|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
RESEARCH ARTICLE |
Department of Biochemistry and Molecular Biology, School of Medicine, University of Murcia, Apto 4021, Campus de Espinardo, 30100 Murcia, Spain
*Author for correspondence (e-mail: gborron{at}um.es)
Accepted March 19, 2001
| SUMMARY |
|---|
|
|
|---|
Key words: Melanogenesis, Oxidative stress, Hydrogen peroxide, Hypopigmentation, Microphthalmia
| INTRODUCTION |
|---|
|
|
|---|
Tyr, Tyrp1 and Dct are highly related proteins encoded for by homologous genes mapping to the albino, brown and slaty loci, respectively. They share several structural properties, such as the ability to bind metal ion co-factors (Furumura et al., 1998), and the association to the melanosomal membrane. Moreover, a strong intermolecular association involving Tyrp1 and Tyr has been demonstrated (Jiménez-Cervantes et al., 1998) that may have functional effects through the stabilization of Tyr (Kobayashi et al., 1998). Interestingly, the rate of transcription of the Tyr, Tyrp1 and Dct genes is mainly controlled by the microphthalmia basic helix-loop-helix-leucine zipper transcription factor (Mitf), whose function and expression is regulated by several signaling pathways (Hemesath et al., 1994; Hemesath et al., 1998; Bentley et al., 1994; Yasumoto et al., 1994; Bertolotto et al., 1996; Bertolotto et al., 1998a; Price et al., 1998a; Price et al., 1998b). Thus, Mitf plays a key role in melanocyte differentiation, as demonstrated by the acquisition of melanocytic characteristics by fibroblasts transfected with Mitf cDNA (Tachibana et al., 1996).
The polymerization reactions involving quinonic melanogenic intermediates are spontaneous, and lead to the formation of H2O2 as a by-product. In support of this view, several oxidative reactions of melanin precursors are inhibited by catalase (dIschia et al., 1991). Moreover, the generation of H2O2 during the oxidation of the melanogenic precursors DHICA and DHI has been demonstrated in vitro (Nappi and Vass, 1996), and H2O2 production by human melanoma cells in culture has also been observed (Bittinger et al., 1998). H2O2 and other reactive oxygen species (ROS) play important roles in the regulation of many intracellular pathways. The mechanisms that underlie this regulatory action are multiple and, often, still poorly understood. ROS have been shown to activate intracellular kinases (Fialkow et al., 1994; Brumell et al., 1996; Bae et al., 1999), to induce protein-tyrosine phosphatases (Keyse and Emslie, 1992), and to control the activity and/or expression of a variety of transcription factors and early-response genes (Brumell et al., 1996; Schreck et al., 1991; Nose et al., 1991; Nose and Ohba 1996; Pinkus et al., 1996). An activation of the ubiquitin-dependent proteolytic pathway after oxidative stress has also been described (Shang et al., 1997). Interestingly, the intracellular levels of H2O2 and other ROS increase in several cellular systems in response to external stimuli, including growth factors such as epidermal growth factor (Bae et al., 1997), platelet-derived growth factor (Sundaresan et al., 1995); cytokines such as tumor necrosis factor
(TNF
) and transforming growth factor ß (TGFß) (Meier et al., 1989; Hennet et al., 1993; Thannickal et al., 1993; Ohba et al., 1994; Thannickal and Fanburg, 1995; Lo and Cruz 1995; Chen et al., 1995; Lo et al., 1996). These cytokines are potent inhibitors of melanogenesis in B16 melanoma cells and human melanocytes (Swope et al., 1991; Martínez-Esparza et al., 1997; Martínez-Esparza et al., 1998).
Given the involvement of H2O2 in central regulatory processes, and its generation during melanogenesis, as a result of u.v. irradiation (Peus et al., 1999), or in response to the hypopigmenting cytokines, it was of interest to study its effects on melanocytes. We show that a short exposure of melanocytes to H2O2 markedly and transiently decreases the melanogenic activities. Using the well-established B16 mouse melanoma model, we have found that this inhibitory effect is accounted for by decreased protein and mRNA levels. A likely mechanism for the transient reduction of Tyr and other melanocyte-specific proteins is a decreased rate of transcription that results from downregulation of the Mitf transcription factor, although the occurrence of post-translational effects is also possible. This effect of H2O2 probably provides the melanogenic pathway with an internal feedback mechanism that may contribute to the fine tuning of melanin synthesis.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Determination of total and oxidized glutathione and lipid peroxidation markers
Total, reduced and oxidized glutathione were determined by a kinetic recycling assay based on the Ellmans reagent (5,5'-dithiobis-2-nitrobenzoic acid, DTNB) and reduction of oxidized glutathione with glutathione reductase in the presence of NADPH (Griffith, 1980).
