Malek, Z., Kassem, L. and Norlund, J. (1991). Interleukins 1{alpha} and 6 and tumor necrosis factor-{alpha} are paracrine inhibitors of human melanocyte proliferation and melanogenesis. J. Invest. Dermatol. 96, 180-185.[Medline]

Tachibana, M., Takeda, K., Nobukuni, Y., Urabe, K., Long, J. E., Meyers, K. A., Aaronson, S. A. and Miki, T. (1996). Ectopic expression of MITF, a gene for Waardenburg Syndrome type 2, converts fibroblasts to cells with melanocyte characteristics. Nat. Genet. 14, 50-54.[Medline]

Tassabehji, M., Newton, V. and Read, A. (1994). Waardenburg syndrome type 2 caused by mutations in the human microphthalmia (MITF) gene. Nat. Genet, 8, 251-255.[Medline]

Thannickal, V. J., Hassoun, P. M., White, A. C. and Fanburg, B. L. (1993). Enhanced rate of H2O2 release from bovine pulmonary artery endothelial cells induced by TGF-ß1. Am. J. Physiol. 265, L622-L626.

Thannickal, V. J. and Fanburg, B. L. (1995). Activation of an H2O2-generating NADH oxidase in human lung fibroblasts by transforming growth factor-ß1 J. Biol. Chem. 270, 30334-30338.[Abstract/Free Full Text]

Tsukamoto, K., Ueda, M. and Hearing, V. (1992). Melanogenesis in murine melancytes is suppressed by infection with the v-rasHa oncogene. Pigment Cell Res. 2, Suppl., 181-184.

Urabe, K., Aroca, P., Tsukamoto, K., Mascagna, D., Palumbo, A., Prota, G. and Hearing, V. (1994) The inherent cytotoxicity of melanin precursors: a revision. Biochim. Biophys. Acta. 1221, 272-278.[Medline]

Winder, A. J. and Harris, H. (1991). New assays for tyrosine hydroxylase and dopa oxidase activities of tyrosinase. Eur. J. Biochem. 198, 317-326.[Medline]

Yagi, K. (1984) In Methods in Enzymology. Vol. 105 (ed. L. Packer), pp 328-331. Academic Press, London.

Yasumoto, K., Yokoyama, K., Shibata, K., Tomita, Y. and Shibahara, S. (1994). Microphthalmia-associated transcription factor as a regulator for melanocyte-specific transcription of the human tyrosinase gene. Mol. Cell. Biol. 14, 8058-8070.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?



This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jiménez-Cervantes, C.
Right arrow Articles by García-Borrón, J. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jiménez-Cervantes, C.
Right arrow Articles by García-Borrón, J. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?