spacer gif spacer gif spacer gif spacer gif Propose a workshop for 2011 spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Howard, T. L.
Right arrow Articles by Hollenberg, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Howard, T. L.
Right arrow Articles by Hollenberg, S. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Journal of Cell Science 114, 2395-2404 (2001)
© 2001 The Company of Biologists Limited


RESEARCH ARTICLE

CHMP1 functions as a member of a newly defined family of vesicle trafficking proteins

Tiffani L. Howard, Daniel R. Stauffer*, Catherine R. Degnin and Stanley M. Hollenberg

Vollum Institute, L474, Oregon Health Sciences University, 3181 S.W. Sam Jackson Park Rd, Portland, OR 97201-3098, USA

*Author for correspondence (e-mail: stauffer{at}ohsu.edu)

Accepted January 18, 2001


    SUMMARY
 Top
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
A multivesicular body is a vesicle-filled endosome that targets proteins to the interior of lysosomes. We have identified a conserved eukaryotic protein, human CHMP1, which is strongly implicated in multivesicular body formation. Immunocytochemistry and biochemical fractionation localize CHMP1 to early endosomes and CHMP1 physically interacts with SKD1/VPS4, a highly conserved protein directly linked to multivesicular body sorting in yeast. Similar to the action of a mutant SKD1 protein, overexpression of a fusion derivative of human CHMP1 dilates endosomal compartments and disrupts the normal distribution of several endosomal markers. Genetic studies in Saccharomyces cerevisiae further support a conserved role of CHMP1 in vesicle trafficking. Deletion of CHM1, the budding yeast homolog of CHMP1, results in defective sorting of carboxypeptidases S and Y and produces abnormal, multi-lamellar prevacuolar compartments. This phenotype classifies CHM1 as a member of the class E vacuolar protein sorting genes. Yeast Chm1p belongs to a structurally-related, but rather divergent family of proteins, including Vps24p and Snf7p and three novel proteins, Chm2p, Chm5p and Chm6p, which are all essential for multivesicular body sorting. These observations identify the conserved CHMP/Chmp family as a set of proteins fundamental to understanding multivesicular body sorting in eukaryotic organisms.

Key words: Biological transport, Endosomes, Vacuoles, Carboxypeptidases, Nuclear matrix, Gene silencing


    INTRODUCTION
 Top
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Vesicle trafficking provides communication and transport between membrane-bound compartments involved in biosynthesis, degradation and cell surface signaling. Within this membrane-defined network, endosomes function as intermediate sorting sites that link trafficking between the trans-Golgi, lysosomes and plasma membrane (Gruenberg and Maxfield, 1995). Vesicle budding from endosomes, outward into the cytoplasm, removes cargo for recycling back to the cell surface or Golgi apparatus (Mellman, 1996), prior to maturation of the endosomes and their fusion with lysosomes (Bright et al., 1997; Futter et al., 1996; Mullock et al., 1998; van Deurs et al., 1995). The decision to recycle or degrade an endocytosed receptor protein is determined, in part, by competition between this outward endosomal vesicle budding and inward vesicle budding into the endosome. This latter process results in formation of a vesicle-filled endosome, the multivesicular body (MVB) (Felder et al., 1990; Friend, 1969; Hopkins and Trowbridge, 1983). MVB formation places receptor proteins and integral membrane hydrolases within the endosome (Odorizzi et al., 1998), which enables delivery to the lumen of the lysosome after fusion of endosome-lysosome membranes (Luzio et al., 2000).

Since MVB formation occurs in simple eukaryotes (Hicke et al., 1997; Li et al., 1999; Prescianotto-Baschong and Riezman, 1998; Wurmser and Emr, 1998), budding yeast is a useful model system for delineating this process. Genetic screens in Saccharomyces cerevisiae have identified a set of genes, the class E VPS, required for MVB sorting (Odorizzi et al., 1998; Odorizzi et al., 2000). These genes belong to a much larger group whose mutation results in defective vacuolar protein sorting (vps) (Bankaitis et al., 1986; Robinson et al., 1988; Rothman et al., 1989; Rothman and Stevens, 1986). vps mutants aberrantly secrete a soluble vacuolar hydrolase, carboxypeptidase Y (CPY), to the extracellular space (Bryant and Stevens, 1998; Raymond et al., 1992; Robinson et al., 1988; Rothman and Stevens, 1986). Class E vps mutants exhibit an additional, distinctive defect in protein sorting: an integral-membrane hydrolase, carboxypeptidase S (CPS), cannot be targeted to the vacuole lumen, its normal site of action. Instead, CPS remains on the vacuole membrane, a fate shared with endocytosed alpha-factor receptor in class E vps mutants (Li et al., 1999; Odorizzi et al., 1998). Ultrastructural analysis of class E vps mutants by electron microscopy reveals an enlarged, aberrant endosomal structure comprising stacked membranes, the class E compartment (Raymond et al., 1992; Rieder et al., 1996). In combination, these observations strongly suggest that the primary defect in class E vps mutants is the inability to properly invaginate endosomal membrane to form an MVB (Odorizzi et al., 1998).

CPY missorting screens in budding yeast have identified 13 class E VPS genes (Raymond et al., 1992). Six of these genes have been analyzed molecularly: VPS4, VPS23, VPS24, VPS27, VPS28 and SNF7/VPS32 (Babst et al., 2000; Babst et al., 1997; Babst et al., 1998; Li et al., 1999; Piper et al., 1995; Rieder et al., 1996). The encoded proteins have no reported structural similarity, and only a pair of functional inter-relationships has been described: the ATPase Vps4p couples ATP hydrolysis with membrane release of Vps24p and Snf7p/Vps32p (Babst et al., 1998). The membrane association of these and other class E Vps proteins is thought to be linked to the presence of a specific bis-phosphorylated phosphatidylinositol on the endosomal membrane (Odorizzi et al., 1998; Odorizzi et al., 2000). This novel phosphoinositide is hypothesized to play a pivotal role in initiating or regulating MVB formation but, to date, no class E Vps protein has been demonstrated to bind it directly. In addition, the relationship between the identified class E Vps proteins and a postulated coat complex has not been elucidated (Wurmser et al., 1999).

Mammals have structural relatives of many or all identified yeast class E Vps proteins (Odorizzi et al., 1998), and functional conservation of two members has been demonstrated. Overexpression of an ATPase-defective human SKD1/VPS4 in mammalian cells results in altered protein sorting and dilated endosomal compartments, structures potentially analogous to the class E compartment observed in vps4 mutant yeast (Bishop and Woodman, 2000; Yoshimori et al., 2000). Similarly, deletion of mouse HRS, which encodes a mammalian structural counterpart to yeast Vps27p (Komada et al., 1997), produces enlarged, transferrin receptor-positive endosomal structures (Komada and Soriano, 1999).