Lipid peroxidation was assessed by measuring the concentration of malondialdehyde (MDA), as this is, in most instances, the major lipid-derived aldehyde formed upon oxidation of biological samples (Brown and Kelly, 1996). The procedure has been described previously (Yagi, 1984), and involves the formation of a fluorescent adduct between MDA and thiobarbituric acid (TBA). Control and H2O2-treated cells were harvested with trypsin and resuspended in PBS. An aliquot was preserved for protein determination. To prevent further lipid oxidation, 5 µl of butylated hydroxytoluene and 1 µl of 2 mM desferroxiamine were added to 100 µl of the cell suspension placed in sealed glass tubes. After sonication for 5 minutes, and addition of 2 ml of 4 M H2SO4 and 0.25 ml of phosphotungstic acid (10% w/v), samples were vigorously mixed, kept for 5 minutes at room temperature and centrifuged at 2000 g, 10 minutes. The supernatant was removed and the procedure was repeated with 1ml H2SO4 and 0.15 ml of phosphotungstic acid. The resulting pellet was resuspended in 2 ml isotonic NaCl, to which 0.5 ml of the TBA acid reagent (46.5 mM TBA in 50% acetic acid) were added. The capped tubes were vortexed, heated at 95°C for 1 hour and cooled on ice. The reaction mixture was extracted with 2.5 ml of n-butanol. The fluorescence of the butanol phase was measured in a Hitachi F-4500 fluorimeter (excitation at 515 nm and emission at 553 nm). Known amounts of MDA were treated in parallel, and used as standards.
Enzyme activity determinations
Cells were washed with Hanks solution, trypsin harvested and counted before solubilization in 1% Igepal CA-630, 0.1 mM PMSF in 10 mM phosphate buffer (pH 6.8). Tyrosine hydroxylase activity was determined by a radiometric method (Jara et al., 1988), and dopa oxidase activity according to Winder and Harris (Winder and Harris, 1991). Activity units are defined as the amount of enzyme transforming 1 µmol of substrate/minute.
Immunochemical techniques
Western blotting was performed as described (Martínez-Esparza et al., 1997; Martínez-Esparza et al., 1998), using the specific antisera
PEP1 (anti-Tyrp1) and
PEP7 (anti-Tyr), a gift from Prof. V. Hearing (NIH, Bethesda, MD).
Northern blotting
Total RNA was isolated with guanidinium thiocyanate, and purified by cesium chloride gradient centrifugation. Before electrophoresis, RNA was denatured for 1 hour at 55°C with glyoxal and dimethylsulfoxide. Identical amounts (usually 10 µg) were electrophoresed on 1.5% agarose gels in 10 mM sodium phosphate buffer, pH 7.0. Comparable loading was ascertained by Acridine Orange staining of the gels before diffusion blotting to Hybond nylon membrane (Amersham) using 20xSSC (3 M NaCl, 0.3 M sodium citrate). Prehybridization and hybridization conditions, as well as the probes used for detection of Tyr, Tyrp1, Dct and Gapdh gene expression have been described elsewhere (Martínez-Esparza et al., 1997; Martínez-Esparza et al., 1998). The remaining probes were for: the silver locus gene, 839 bp fragment corresponding to the 3' portion of the coding sequence (Martínez-Esparza et al., 1999); Mc1r, 1003 bp fragment covering the complete coding sequence of the receptor gene (Loir et al., 1999); and Mitf, 1.3 kb PCR fragment obtained with primers AAGTGGTCTGCGGTGTCTCC (forward) and AAGGCAGGCTCGCTAACACG (reverse), whose identity was ascertained by restriction mapping. The GAPDH probe was used as control for comparable loading, transfer and normalization of phosphor-imaging data.
Semi-quantitative RT-PCR
First strand cDNA synthesis was performed with the Superscript kit (Gibco) as per instructions, using a starting amount of 0.5 µg of total RNA. Preliminary PCR runs were performed to determine the volume of the different cDNA preparations yielding comparable bands with a commercial primer set that was specific for GAPDH (from Clontech, Palo Alto, CA). Then, the appropriate amounts of cDNA were amplified in parallel with the Mitf-specific primers described above for the preparation of the Mitf probe, and with the GAPDH-specific primers. Care was taken to ascertain that the reactions were run in the exponential phase. Suitable aliquots were electrophoresed in 1% agarose gels and ethidium bromide stained. The intensity of the bands was quantified in a Gel Doc system (BioRad) using the Multi-Analyst software.
Other procedures
Protein concentration was measured with the bicinchoninic acid method using BSA as a standard. Melanin concentrations were determined by hydrolysis in 0.85 N KOH, at 100°C, followed by measurement of absorbance at 400 nm and extrapolation from a calibration curve obtained with synthetic melanin (Sigma, St Louis, MO), that was treated in parallel.
| RESULTS |
|---|
|
|
|---|
|
|
Since tyrosine hydroxylation is the rate-limiting melanogenic step, an inhibition of this reaction should result in a reduced rate of melanin formation. In fact, cell pellets from samples allowed to recover for 16 to 24 hours after the oxidative challenge were consistently found, upon visual inspection, to have a lighter color than the corresponding controls. Therefore, we treated melanocytes with H2O2, and determined the evolution of their melanin contents after the oxidative shock (Fig. 3). Melanin concentration decreased by as much as 75%. This decrease was still observed 24 hours after the treatment. This was not due to artifacts arising from direct bleaching of melanin by H2O2, as model melanin in suspension submitted to an identical treatment before its quantification gave identical results to untreated, control melanin (not shown). The sharp decrease in the cellular melanin to protein ratio observed between 6 and 16 hours can be partially explained by dilution of pre-existing pigment within the cell population, under conditions of drastically reduced de novo pigment formation. Consistent with this possibility, cellular proliferation stopped in H2O2-treated cells within roughly 10 hours of the oxidative shock. Thereafter, the cells recovered a normal growth rate (Fig. 3B). However, the magnitude of the decrease in melanin content suggests the contribution of other effects, such as indirect bleaching by secondary oxidation products arising from the reaction of H2O2 with cellular components, or increased pigment release from H2O2-treated cells.
|
|
The levels of total glutathione in H2O2-challenged melanocytes moderately decreased by about 20% with respect to control values in the first 5 minutes, but recovered rapidly, and were even slightly higher than pretreatment levels by 15 minutes (Fig. 5A). This trend was maintained over the next hours, and values about 250% of pre-treatment levels were reached 6 hours after the challenge. However, the levels of oxidized glutathione were barely detectable by the analytical procedure employed, and never reached 5% of total glutathione. Therefore, the evolution of total glutathione concentration shown in Fig. 5 can be approximately equated to the one of reduced glutathione. The concentration of the lipid peroxidation marker MDA increased approximately twofold 2 hours after the treatment, but pre-treatment levels were subsequently restored (Fig. 5B), and after 24 hours of recovery they were slightly lower than controls. These data, together with the recovery of a normal growth rate soon after the oxidative shock shown in Fig. 3B, show that B16 melanoma cells can rapidly restore the intracellular redox status and even increase their antioxidant defense mechanisms after an oxidative stress.
|
|
|
H2O2 rapidly and transiently represses Mitf transcription factor mRNA
Mitf has been identified as the major transcriptional regulator of the melanocyte-specific genes encoding for Tyr, Tyrp1 and Dct (Hemesath et al., 1994; Hemesath et al., 1998; Bentley et al., 1994; Yasumoto et al., 1994; Bertolotto et al., 1996; Bertolotto et al., 1998a; Price et al., 1998a; Price et al., 1998b; Tachibana et al., 1996). Therefore, the kinetics of changes in Mitf mRNA levels following an H2O2 challenge were next analyzed by northern blot. For comparison, B16 melanoma cells were treated with TPA. This phorbol ester has been shown to downregulate melanogenesis by decreasing Mitf transactivating activity (Bertolotto et al., 1998b). Moreover, and as a positive control for Mitf responsiveness, B16 melanoma cells were also treated with
-melanocyte stimulating hormone (
MSH) or forskolin, two potent inducers of Mitf gene expression (Price et al., 1998b).
The inhibition of the melanogenic activities achieved by TPA treatment was similar to the one observed after H2O2 challenge. Residual tyrosine hydroxylase and dopa oxidase activities were near 30% of controls 16 hours after addition of TPA (not shown). The levels of Mitf mRNA dropped rapidly after H2O2 treatment, to about 30% of control values 1 hour after the challenge, but were already rising after 8 hours of recovery (Fig. 8A). Mitf mRNA downregulation mediated by TPA was quantitatively similar, but the inhibitory effect of TPA was more persistent. Accordingly, the TPA-dependent inhibition of the melanogenic activities was very similar when measured 16, 24 or 48 hours after addition of TPA.
|
MSH and forskolin (Fig. 8B). This shows that the mechanisms of Mitf regulation operating in normal melanocytes are functional in the B16 mouse melanoma cells used in this study. As basal levels of Mitf mRNA were quite low and, therefore, further decreases were difficult to quantitate accurately by Northern blot, we wished for confirmation of the data described above by means of a semiquantitative RT-PCR approach. As shown in Fig. 8C, Mitf gene expression dropped strongly and transiently after H2O2 challenge. Maximal inhibition (about 25% residual levels) was observed between 1 and 2 hours after the treatment, and recovery was essentially complete 8 hours after the oxidative challenge. These results fully confirm the decrease in Mitf gene expression observed by northern blot.
| DISCUSSION |
|---|
|
|
|---|
and TGFß (Meier et al., 1989; Hennet et al., 1993; Thannickal et al., 1993; Ohba et al., 1994; Thannickal and Fanburg, 1995; Lo and Cruz, 1995; Chen et al., 1995; Lo et al., 1996), two cytokines that have been shown to exert a strong inhibition of melanogenesis in both B16 mouse melanoma cells and normal human melanocytes (Swope et al., 1991; Martínez-Esparza et al., 1997; Martínez-Esparza et al., 1998); and (4) the generation of ROS and/or the resulting increase in lipid peroxidation products have been proposed as etiological factors for de-pigmentary natural processes such as hair graying (Nordlund and Abdel-Malek, 1988), and several pathological conditions, like vitiligo (Passi et al., 1998). Moreover, imbalances of the normal antioxidant mechanisms are common in human melanoma cells (Bravard et al., 1998). However, little attention has been paid to the effects of oxidative stress on the rate of melanogenesis and the expression of specific differentiation markers, using well-defined cellular models. The results presented here demonstrate that a short pulse with H2O2 inhibits melanogenesis in B16 mouse melanoma cells, as well as in two human melanoma cell lines. In the B16 mouse melanoma model, this inhibition is not related to a severe cellular damage, as treatment conditions with a strong inhibitory action are adequately withstood by the cells. Under the standard conditions employed, cell viability is maintained, oxidized glutathione never exceeds 5% of total glutathione, and normal lipid peroxidation levels are rapidly restored after the oxidative shock. Moreover, B16 melanoma cells appear to respond actively to the oxidative challenge by increasing their intracellular concentration of glutathione, and they are highly resistant to oxidative lysis unless their glutathione pool is depleted prior to an exposure to H2O2 (Peinado et al., 1992). Therefore, B16 melanoma cells and most likely other melanocytes seem to possess active defense mechanisms to prevent oxidative damage. Accordingly, melanoma cells are highly resistant to radiation therapy (Sarna et al., 1986) and to chemotherapy with drugs whose cytotoxic action is dependent on redox cycling (Pezzuto et al., 1988). This resistance of melanocytes to oxidative damage is consistent with the normal generation of ROS in the skin mentioned above, and may make melanocytes a particularly interesting model to study ROS-mediated regulatory pathways.