We have identified a mammalian protein, CHMP1, which physically interacts with human SKD1, localizes to early endosomes and can disrupt membrane trafficking when overexpressed in mutant form. CHMP1 is structurally conserved in simple and complex eukaryotes and has led to the identification of a family of proteins (Chmps) required for yeast MVB sorting. Structural similarities within the CHMP/Chmp family suggest cooperative or sequential action of these proteins in a related aspect of MVB formation.


    MATERIALS AND METHODS
 Top
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Plasmid construction
Parental vectors were obtained or constructed as follows. CS2+ was a gift from Dave Turner. ßAct was constructed from CS2+ by replacing the cytomegalovirus regulatory region with a 300 nucleotide fragment from the promoter of rat ß-actin. p2FLAG is a pcDNA3 derivative that encodes a tandem array of FLAG epitopes within the polylinker and was a gift from Phil Stork (Oregon Health Science University). p316-ADH was constructed by inserting the S. cerevisiae ADH promoter and terminator from pBTM116 (Hollenberg et al., 1995) into pRS316 (Sikorski and Hieter, 1989). pLex-A is a pBTM116 derivative containing the ADE2 gene of S. cerevisiae (Chen et al., 1996).

Two hybrid bait plasmid pLex-CHMP1 was constructed by introducing the full-length human CHMP1 coding sequence (GenBank AF281063) into the unique BamHI site of pLex-A. The full-length human SKD1 coding sequence (GenBank AF159063), obtained from two-hybrid screening with CHMP1, was mutagenized with sense and antisense 5' CATCATCTTCATCGACCAGGTCGATTCCCTCTGCGGG 3' primers using the QuikChange Site-Directed Mutagenesis kit (Stratagene) to produce SKD1(E228Q). The entire open reading frames of SKD1 and SKD1(EQ) were transferred to pmal-c2 (New England Biolabs) to generate pMBP-SKD1 and pMBP-SKD1(EQ). In addition, the SKD1(EQ) coding sequence was introduced into p2FLAG to generate p2FLAG-SKD1(EQ).

Plasmid expression vectors for Escherichia coli expression of CHMP1 fusion proteins were constructed using the EcoRI/BamHI fragment of CHMP1. This fragment was end-filled and introduced into pmal-c2 (New England Biolabs) or pGEX-kT (Guan and Dixon, 1991) to produce MBP-CHMP1 or GST-CHMP1, respectively.

GFP fusion expression vectors were constructed as follows. The CHMP1 termination codon was removed by amplification with a sense primer and antisense primer 5' GGCAATCGATAGTTCCTCAAGGCGGCCAACCT 3'. The product was fused to GFP coding sequences at its C-terminus in the vector CS2+ to create CS-CHMP1-GFP. The coding sequence of SKD1(EQ) was fused at its N-terminus to GFP sequences and introduced into ßAct (see above) to create ßAct-GFP-SKD1(EQ). The plasmid encoding a GFP-CPS fusion was constructed based on the strategy described previously (Odorizzi et al., 1998). Briefly, an expression cassette was constructed that contained the following elements: the ADH promoter from pBTM116 controlling a GFP-CPS fusion, with GFP fused at its C-terminus to full-length CPS coding sequences. This expression cassette was introduced in pRS421, a 2 µm MET15 plasmid (Brachmann et al., 1998) to generate 421-GFP-CPS. 316-ADH-CHM1 was constructed from 316-ADH (see above) by introducing the S. cerevisiae CHM1 open reading frame generated by amplification with 5' GCAAGGATCCACCATGTCACGTAATTCTGCAGCAGGTTTG 3' and 5' GGCACTCGAGTGAACTAAAAATGCATGACCTGTTAGCATG 3'.

Two-hybrid screen
Yeast strain L40 containing pLex-CHMP1 was used to screen human brain and leukocyte libraries in pAct2 (Clontech). Transformants were plated onto CSM(-His, -Trp, -Leu) (Bio101) containing 1 mM 3-aminotriazole.

Cell culture, immunocytochemistry and antibodies
HEK-293 (human embryonic kidney) or COS7 (African green monkey kidney) cells were cultured on eight-well Nunc SuperCell culture slides (Intermountain Scientific) in Dulbecco’s modified eagle medium with 10% fetal calf serum, 100 units/ml penicillin G, and 100µg/ml streptomycin (Gibco BRL). Twenty-four hours after plating, cells were directly fixed (see below) or transfected using LipofectAMINE in the presence of Opti-MEM1 (Gibco BRL). Five hours post-transfection, cells were washed, fed using DMEM with serum, and incubated for another 24 hours. Cells were fixed with 4% paraformaldehyde, washed, blocked, permeabilized and exposed to primary and secondary antibodies. Rabbit polyclonal anti-CHMP1 (1:300) was made by injection of GST-CHMP1 fusion protein mixed with Freund’s incomplete adjuvant into rabbits by Pocono Rabbit Farm & Laboratory Inc. The antibody was subsequently purified over a MBP-CHMP1 Affigel (Bio-Rad) column and eluted with low pH. The CHMP1 antibody does not crossreact with any of the other CHMP proteins we have identified, including closely related CHMP2. Mouse monoclonal antibodies used were specific for transferrin receptor (B3/25.4, 1:100; a gift of Ian Trowbridge, The Salk Institute), lysobisphosphatidic acid (6C4, 1:10; a gift of Jean Gruenberg, University of Geneva), Rab7 (1:300; a gift of Suzanne Pfeffer, Stanford), early endosomal antigen-1 (EEA1; Transduction Laboratories; 1:200), cation-independent mannose-6 phosphate receptor (M6PR, 1:300; a gift of William Brown, Cornell University), LAMP-1 (PharMingen; 1:100), mannosidase II (1:20; a gift of Kelly Moremen, University of Georgia), and {gamma}-adaptin (H4A3; Sigma; 1:50). Secondary antibodies used were anti-rabbit Alexa 488 (Molecular probes; 1:300) and anti-mouse Cy3 (Jackson ImmunoResearch Laboratories Inc; 1:300), and included Hoechst 33258 (Molecular Probes) at 1.0 µg/ml. Samples were visualized with a Zeiss Axioplan microscope or by laser scanning confocal microscopy on a BioRad MRC 1000.