In addition to the lack of significant cytotoxicity, the range of H2O2 concentrations employed in this report could be physiologically relevant. First, they are similar to those employed in other studies, and shown to activate intracellular signaling pathways and nuclear responses (Brumell et al., 1996; Bae et al., 1999; Nose et al., 1991; Nose and Ohba, 1996; Pinkus et al., 1996). Second, human melanoma cells produce superoxide radicals and H2O2 at a significant rate, even in the absence of stimulating agents. The values reported are 5 nmol H2O2/106 cells/90 minutes (Bittinger et al., 1998), and should be higher under conditions of active melanogenesis, after u.v. irradiation or hormonal stimulation.
Concerning the mechanisms of H2O2-mediated inhibition of melanogenesis, the decreases in Tyr and Tyrp1 proteins following the oxidative challenge adequately account for the reduction in the velocity of the rate limiting step of the pathway. Therefore, inhibition of melanin formation most likely results from decreased enzyme levels, rather than from a modulation of the specific activity of Tyr and/or Tyrp1. In turn, our data suggest that downregulation of the Tyr and Tyrp1 proteins is exerted, at least partially, by transcriptional regulation. Indeed, 8 hours after the treatment, a significant decrease in the corresponding mRNAs was observed. Moreover, Tyr mRNA levels begin to return to control values by 16 hours after the oxidative challenge, thus preceding the recovery of Tyr protein and enzyme activity pre-treatment levels. However, the abundance of Tyr and Tyrp1, and the associated enzymatic activities are reduced rapidly and more strongly than the corresponding mRNA species. Therefore, a comparison of the levels of Tyr and Tyrp1 proteins on one hand, and mRNAs on the other, suggests that post-translational effects such as a decrease in the intracellular stability of the proteins may also contribute to the inhibitory action of H2O2. Consistent with this possibility, the fall in Tyr abundance is rapid, already noticeable 1 hour after the oxidative challenge. Moreover, we have previously found that the hypopigmenting cytokines TGFß and TNF
decrease the half-life of enzymatically active tyrosinase in B16 melanocytes (Martínez-Esparza et al., 1997; Martínez-Esparza et al., 1998), and H2O2 has been characterized as a second messenger for these cytokines in several cellular systems, as discussed above.
However, several observations point to Mitf downregulation as a mechanism underlying the inhibition of melanogenesis by H2O2. First, Mitf mRNA reduction is strong and observed clearly before the downregulation of the mRNAs for the melanocyte differentiation markers, including Tyr and Tyrp1, as shown both by northern blot and semiquantitative RT-PCR. Second, recovery of normal Mitf levels also precedes the increase in Tyr mRNA, enzyme activity and protein towards pre-treatment levels. Third, the inhibitory effects of H2O2 treatment are observed coordinately for the five melanocyte-specific genes studied in this report: Tyr, Tyrp1, Dct, Mc1r and silver. Mitf has been shown to be a major transactivating factor for the Tyr and Tyrp1 genes (Bentley et al., 1994; Yasumoto et al., 1994; Bertolotto et al., 1996; Bertolotto et al., 1998a; Price et al., 1998a; Aksan and Goding, 1998) and to control the rate of expression of Dct (Bertolotto et al., 1998a) and Mc1r (Moro et al., 1999, Adachi et al., 2000). Although there is no direct evidence for a role of Mitf in the regulation of silver gene expression, our results and the known inducibility by
MSH and cAMP elevating agents allow us to predict that Mitf-binding elements will be found in the silver gene promoter. Moreover, a possible involvement of Mitf in the regulation of the silver locus gene expression has also been suggested by others (Halaban et al., 1996). And fourth, TPA, which inhibits melanogenesis in B16 melanoma cells through a diminution of Mitf binding to the Tyr promoter (Bertolotto et al., 1998b), reduces Mitf mRNA levels to a similar extent to H2O2. This suggests that the downregulation of Mitf expression reported here is sufficient to decrease its transactivating activity.
Therefore, our data strongly suggest that H2O2-mediated downregulation of Mitf results in a decreased expression of Mitf-controlled melanocyte-specific genes, and hence in an inhibition of melanogenesis. As Mitf probably plays a key role not only in the control of differentiation, but also in melanocyte survival (Tassabehji et al., 1994), it is tempting to speculate that a continued inhibition of its expression by a sustained exposure to ROS may lead to melanocyte death, thus providing a molecular basis for the observed association between vitiligo and oxidative stress (Passi et al., 1998). In any case, this is the first report of a relationship between the redox status of melanocytes and Mitf expression. The nature of the signaling mechanisms leading from H2O2 to decreased Mitf gene expression remains speculative at this stage; however, several observations point to Ras activation as a possible upstream event. Ras is activated by ROS in mouse fibroblasts and other cell types (Abe and Berk, 1999). Infection of murine melanocytes with the v-Ha-Ras oncogene inhibits melanogenesis (Tsukamoto et al., 1992, Halaban et al., 1996), and Mitf has been identified as the transcription factor downregulated in ras-infected melanocytes, and responsible for their amelanotic phenotype (Halaban et al., 1996). Interestingly, Ras activation by ROS is mediated by FYN (Abe and Berk, 1999), a cytosolic tyrosine kinase present in normal melanocytes, and overexpressed in melanomas (reviewed by Easty and Bennett, 2000). Moreover, downstream effectors of Ras include the MAP kinases ERK1 and ERK2, whose specific inhibition triggers differentiation of B16 melanoma cells and increases tyrosinase gene expression (Englaro et al., 1998). However, the possible involvement of Ras as an upstream effector of H2O2-induced downregulation of melanogenesis is, at this stage, a speculation that will be the subject of further studies. It will also be interesting to compare the levels of mRNA and transactivating activity in depigmented lesions and disease-free skin.
Keeping in mind that the highly reactive intermediates of the melanogenic pathway are cytotoxic (Urabe et al., 1994), it is often considered that an uncontrolled activation of melanogenesis is potentially harmful for the melanocytes. Thus, the inhibition of the rate-limiting step in the melanogenic pathway by H2O2 might constitute a protective mechanism. As H2O2 is a by-product of the melanogenic pathway (Nappi and Vass, 1996), it may act as a suitable feedback inhibitor of the first reaction of melanogenesis, thus limiting the accumulation of toxic intermediates. This possible feedback might be particularly relevant under physiological conditions of active melanogenesis, following hormonal stimulation by
MSH, or after u.v. irradiation of the skin.
In summary, we have described an inhibitory action of H2O2 on melanogenesis. This effect is mediated by a reduction of the intracellular concentration of the melanogenic enzymes, probably achieved, at least partially, at the transcriptional level. These observations might provide the basis for a better understanding, at the molecular level, of several pigmentation disorders. However, it should be kept in mind that most of the experiments described above have been performed using B16 mouse melanoma cells as a model, and that these cells sometimes show different responses from cultured melanocytes. The fact that two human melanoma cell lines also respond to H2O2 by decreasing their melanogenic potential, supports the notion that our results reflect a general behavior of malignant melanocytes. But further work will be needed to ascertain whether our findings can be extrapolated to normal melanocytes.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Abe, J. and Berk, B. (1999). Fyn and JAK2 mediate Ras activation by reactive oxygen species. J. Biol. Chem. 274, 21003-21010.
Adachi, S., Morii, E., Kim, D., Ogihara, H., Jippo, T., Ito, A., Lee, Y. and Kitamura, Y. (2000). Involvement of mi-transcription factor in expression of alpha-melanocyte-stimulating hormone receptor in cultured mast cells of mice. J. Immunol. 164, 855-860.
Aksan, I. and Goding, C. (1998). Targeting of Microphthalmia basic helix-loop-helix-leucine zipper transcription factor to a subset of E-box elements in vitro and in vivo. Mol. Cell. Biol. 18, 6930-6938.
Aroca, P., García-Borrón, J. C., Solano, F. and Lozano, J. A. (1990). Regulation of distal mammalian melanogenesis. Partial purification and characterization of a dopachrome converting factor: dopachrome tautomerase. Biochim. Biophys. Acta, 1035, 266-275.[Medline]
Bae, G., Seo, D., Kwon, H., Lee, H., Hong, S., Lee, Z., Ha, K., Lee, H. and Han, J. (1999). Hydrogen peroxide activates p70S6k signaling pathway. J. Biol. Chem. 274, 32596-32602.
Bae, Y. S., Kang, S. W., Seo, M. S., Baines, I. C., Tekle, E., Chock, P. B. and Rhee, S. G. (1997). Epidermal growth factor-induced generation of hydrogen peroxide. J. Biol. Chem. 272, 217-221.
Bentley, N. J., Eisen, T. and Goding, C. R. (1994). Melanocyte-specific expression of the human tyrosinase promoter: activation by the microphthalmia gene product and role of the initiator. Mol. Cell. Biol. 14, 7996-8006.
Bertolotto, C., Bille, K., Ortonne, J. P. and Ballotti, R. (1996). Regulation of tyrosinase gene expression by cAMP in B16 melanoma cells involves two CATGTG motifs surrounding the TATA box: implication of the microphthalmia gene product. J. Cell Biol. 134, 747-755.