Percoll gradient and membrane fractionation
The Percoll gradient analysis was performed with HEK293 cells, as described previously (Czekay et al., 1997) with some modifications (Press et al., 1998). Membrane fractionation analysis was carried out based on a published method (Wan et al., 1998). HEK293 cells were harvested and washed in PBS. Cells were resuspended in 1.5 ml of lysis buffer (10 mM Tris-HCl pH 7.4, 2.5 mM MgCl2, protease inhibitors) and transferred to ice for 15 minutes. Cells were lysed with 25-60 strokes of a dounce homogenizer and the lysate was gently layered over a sucrose cushion (0.5 M sucrose, 10 mM Tris-HCl pH 7.4, 2.5 mM MgCl2). Nuclei were pelleted by centrifugation at 5000 g for 10 minutes at 4°C in a Sorvall HB4 rotor. The upper layer consisting of cytoplasmic extract was collected and concentrated to 100 µl in a Centricon 10 column. This fraction was centrifuged at 100,000 g for 1 hour at 4°C in a TLA 45 rotor (Beckman), resulting in a soluble supernatant and membrane-associated pellet. The pellet was either resuspended in 100 µl of RIPA buffer (50 mM Tris-HCl pH 7.4, 5 mM DTT, 150 mM NaCl, 1% NP-40, 0.5% deoxycholate, 0.1% SDS, protease inhibitors) for gel analysis or resuspended in 100 µl of high salt buffer (10 mM Tris-HCl pH 7.4, 750 mM NaCl, with protease inhibitors) and centrifuged for 1 hour at 100,000 g yielding a high salt supernatant and pellet. This pellet was then resuspended in 100 µl of high pH buffer (10 mM Tris-HCl pH 11.0, 100 mM Na2CO3, protease inhibitors) and centrifuged for 1 hour at 100,000 g yielding a high pH supernatant and final pellet. The final pellet was resuspended in 100 µl of RIPA buffer. Equal cell equivalents were resolved by SDS-PAGE and CHMP1 was visualized by western blot analysis.

Co-immunoprecipitation and pulldown assays
For co-immunoprecipitations, 293 cells were transfected with LipofectAMINE (Gibco-BRL). Forty-eight hours after transfection the cells were washed twice in ice cold PBS, scraped in PBS, pelleted, resuspended in 0.1 M sodium phosphate, pH 7.8, containing 0.1% NP-40, and lysed by repeated freeze-thaw cycles. Co-immunoprecipitation reactions contained 20 µl anti-FLAG M2 affinity gel (Sigma) and 200 µg cell lysate, and were incubated for 2 hours at 4°C. Following several washes in TENN (20 mM Tris-Cl, 5 mM EDTA, 150 mM NaCl, 0.5% NP-40), proteins bound to the resin were resolved by SDS-PAGE and analyzed by western analysis with anti-CHMP1 antibody.

MBP-fusions for in vitro binding assays were purified over amylose resin according to the manufacturer’s instructions (New England Biolabs). The yield and purity of each fusion protein was determined by SDS-PAGE. Based on this analysis, equal amounts of fusion protein and resin were added to an equal volume of binding buffer. CHMP1 and GFP were synthesized using the TNT SP6 coupled reticulocyte lysate system (Promega) in the presence of [35S]methionine. An aliquot of in vitro translated protein was incubated with amylose resin-bound protein (MBP, MBP-SKD1, or MBP-SKD1(EQ)) in 25 µl NETT (20 mM Tris, pH 8.0, 100 mM NaCl, 1 mM EDTA, 0.2% Triton X-100) for 2 hours at 4°C. Binding reactions were subsequently washed in NETT, and analyzed by SDS-PAGE and autoradiography.

Yeast strains
BY4741 and isogenic deletions of chm2, vps24, snf7, chm6 and vps4 were obtained from the Saccharomyces Deletion Project through Research Genetics. CHM1 and CHM5 were replaced by LEU2 in either BY4741 or the snf7 deletion strain using PCR-mediated gene disruption (Wach, 1996). Homologous recombination was confirmed by 5' and 3' PCR amplification.

Carboxypeptidase S sorting assay
Yeast cultures expressing GFP-CPS were cultured in CSM(-Met) (Bio101), harvested at mid-log phase, and pulse-labeled with 20 mM FM4-64 (Molecular Probes) at 30°C (Vida and Emr, 1995). Samples were visualized by laser scanning confocal microscopy on a BioRad MRC 1000.

CPY sorting assay
CPY sorting was measured based on several previously described methods (Gaynor et al., 1994; Klionsky et al., 1988; Vida et al., 1990). Yeast was grown in CSM (-Met) to mid-log phase. Cells were spheroplasted for 30 minutes in 0.5 ml CSM containing 1 M sorbitol and 2 µl zymolyase 100T, washed in 1.2 M sorbitol, and resuspended to 10 OD600/ml with 135 µl CSM (-Met) containing 1 M sorbitol, 1 mg/ml BSA, and 0.2 U {alpha}2-macroglobulin. Cells were pulse-labeled for 10 minutes with 100 µCi [35S]methionine at 30°C. Chase was initiated with the addition of chase solution (to a final concentration of 0.2% yeast extract, 5 mM methionine, 1 mM cysteine). After a 40 minute incubation, cultures were spun at 13,000 g to produce supernatant (extracellular; EC) and pellet (intracellular; IC) fractions. EC was adjusted to 1% SDS, IC was resuspended in 150 µl resuspension buffer (50 mM Tris, pH 7.5, 1 mM EDTA, 1% SDS) and samples were boiled for 4 minutes. After brief pelleting, supernatants were transferred to fresh tubes containing 1 ml IP buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 0.1 mM EDTA, 0.5% Tween-20) and immunoprecipitated with 1.75 µg CPY antibody (Molecular Probes, mouse monoclonal 10A5-B5). Antibody was bound with 20 µl 50% Protein A/G beads (Santa Cruz). Complexes were washed with NETT and RIPA (50 mM Tris-Cl, pH 7.4, 150 mM NaCl, 1% Triton X-100, 0.1% SDS, 1% sodium deoxycholate) and resolved by SDS-PAGE.

Electron microscopy
Cells were fixed and stained as described previously (Banta et al., 1988) with the following modifications. Cells were fixed overnight at 4°C in 3% glutaraldehyde. Spheroplasts were produced with 70 units/ml ß-glucuronidase type HP-2S (Sigma) and 2.5 mg/ml Zymolase 20T (Seikagaku Corporation) for 20 minutes at 30°C in 1.2 M sorbitol in 0.1 M KPO4, pH 4.0. Subsequent to staining, samples were dehydrated and embedded in Epon 812 resin. Sections were analyzed on a transmission electron microscope (Phillips CMJ120). Cell counts resulted from inspecting the cytoplasm of cells that were stained sufficiently to visualize the plasma and nuclear membrane. Cells with multi-lamellar cytoplasmic membrane structures were scored as positive.