Bertolotto, C., Busca, R., Abbe, P., Bille, K., Aberdam, E., Ortonne, J. P. and Ballotti, R. (1998a). Different cis-acting elements are involved in the regulation of TRP1 and TRP2 promoter activities by cAMP: pivotal role of M Boxes (GTCATGTGCT) and of microphthalmia. Mol. Cell. Biol. 18, 694-702.
Bertolotto, C., Bille, K., Ortonne, J. P. and Ballotti, R. (1998b). In B16 mouse melanoma cells, the inhibition of melanogenesis by TPA results from PKC activation and diminution of microphthalmia binding to the M-box of the tyrosinase promoter. Oncogene 16, 1665-1670.[Medline]
Bittinger, F., González-García J. L., Klein, C. L., Brochhausen, C., Offner, F. and Kirkpatrick, C. J. (1998). Production of superoxide by human malignant melanoma cells. Melanoma Res. 8, 381-387.[Medline]
Bravard, A., Cherbonnel-Lasserre, C., Reillaudou, M., Beaumatin, J., Dutrillaux, B. and Luccioni, C. (1998). Modifications of the antioxidant enzymes in relation to chromosome imbalances in human melanoma cell lines. Melanoma Res. 8, 329-335.[Medline]
Brown R. K. and Kelly F. J. (1996) Peroxides and other products. In Free Radicals, A Practical Approach, pp. 119-131. New York: Oxford University Press.
Brumell, J. H., Burkhardt, A. L., Bolen, J. B. and Grinstein, S. (1996). Endogenous reactive oxygen intermediates activate tyrosine kinases in human neutrophils. J. Biol. Chem. 271, 1455-1461.
Chen, Q., Olashaw, N. and Wu, J. (1995). Participation of reactive oxygen species in the lysophosphatidic acid-stimulated mitogen-activated protein kinase kinase activation pathway. J. Biol. Chem. 270, 28499-28502.
Cooksey, C. J., Garratt, P. J., Land, E. V., Pavel, S., Ramsden, C. A., Riley, P. A. and Smit, N. P. (1997). Evidence of the indirect formation of the catecholic intermediate substrate responsible for the autoactivation kinetics of tyrosinase. J. Biol. Chem. 272, 26226-26235.
dIschia, M., Napolitano, A. and Prota, G. (1991). Peroxidase as an alternative to tyrosinase in the oxidative polymerization of 5,6-dihydroxyindoles to melanin(s). Biochim. Biophys. Acta 1073, 423-430.[Medline]
Easty, D. J. and Bennett, D. C. (2000). Protein tyrosine kinases in malignant melanoma. Melanoma Res. 10, 401-411.[Medline]
Englaro, W., Bertolotto, C., Busca, R., Brunet, A., Pages, G., Ortonne, J. P. and Ballotti, R. (1998). Inhibition of the mitogen-activated protein kinase pathway triggers B16 melanoma cell differentiation. J. Biol. Chem. 273, 1-5.
Fialkow,L., Chan, C. K., Rotin, D., Grinstein, S. and Downey, G. (1994). Activation of the mitogen-activated protein kinase signaling pathway in neutrophils. Role of oxidants. J. Biol. Chem. 269, 31234-31242.
Furumura, M., Solano, F., Matsunaga, N., Sakai, C., Spritz, R. A. and Hearing, V. J. (1998). Metal ligand-binding specificities of the tyrosinase-related proteins. Biochem. Biophys. Res. Commun. 242, 579-585.[Medline]
Griffith, O. W. (1980). Determination of glutathione and glutathione disulfide using glutathione reductase and 2-vinylpiridine. Anal. Biochem. 106, 207-212.[Medline]
Halaban, R., Bohm, M., Dotto, P., Moellmann, G., Cheng, E. and Zhang, Y. (1996). Growth regulatory proteins that repress differentiation markers in melanocytes also downregulate the transcription factor microphthalmia. J. Invest. Dermatol. 106, 1266-1272[Medline]
Hemesath, T. J., Steingrimsson, E., McGill, G., Hansen, M. J., Vaught, J., Hodgkinson, C. A., Arnheiter, H., Copeland, N. G., Jenkins, N. A. and Fisher, D. E. (1994). Microphthalmia, a critical factor in melanocyte development, defines a discrete transcription factor family. Genes Dev. 8, 2770-2780.
Hemesath, T. J., Price, E. R., Takemoto, C., Badalian, T. and Fisher, D. E. (1998). MAP kinase links the transcription factor microphthalmia to c-kit signaling in melanocytes. Nature 391, 298-300.[Medline]
Hennet, T., Richter, C. and Peterhans, E. (1993). Tumour necrosis factor-
induces superoxide anion generation in mitochondria of L929 cells. Biochem. J. 289, 587-592.