    RESULTS
 Top
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Mammalian CHMP1 is localized to early endosomes
CHMP1 was identified in a two-hybrid screen for Polycomblike partners (Stauffer et al., 2001). A CHMP1-specific antibody was generated, affinity-purified and used to define the sites of CHMP1 expression. Western analysis of cell lines and tissues demonstrated that CHMP1 is widely expressed and found in both the cytoplasm and nuclear matrix (Stauffer et al., 2001). We have used immunocytochemistry to investigate the localization of CHMP1 in individual cells and report here its distribution and role within the cytoplasm. CHMP1 distributes to a punctate, asymmetrical pattern centered over the microtubule organizing center (data not shown), a pattern similar to several membrane-bound compartments involved in vesicle trafficking. To more accurately define the compartment to which CHMP1 localizes, cells were double-labeled with antibodies to CHMP1 and proteins that mark endosomes (transferrin receptor (TfR); early endosomal antigen (EEA1); and lysobisphosphatidic acid (6C4)), lysosomes (LAMP-1), and regions of the Golgi apparatus (mannosidase II (Man II); {gamma}-adaptin). As shown in Fig. 1, although there is considerable overlap between compartments, the CHMP1 pattern is most highly coincident with the early endosomes defined by the transferrin receptor (Trowbridge et al., 1993).



View larger version (96K):
[in this window]
[in a new window]
 
Fig. 1. Cytoplasmic CHMP1 colocalizes with endosomes. COS7 cells were double-labeled with antibodies to CHMP1 and the indicated trafficking markers, and visualized by indirect immunofluorescence. Labeled structures are early endosomes, TfR and EEA1; late endosomes, Rab7; lysosomes, LAMP-1; medial and trans-Golgi, mannosidase II (Man II); and trans-Golgi, {gamma}-adaptin ({gamma}-adap). Note that CHMP1 and TfR patterns are most highly related.

 
The membrane-association of CHMP1 was further defined by high speed centrifugation analysis. Cytoplasmic extracts from HEK293 cells was centrifuged at 100,000 g for 1 hour to produce soluble (S100) and membrane pellet (P100) fractions. Western analysis demonstrates that the majority of CHMP1 is soluble, but a reproducible fraction pellets with membranes (Fig. 2A, compare lanes 1,2). Sequential treatment of the membrane fraction with high salt and alkali reveals that the CHMP1 is almost quantitatively released by treatment with high salt (Fig. 2A, compare lanes 3-5). This indicates that CHMP1 is peripherally associated with membranes through ionic interactions, an observation consistent with the charged nature of CHMP1 (see below).



View larger version (54K):
[in this window]
[in a new window]
 
Fig. 2. CHMP1 is peripherally associated with the membranes of early and late endosomes. (A) HEK293 cytoplasmic extract was centrifuged at 100,000 g to produce soluble (S100) (lane 1) and membrane-associated (P100) (lane 2) fractions. The membrane pellet was sequentially extracted with 750 mM NaCl (lane 3), 0.1 M Na2CO3 (lane 4), and then the residual was completely solubilized (lane 5). Comparable cell-equivalents from each treatment were resolved by SDS-PAGE and analyzed by western blot for CHMP1. (B) Human 293 cytoplasmic extract was layered on, and centrifuged through, a Percoll gradient. The indicated numbered fractions were collected from the top and analyzed by western blot for CHMP1 and the other early (EEA1) and late (Rab7) endosome, and lysosome (LAMP-1) markers. Note that CHMP1 overlaps well with EEA1, but is also detectable in more dense fractions.

 
This biochemically defined membrane interaction was used to confirm and extend the immunocytochemical localization of CHMP1. Others have demonstrated that early and late endosomes and lysosomes can be resolved, based on their differing densities, by centrifugation through a Percoll gradient (Czekay et al., 1997; Press et al., 1998). We have used this approach to measure the distribution of CHMP1. As shown in Fig. 2B, the bulk of CHMP1 is found at the very top of the gradient, colocalized with soluble proteins (data not shown), which is consistent with the partial membrane association of Fig. 2A. In addition, measurable levels of CHMP1 enter the gradient and overlap with the early endosome pattern defined by EEA1 (Mu et al., 1995). Interestingly, detectable CHMP1 also co-migrates with Rab7 in late endosome fractions that do not exhibit an EEA1 signal (Fig. 2B, fractions 6-8), indicating that CHMP1 is distributed between both early and late endosomes, consistent with its overlap with the Tfr by immunocytochemistry (Fig. 1)

Human CHMP1 interacts with trafficking protein SKD1
To gain insight into the function of CHMP1, it was fused to LexA and used as bait in a yeast two-hybrid screen (Hollenberg et al., 1995) of human brain and leukocyte cDNA fusion libraries. Remarkably, 80% of the positives corresponded to full-length human VPS4/SKD1 (Bishop and Woodman, 2000; Scheuring et al., 1999; Yoshimori et al., 2000). Mammalian SKD1 is a close structural relative of an ATPase in yeast, Vps4p, which is required for correct vacuolar protein sorting and belongs to the class E VPS group (see Introduction) (Banta et al., 1988; Raymond et al., 1992; Robinson et al., 1988). Babst and co-workers have demonstrated that Vps4p regulates the membrane association of two other class E VPS gene products, Vps24p and SNF7p/Vps32p, through ATP hydrolysis (Babst et al., 1998).

The interaction between CHMP1 and SKD1 has been confirmed using an in vitro binding assay. For this analysis, binding to wild-type SKD1 and an ATPase-defective mutant derivative SKD1(EQ) (Bishop and Woodman, 2000) was compared. Each was expressed in E. coli as a fusion with maltose-binding protein (MBP) and affinity purified. As shown in Fig. 3A, in vitro translated CHMP1 shows significant binding to MBP-SKD1 above MBP alone (compare lanes 6,7). Furthermore, introduction of the inactivating E to Q mutation in SKD1 appears to increase CHMP1 binding (Fig. 3A, compare lanes 7,8). Although the increase is small, it is reproducible within each experiment.