Hornyak, T., Hayes, D. and Ziff, E. (2000). Cell-density-dependent regulation of espression and glycosylation od dopachrome tautomerase/tyrosinase-related protein-2. J. Invest. Dermatol. 115, 106-112.[Medline]
Jara, J. R., Solano, F. and Lozano, J. A. (1988). Assays for mammalian tyrosinase: a comparative study. Pigment Cell Res. 1, 332-339.[Medline]
Jiménez-Cervantes, C., Solano, F., Kobayashi, T., Urabe, K., Hearing, V. J., Lozano, J. A. and García-Borrón, J. C. (1994). A new enzymatic function in the melanogenic pathway. The 5,6-dihydroxyindole-2-carboxylic acid oxidase activity of tyrosinase-related protein-1 (TRP-1). J. Biol. Chem. 269, 17993-18001.
Jiménez-Cervantes, C., Martínez-Esparza, M., Solano, F., Lozano, J. A. and García-Borron, J. C. (1998). Molecular interactions within the melanogenic complex: formation of heterodimers of tyrosinase and TRP1 from B16 mouse melanoma. Biochem. Biophys. Res. Commun. 253, 761-767.[Medline]
Keyse, S. M. and Emslie, E. A. (1992). Oxidative stress and heat shock induce a human gene encoding a protein-tyrosine phosphatase. Nature 359, 644-647.[Medline]
Kobayashi, T., Urabe, K., Winder, A., Jiménez-Cervantes, C., Imokawa, G., Brewington, T., Solano, F., García-Borrón, J. C. and Hearing, V. (1994). Tyrosinase related protein 1 (TRP1) functions as a DHICA oxidase in melanin biosynthesis. EMBO J. 13, 5818-5825.[Medline]
Kobayashi, T., Imokawa, G., Bennett, D. C. and Hearing, V. J. (1998). Tyrosinase stabilization by Tyrp1 (the brown locus protein). J. Biol. Chem. 273, 31801-31805.
Lo, Y. Y. C. and Cruz, T. F. (1995). Involvement of reactive oxygen species in cytokine and growth factor induction of c-fos expression in chondrocytes. J. Biol. Chem. 270, 11727-11730.
Lo, Y. Y. C., Wong, J. M. S. and Cruz, T. F. (1996). Reactive oxygen species mediate cytokine activation of c-Jun NH2-terminal kinases. J. Biol. Chem. 271, 15703-15707.
Loir, B., Pérez Sánchez, C., Ghanem, G., Lozano, J. A., García-Borrón, J. C. and Jiménez-Cervantes, C. (1999). Expression of the MC1 receptor gene in normal and malignant human melanocytes. A semiquantitative RT-PCR study. Cell. Mol. Biol. 45, 1083-1092.
Martínez-Esparza, M., Jiménez-Cervantes, C., Beermann, F., Aparicio, P., Lozano, J. A. and García-Borrón J. C. (1997). Transforming growth factor-ß1 inhibits basal melanogenesis in B16/F10 mouse melanoma cells by increasing the rate of degradation of tyrosinase and tyrosinase-related protein-1. J. Biol. Chem. 272, 3967-3972.
Martínez-Esparza, M., Jiménez-Cervantes, C., Solano, F., Lozano, J. A. and García-Borrón J. C. (1998). Mechanisms of melanogenesis inhibition by tumor necrosis factor-
in B16/F10 mouse melanoma cells. Eur. J. Biochem. 255, 139-146.[Medline]
Martínez-Esparza, M., Jiménez-Cervantes, C., Bennett, D. C., Lozano, J. A., Solano, F. and García-Borrón, J. C. (1999). The mouse si locus encodes a single transcript truncated by the si mutation. Mamm. Genome 10, 1168-1171.[Medline]
Meier, B., Radeke, H. H., Selle, S., Younes, M., Sies, H., Resch, K. and Habermehl, G. G. (1989). Human fibroblasts release reactive oxygen species in response to interleukin-1 or tumour necrosis factor-
. Biochem. J. 263, 539-545.[Medline]
Moro, O., Ideta, R. and Ifuku, O. (1999). Characterization of the promoter region of the human melanocortin-1 receptor (MC1R) gene. Biochem. Biophys. Res. Commun. 262, 452-460.[Medline]
Nappi, A. J and Vass, E. (1996). Hydrogen peroxide generation associated with the oxidations of the eumelanogenic precursors 5,6-dihydroxyindole and 5,6-dihydroxyindole-2-carboxylic acid. Melanoma Res. 6, 341-349.[Medline]
Nordlund, J. J and Abdel-Malek, Z. (1988). Mechanisms for postinflammatory hyperpigmentation and hypopigmentation. Prog. Clin. Biol. Res. 256, 219-236.[Medline]
Nose, K. and Ohba, M. (1996). Functional activation of the erg-1 (early growth response-1) gene by hydrogen peroxide. Biochem. J. 316, 381-383.
Nose, K., Shibanuma, M., Kikuchi, K., Kageyama, H., Sakiyama, S. and Kuroki, T. (1991). Transcriptional activation of early-response genes by hydrogen peroxide in a mouse osteoblastic cell line. Eur. J. Biochem. 201, 99-106.[Medline]
Ohba, M., Shibanuma, M., Kuroki, T. and Nose, K. (1994). Production of hydrogen peroxide by transforming growth factor-ß1 and its involvement in the induction of egr-1 in mouse osteoblastic cells. J. Cell Biol. 126, 1079-1088.