View larger version (40K):
[in this window]
[in a new window]
 
Fig. 3. CHMP1 physically interacts with human SKD1/VPS4 in vitro and in vivo. (A) CHMP1 and a control GFP protein were radiolabeled by in vitro translation and incubated with purified, immobilized MBP, MBP-SKD1 or MBP-SKD1(EQ). Bound protein was eluted, resolved by SDS-PAGE and visualized by fluorography. The input lane represents one-tenth the amount of radiolabeled protein used in each binding reaction. Note that only CHMP1 efficiently binds both wild-type and mutant (EQ) SKD1. (B) COS7 cells were transiently transfected with plasmids that produce unfused- or SKD1(EQ) -fused FLAG epitope, plus (lanes 1-4) or minus (lanes 5,6) a CHMP1 expression vector. Cell extracts were immunoprecipitated with anti-FLAG M2 affinity gel (Sigma), and bound material was analyzed by SDS-PAGE, followed by western blot with CHMP1 antibody. Note that SKD1(EQ) can immunoprecipitate endogenous CHMP1 (lane 6). (C) Transfected COS7 cells overexpressing GFP-SKD1(EQ) were analyzed by immunocytochemistry for changes in the endogenous CHMP1 distribution. Transfected (arrowhead) and untransfected (arrow) cells are indicated. Cells were visualized by fluorescence microscopy.

 
The ability of CHMP1 and SKD1 to interact was also measured in cellular extracts. Based on the moderate increased binding activity of the SKD1(EQ) mutant in vitro, this point mutant was used in a co-immunoprecipitation assay. COS7 cells were co-transfected with plasmids encoding FLAG epitope alone or FLAG fused to SKD1(EQ), and the ability of each to co-immunoprecipitate exogenous CHMP1 was compared. Not only are significant levels of exogenous CHMP1 bound by SKD1(EQ) in this assay (Fig. 3B, compare lanes 2,4), but also endogenous CHMP1 is detectably co-immunoprecipitated (Fig. 3B, compare lanes 2,6). These observations strongly suggest that CHMP1 and SKD1(EQ) physically interact in the cell. To gain further support for this hypothesis, we tested the ability of SKD1(EQ) to redistribute endogenous CHMP1 within the cell. COS7 cells were transfected with a GFP-tagged SKD1(EQ), and the subcellular localization of CHMP1 was measured by indirect immunofluorescence. The GFP-SKD1(EQ) fusion protein produces a punctate cytoplasmic pattern, as was observed previously (Bishop and Woodman, 2000), which is always matched accurately by locally increased CHMP1 signal (Fig. 3C). Overall, these in vitro and in vivo assays demonstrate a partnership between CHMP1 and SKD1.

Mutant CHMP1 and SKD1 produce similar effects on endosomal trafficking
To further define the properties of CHMP1, its C-terminus was fused to GFP and the subcellular pattern analyzed after transient transfection. CHMP1-GFP localizes to structures in the cytoplasm that are visible by phase-contrast microscopy (Fig. 4A, arrowhead). Similar structures are produced by expression of GFP-SKD1(EQ) (Bishop and Woodman, 2000; Yoshimori et al., 2000), but not by unfused GFP (Fig. 4A). The physical interaction between CHMP1 and SKD1, and the similar appearance of the corresponding, overexpressed GFP-fusions, suggest that each GFP-fusion is altering common aspects of endosomal trafficking, and that the fusion of GFP to CHMP1 changes the properties of the protein. We therefore consider GFP-CHMP1 to be a functionally mutant protein. We have tested this idea by comparing the effects of each fusion protein on the morphology of endosomal structures. As shown in Fig. 4B, comparison of untransfected (arrows) with transfected cells (arrowheads) shows that each of these GFP-fusion proteins strongly affects the distribution of both early (EEA1) and late (LBPA/M6PR) endosomal markers. In general, the fine punctate distribution produced with each marker is converted to larger diameter structures, indicating dilation and fusion of trafficking compartments. The GFP-signal from these fusion proteins only partially colocalizes with the endosomal patterns, suggesting both direct and indirect effects on membrane flow within several trafficking pathways. This analysis provides further support for functional similarity between CHMP1 and SKD1 and for a CHMP1 role in vesicle trafficking.



View larger version (65K):
[in this window]
[in a new window]
 
Fig. 4. GFP fusions of CHMP1 and ATPase-defective human SKD1 produce similar effects on endosome structure. COS7 cells were transiently transfected with plasmids encoding the indicated GFP-fusion proteins, fixed, and labeled with antibodies to the indicated proteins or lipid, plus nuclear dye Hoechst 33258. Transfected (arrowheads) and endogenous patterns (arrows) are indicated. (A) Cell were analyzed by phase-contrast and fluorescent microscopy. Note the GFP-positive, phase-contrast visible structures in the cytoplasm that are produced by both CHMP1 and SKD1(EQ) fusions. (B) The indicated antigens were visualized by indirect immunofluorescence microscopy. EEA1 (early endosome antigen 1), a marker for early endosomes (Mu et al., 1995); lysobisphosphatidic acid (LBPA), late endosomes (Kobayashi et al., 1998); and cationic-independent mannose-6-phosphate receptor (M6PR) present on both early and late endosomes.

 
CHMP1 is structurally-related to a family of conserved proteins
Comparison of CHMP1 primary structure with the protein sequence database reveals that CHMP1 is a conserved protein, found in S. cerevisiae and many other eukaryotic organisms (D.R.S. and S.M.H., unpublished). The yeast homolog of CHMP1, Chm1p, shows structural similarity with five other yeast proteins (Fig. 5A). Each protein in this group is related in size (220 amino acid average) and has a conserved, distinctive charge distribution resulting in average predicted isoelectric points of 10.2 and 4.1 for the N- and C-terminal halves, respectively (Fig. 5A; Babst et al., 1998).



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 5. CHMP1 is a conserved member of a structurally related, but divergent, family of yeast and mammalian proteins. (A) The six yeast Chm proteins show related size and predicted isoelectric point (pI) values for their N- and C-terminal halves. Yeast CHM open reading frame assignments are CHM1, YKR035w; CHM2, YKL002w; CHM5, YDR486c; and CHM6, YMR077c. (B) Phylogenetic tree for proteins of the yeast Chmp (boxed) and human CHMP families is shown. ClustalX was used to construct the tree (Thompson et al., 1997). D is a measure of sequence divergence. GenBank accession numbers for human proteins are: CHMP1, AF281063; CHMP1.5, AF281064; CHMP2 (BC-2), AF042384; CHMP2.5 (CGI-84), AF151842; CHMP3 (NEDF), AF219226; CHMP4 (HSPC134), AF161483; CHMP5 (CGI-34), AF132968; and CHMP6, AW965590.

 
The structural relatedness of yeast Chm and mammalian CHMP proteins is illustrated graphically in a phylogenetic tree (Fig. 5B). This tree is composed of two branches, with three distinct sub-families in each branch. In yeast, Chm1p, Chm2p and Vps24p produce one branch, whereas Snf7p/Vps32p, Chm5p and Chm6p define the other. The two branches of the CHMP tree have diverged considerably and show only weak similarity. Each of the six sub-families includes yeast (boxed) and mammalian structural homologs (Fig. 5B). Comparison of any two proteins in the tree reveals sequence similarity that is distributed throughout the length of the protein, not just limited to a defined motif. Despite the weak sequence similarity exhibited by the most divergent members of this family, the common overall structural features illustrated in Fig. 5A appear to mediate a common function, as demonstrated below.

The entire yeast CHM family is required for high fidelity carboxypeptidase Y sorting
Several observations suggest that the yeast CHM family might function in a specific aspect of vacuolar protein sorting. Studies outlined above demonstrate that mammalian CHMP1 localizes to endosomes, physically interacts with SKD1, and can disrupt trafficking in a manner similar to SKD1. In addition, CHMP1 shows structural similarity to Vps24p and Snf7p/Vps32p (Fig. 5A), class E Vps proteins that function with the budding yeast counterpart of SKD1. Therefore, we have used a genetic strategy to test the role in vacuolar protein sorting of CHM1 and three other previously uncharacterized CHM family members, CHM2, CHM5 and CHM6.

The standard assay which identifies vps mutants measures maturation and targeting of a soluble hydrolase, CPY, to the vacuole lumen (Bankaitis et al., 1986; Robinson et al., 1988; Rothman et al., 1989; Rothman and Stevens, 1986). We have constructed or obtained deletions of each member of the S. cerevisiae CHM family, including previously characterized VPS24 and SNF7/VPS32 (Babst et al., 1998), and analyzed their ability to sort and process CPY. Cells were collected at mid-log phase, converted to spheroplasts, pulse-chase labeled with [35S]methionine, separated into secreted and spheroplast fractions, and then analyzed for the presence of CPY by immunoprecipitation. As shown in Fig. 6A, each chm deletion strain (and vps4) correctly processes over half of its CPY to an intracellular (I) form of 61 kDa (Fig. 6A). The remaining CPY migrates as an immature, unprocessed form of 69 kDa in both the intracellular (I) and extracellular (E) fractions. By contrast, the parental strain (+) quantitatively processes and targets all CPY. All chm single mutants show a comparable defect in CPY sorting, which is not increased in chm double mutants (Fig. 6A; chm1 snf7; and data not shown). The inability of double mutants to increase the phenotypic severity suggests that CHM gene products function in a common pathway required for high fidelity CPY sorting.



View larger version (92K):
[in this window]
[in a new window]
 
Fig. 6. Yeast chm deletions show delayed processing and partial secretion of CPY and produce a Class E vps multi-lamellar structure. (A) Parental yeast (+; BY4741), derivatives generated by deletion of the indicated CHM open reading frames, and the structurally unrelated class E vps sorting mutant, vps4, were pulse-chase labeled as spheroplasts. Intracellular (I) and extracellular (E) fractions were immunoprecipitated with CPY monoclonal antibody (Molecular Probes), resolved by SDS-PAGE, and visualized by fluorography. Proenzyme (pro, 69 kDa) and mature (m, 61 kDa) forms of CPY are indicated. Note that all mutants missort CPY and that the extent of missorting is not increased with a double chm mutant (chm1 snf7). (B-D) Transmission electron micrographs of parental (B) and chm1 mutant cells (C,D). An example of a class E structure (C, arrow) is shown magnified (D). A vacuole in each cell is indicated (v). (E) The frequency (%) of cells with one or more of these multi-lamellar class E vps structures is tabulated for each chm mutant. n, number of cells scored.

 
chm deletions form multi-lamellar class E vps compartments
To further classify chm mutants and to facilitate identification of the specific process that is disrupted, we analyzed mutant cells ultrastructurally using transmission electron microscopy. The defining morphological feature of vps4, vps24, snf7/vps32 and all other class E vps mutants is a multi-lamellar structure visible by electron microscopy (Odorizzi et al., 1998; Piper et al., 1995; Raymond et al., 1992; Rieder et al., 1996). As shown in Fig. 6B, parental yeast typically exhibits at least one prominent vacuole (v), but completely lack the darkly stained, multi-layered membrane stacks visible in a chm1 mutant (Fig. 6C,D). Tabulation of the frequency of these aberrant structures reveals that none are visible in sections from 260 cells of the parental strain, whereas 14% to 44% of cell sections from chm deletion strains, including previously characterized vps24 and snf7/vps32, show aberrant multi-lamellar structures in the cytoplasm (Fig. 6E). The frequency of these structures varies somewhat between chm mutants, but their general appearance does not. The relative percentages between the mutant strains should not be emphasized, instead the qualitative difference between the WT strain (0% of the cells containing class E compartments) and each of the mutant strains (>14%) is the significant observation. This suggests that each deletion results in a similar ultrastructural change, the formation of a class E vps prevacuolar compartment.

Each yeast CHM gene is required for sorting to the multivesicular body
Odorizzi and coworkers have demonstrated that missorting of CPS is a hallmark of class E vps mutants (Odorizzi et al., 1998). In their analysis, all known class E vps mutations were unable to sort a GFP-CPS fusion protein to the vacuole lumen. Instead, the GFP signal accumulated on the vacuolar membrane. These studies suggested that class E VPS genes function in sorting proteins (and lipid) to the multivesicular body (see Introduction). To confirm the EM assignment of the CHM family as class E VPS, we tested each chm deletion mutant in this CPS sorting assay. The parental strain (+) shows a GFP-CPS fluorescence that is internal to the vacuolar membranes identified with the vital membrane dye FM4-64 (Fig. 7). By contrast, deletion of each chm gene dramatically changes the GFP pattern. These mutants show a GFP signal that is largely excluded from the vacuole interior, but colocalizes with the FM4-64 membrane signal instead. In addition, intense GFP signals are visible in a perivacuolar location, which presumably corresponds to the class E vps compartment (Fig. 6B-D). The sorting defect observed with GFP-CPS for the chm1 mutant can be efficiently rescued by expression of CHM1 from a CEN plasmid under control of the ADH promoter. CHM2, CHM5 and CHM6 genes at single copy and expressed from their own promoters also rescue their corresponding mutations (T.L.H. and S.M.H., unpublished).