Passi, S., Grandinetti, M., Maggio, F., Stancato, A. and de Luca, C. (1998). Epidermal oxidative stress in vitiligo. Pigment Cell Res. 11, 81-85.[Medline]
Peinado, P., Martínez-Liarte, J. H., del Marmol, V., Solano, F. and Lozano, J. A. (1992). Glutathione depletion in mouse melanoma cells increases their sensitivity to oxidative lysis. Cancer J. 5, 348-353.
Peus, D., Vasa, R. A., Beyerle, A., Meves, A., Krautmacher, C. and Pittelkow, M. R. (1999). Reactive oxygen species in cultured keratinocytes. J. Invest. Dermatol. 112, 751-756.[Medline]
Pezzuto, J., Shieh, H., Saughnessy, E. and Beattie, C. (1988) Approaches for drug development in treatment of advanced melanoma. Semin. Oncol. 15, 578-588.[Medline]
Pinkus, R., Weiner, L. M. and Daniel, V. (1996). Role of oxidants and antioxidants in the induction of AP-1, NF-kB, and glutathione S-transferase gene expression. J. Biol. Chem. 271, 13422-13429.
Price, E. R., Ding, H.-F., Badalian, T., Battacharya, S., Takemoto, C., Yao, T. P., Hemesath, T. J. and Fisher, D. E. (1998a). Lineage-specific signaling in melanocytes. c-kit stimulation recruits p300/CBP to microphthalmia. J. Biol. Chem. 273, 17983-17986.
Price, E. R., Horstmann, M. A., Wells, A. G., Welbaecker, K. N., Takemoto, C. M., Landis, M. W. and Fisher, D. E. (1998b).
-Melanocyte-stimulating hormone signaling regulates expression of microphthalmia, a gene deficient in Waardenburg syndrome. J. Biol. Chem. 273, 33042-33047.
Sarna, T., Pilas, B., Land, E. J. and Truscott, G. (1986). Interaction of radicals from water radiolysis with melanin. Biochim. Biophys. Acta 883,162-167.[Medline]
Schreck, R., Rieber, P. and Baeuerle, P. A. (1991). Reactive oxygen intermediates as apparently widely used messengers in the activation of the NF-kB transcription factor and HIV-1. EMBO J. 10, 2247-2258.[Medline]
Shang, F., Gong, X. and Taylor, A. (1997). Activity of ubiquitin-dependent pathway in response to oxidative stress. Ubiquitin-activating enzyme is transiently upregulated. J. Biol. Chem. 272, 23086-23093.
Sundaresan, M., Yu, Z., Ferrans, V., Irani, K. and Finkel, T. (1995). Requirement for generation of H2O2 for platelet-derived growth factor signal transduction. Science 270, 296-299.
Swope, V., Abdel-Malek, Z., Kassem, L. and Norlund, J. (1991). Interleukins 1
and 6 and tumor necrosis factor-
are paracrine inhibitors of human melanocyte proliferation and melanogenesis. J. Invest. Dermatol. 96, 180-185.[Medline]
Tachibana, M., Takeda, K., Nobukuni, Y., Urabe, K., Long, J. E., Meyers, K. A., Aaronson, S. A. and Miki, T. (1996). Ectopic expression of MITF, a gene for Waardenburg Syndrome type 2, converts fibroblasts to cells with melanocyte characteristics. Nat. Genet. 14, 50-54.[Medline]
Tassabehji, M., Newton, V. and Read, A. (1994). Waardenburg syndrome type 2 caused by mutations in the human microphthalmia (MITF) gene. Nat. Genet, 8, 251-255.[Medline]
Thannickal, V. J., Hassoun, P. M., White, A. C. and Fanburg, B. L. (1993). Enhanced rate of H2O2 release from bovine pulmonary artery endothelial cells induced by TGF-ß1. Am. J. Physiol. 265, L622-L626.
Thannickal, V. J. and Fanburg, B. L. (1995). Activation of an H2O2-generating NADH oxidase in human lung fibroblasts by transforming growth factor-ß1 J. Biol. Chem. 270, 30334-30338.
Tsukamoto, K., Ueda, M. and Hearing, V. (1992). Melanogenesis in murine melancytes is suppressed by infection with the v-rasHa oncogene. Pigment Cell Res. 2, Suppl., 181-184.
Urabe, K., Aroca, P., Tsukamoto, K., Mascagna, D., Palumbo, A., Prota, G. and Hearing, V. (1994) The inherent cytotoxicity of melanin precursors: a revision. Biochim. Biophys. Acta. 1221, 272-278.[Medline]
Winder, A. J. and Harris, H. (1991). New assays for tyrosine hydroxylase and dopa oxidase activities of tyrosinase. Eur. J. Biochem. 198, 317-326.[Medline]
Yagi, K. (1984) In Methods in Enzymology. Vol. 105 (ed. L. Packer), pp 328-331. Academic Press, London.
Yasumoto, K., Yokoyama, K., Shibata, K., Tomita, Y. and Shibahara, S. (1994). Microphthalmia-associated transcription factor as a regulator for melanocyte-specific transcription of the human tyrosinase gene. Mol. Cell. Biol. 14, 8058-8070.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||