View larger version (77K):
[in this window]
[in a new window]
 
Fig. 7. chm deletions in yeast cannot sort a CPS-GFP fusion protein to the vacuole lumen. Parental yeast (+) and the indicated chm mutants were transformed with a GFP-CPS expression vector (2 µm). Each strain was stained with the vital dye FM4-64 (red), which labels the vacuolar membrane under our chase conditions, and was imaged by laser scanning confocal microscopy. Rescue of chm1 is shown with a single copy plasmid containing the ADH promoter fused to the CHM1 open reading frame. Note the lumenal GFP signal in the parent and the CHM1/chm1 strain, but membrane localization in all chm mutants. The strong GFP signal that accumulates adjacent to the vacuole in all chm mutants marks apparent class E compartments.

 

    DISCUSSION
 Top
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 
Based on conserved structural features and functional similarities, we have identified a CHMP/Chmp family of eukaryotic proteins. Genetic studies in yeast demonstrate the Chmp family functions in a common aspect of vesicle trafficking. Specifically, deletion of each of the six S. cerevisiae CHM genes results in similar effects, disrupting prevacuolar/endosomal structure and producing a missorting of two vacuolar hydrolases. The phenotype shared by these mutants points to a role for each of these proteins in MVB sorting, a role already demonstrated for the two previously characterized members of this yeast CHM family, VPS24 and SNF7/VPS32. Studies with CHMP1 in mammalian cells supports this functional assignment and indicates functional conservation across eukaryotes. CHMP1 is peripherally associated with the membranes of both early and late endosomes and alters endosomal structure when a CHMP1-fusion derivative is overexpressed. Furthermore, mammalian CHMP1 physically interacts with the mammalian homolog of another yeast protein required for MVB sorting, Vps4p. These observations suggest that CHMP1 and its yeast counterpart have a similar role and protein partner during MVB sorting.

Identification of four new yeast class E vps mutants
The phenotypic consequences of CHM1, -2, -5 and -6 deletion categorizes them as class E VPS genes. For example, these new deletion mutants show aberrant secretion of unprocessed CPY into the extracellular space, a phenotype common to all vps mutants, but most similar to other class E vps mutations in correctly targeting the majority of CPY (Raymond et al., 1992). It will be important to determine whether these four CHM genes are allelic to previously identified class E vps mutations, which have not been characterized at the molecular level, or are novel class E VPS genes. The identification of new, non-allelic class E vps mutations would not be completely unexpected. The weak CPY missorting phenotype exhibited by class E vps mutants probably reduced the efficiency with which some were isolated during the initial vps mutant screens (Bankaitis et al., 1986; Robinson et al., 1988; Rothman et al., 1989; Rothman and Stevens, 1986).

Structural conservation in MVB formation
With the addition of Chm1p, Chm2p, Chm5p and Chm6p, the yeast Chmp family now totals six structurally related proteins. Since each protein is required for CPS internalization in yeast, each Chmp must play a distinct, non-redundant role in the process. Nevertheless, these proteins show a similar, well-conserved size and charge distribution in the absence of strong primary sequence conservation. How might these proteins function in MVB sorting? One explanation for these conserved features envisions a structural role for Chm proteins on the endosome membrane, where Chm proteins might participate in formation of a membrane coat. Consistent with this hypothesis, CHMP1, Vps24p and Snf7p/Vps32p all show partial membrane association (this study and Babst et al., 1998). This proposed coat would be created by Chm proteins as a membrane-associated lattice (Babst et al., 1998). Within this lattice, the common structural features shared by Chm proteins might allow these proteins to be interchangeable to some extent, which could alter the curvature and/or membrane attachment properties of the lattice. Additional studies directed toward testing this model will determine whether CHMP proteins physically interact within one complex, interact in distinct complexes, or act in a sequential fashion on the endosome membrane.

CHMP1-SKD1/VPS4 interaction
The model proposed above for Chmp action in MVB formation would require restructuring of a membrane lattice to create concave curvature to effect invagination. This restructuring might require changes in protein conformation or protein-protein interaction. The protein previously suggested to carry out this function is yeast Vps4p, a class E Vps protein structurally unrelated to the Chmp family (Babst et al., 1997; Babst et al., 1998). Interestingly, we have demonstrated that mammalian CHMP1 is a physical partner of human SKD1 as measured by two-hybrid, co-immunoprecipitation and in vitro binding studies. This is likely to be a fundamental, conserved functional interaction, since yeast Chm1p shows an equally strong two-hybrid signal with human SKD1 (T.L.H. and S.M.H., unpublished). Two hybrid analysis of interactions between SKD1 and the several other members of the mammalian CHMP family identifies a strong interaction with CHMP2, also known as BC-2 (Keesee et al., 1999), but no signal above background with CHMP3, CHMP4 or CHMP5 (T.L.H. and S.M.H., unpublished). Analysis of yeast CHM mutants supports this specificity of SKD1 interaction: deletion of yeast CHM1 or CHM2, but not CHM5 or CHM6, results in predominant membrane association of Snf7p (C.R.D. and S.M.H., unpublished). The extent of membrane binding is equivalent to that observed in a vps4 background (Babst et al., 1998). Based on these observations, it is likely that SKD1/Vps4p is acting directly on CHMP1/Chm1p and CHMP2/Chm2p, but indirectly on other CHMP/Chm proteins to mediate restructuring and/or membrane dissociation. In conclusion, by identifying a family of divergent but functionally related proteins responsible for MVB formation, this study provides compelling groundwork for the analysis of the role of the CHMP proteins in cellular trafficking.

Note added in proof
While our manuscript was in review, CHM1 (DID2) and CHM2 (DID4) were identified in a screen for suppressors of the doa-1 (deubiquitinating enzyme) mutation. This publication verifies our observation that these proteins are class E Vps factors (Amerik et al., 2000).


    ACKNOWLEDGMENTS
 
We thank the following generous contributors: William Brown, Jean Gruenberg, Kelly Moremen, Suzanne Pfeffer, Gary Thomas and Ian Trowbridge. We greatly appreciate the assistance of Keith Mayo, Mike Webb and Eric Barklis in EM analysis. We also thank the Thomas lab and Stefan Lanker for providing reagents and helpful discussions throughout the course of this study; and Caroline Enns and Richard Maurer for critical analysis of the manuscript. This work was supported by a grant from the national institutes of health (GM 52458-05).


    REFERENCES
 Top
 SUMMARY
 INTRODUCTION
 MATERIALS AND METHODS
 RESULTS
 DISCUSSION
 REFERENCES
 

Amerik, Y. A., Nowak, J., Swaminathan, S. and Hochstrasser, M. (2000). The Doa4 deubiquitinating enzyme is functionally linked to the vacuolar protein-sorting and endocytic pathways. Mol. Biol. Cell 11, 3365-3380.[Abstract/Free Full Text]

Babst, M., Sato, T. K., Banta, L. M. and Emr, S. D. (1997). Endosomal transport function in yeast requires a novel AAA-type ATPase, Vps4p. EMBO J. 16, 1820-1831.[Medline]

Babst, M., Wendland, B., Estepa, E. J. and Emr, S. D. (1998). The Vps4p AAA ATPase regulates membrane association of a Vps protein complex required for normal endosome function. EMBO J. 17, 2982-2993.[Medline]

Babst, M., Odorizzi, G., Estepa, E. J. and Emr, S. D. (2000). Mammalian tumor susceptibility gene 101 (TSG101) and the Yeast Homologue, Vps23p, both function in late endosomal trafficking. Traffic 1, 248-258.[Medline]

Bankaitis, V. A., Johnson, L. M. and Emr, S. D. (1986). Isolation of yeast mutants defective in protein targeting to the vacuole. Proc. Natl. Acad. Sci. USA 83, 9075-9079.[Abstract/Free Full Text]

Banta, L. M., Robinson, J. S., Klionsky, D. J. and Emr, S. D. (1988). Organelle assembly in yeast: characterization of yeast mutants defective in vacuolar biogenesis and protein sorting. J. Cell Biol. 107, 1369-1383.[Abstract/Free Full Text]

Bishop, N. and Woodman, P. (2000). ATPase-defective mammalian VPS4 localizes to aberrant endosomes and impairs cholesterol trafficking. Mol. Biol. Cell 11, 227-239.[Abstract/Free Full Text]

Brachmann, C. B., Davies, A., Cost, G. J., Caputo, E., Li, J., Hieter, P. and Boeke, J. D. (1998). Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast 14, 115-132.[Medline]

Bright, N. A., Reaves, B. J., Mullock, B. M. and Luzio, J. P. (1997). Dense core lysosomes can fuse with late endosomes and are re-formed from the resultant hybrid organelles. J. Cell Sci. 110, 2027-2040.[Abstract]

Bryant, N. J. and Stevens, T. H. (1998). Vacuole biogenesis in Saccharomyces cerevisiae: protein transport pathways to the yeast vacuole. Microbiol. Mol. Biol. Rev. 62, 230-247.[Abstract/Free Full Text]

Chen, C. M., Kraut, N., Groudine, M. and Weintraub, H. (1996). I-mf, a novel myogenic repressor, interacts with members of the MyoD family. Cell 86, 731-741.[Medline]

Czekay, R. P., Orlando, R. A., Woodward, L., Lundstrom, M. and Farquhar, M. G. (1997). Endocytic trafficking of megalin/RAP complexes: dissociation of the complexes in late endosomes. Mol. Biol. Cell 8, 517-532.[Abstract]

Felder, S., Miller, K., Moehren, G., Ullrich, A., Schlessinger, J. and Hopkins, C. R. (1990). Kinase activity controls the sorting of the epidermal growth factor receptor within the multivesicular body. Cell 61, 623-634.[Medline]

Friend, D. S. (1969). Cytochemical staining of multivesicular body and golgi vesicles. J. Cell Biol. 41, 269-279.[Abstract/Free Full Text]

Futter, C. E., Pearse, A., Hewlett, L. J. and Hopkins, C. R. (1996). Multivesicular endosomes containing internalized EGF-EGF receptor complexes mature and then fuse directly with lysosomes. J. Cell Biol. 132, 1011-1023.[Abstract/Free Full Text]

Gaynor, E. C., te Heesen, S., Graham, T. R., Aebi, M. and Emr, S. D. (1994). Signal-mediated retrieval of a membrane protein from the Golgi to the ER in yeast. J. Cell Biol. 127, 653-665.[Abstract/Free Full Text]

Gruenberg, J. and Maxfield, F. R. (1995). Membrane transport in the endocytic pathway. Curr. Opin. Cell Biol. 7, 552-563.[Medline]

Guan, K. L. and Dixon, J. E. (1991). Eukaryotic proteins expressed in Escherichia coli: an improved thrombin cleavage and purification procedure of fusion proteins with glutathione S-transferase. Anal. Biochem. 192, 262-267.[Medline]

Hicke, L., Zanolari, B., Pypaert, M., Rohrer, J. and Riezman, H. (1997). Transport through the yeast endocytic pathway occurs through morphologically distinct compartments and requires an active secretory pathway and Sec18p/N-ethylmaleimide-sensitive fusion protein. Mol. Biol. Cell 8, 13-31.[Abstract]

Hollenberg, S. M., Sternglanz, R., Cheng, P. F. and Weintraub, H. (1995). Identification of a new family of tissue-specific basic helix-loop-helix proteins with a two-hybrid system. Mol. Cell. Biol. 15, 3813-3822.[Abstract]

Hopkins, C. R. and Trowbridge, I. S. (1983). Internalization and processing of transferrin and the transferrin receptor in human carcinoma A431 cells. J. Cell Biol. 97, 508-521.[Abstract/Free Full Text]

Keesee, S. K., Obar, R. and Wu, Y.-J. (1999). Materials and methods for detection of breast cancer. US Patent 5,914,238.

Klionsky, D. J., Banta, L. M. and Emr, S. D. (1988). Intracellular sorting and processing of a yeast vacuolar hydrolase: proteinase A propeptide contains vacuolar targeting information. Mol. Cell. Biol. 8, 2105-2116.[Abstract/Free Full Text]

Kobayashi, T., Stang, E., Fang, K. S., de Moerloose, P., Parton, R. G. and Gruenberg, J. (1998). A lipid associated with the antiphospholipid syndrome regulates endosome structure and function. Nature 392, 193-197.[Medline]

Komada, M. and Soriano, P. (1999). Hrs, a FYVE finger protein localized to early endosomes, is implicated in vesicular traffic and required for ventral folding morphogenesis. Genes Dev. 13, 1475-1485.[Abstract/Free Full Text]

Komada, M., Masaki, R., Yamamoto, A. and Kitamura, N. (1997). Hrs, a tyrosine kinase substrate with a conserved double zinc finger domain, is localized to the cytoplasmic surface of early endosomes. J. Biol. Chem. 272, 20538-20544.[Abstract/Free Full Text]

Li, Y., Kane, T., Tipper, C., Spatrick, P. and Jenness, D. D. (1999). Yeast mutants affecting possible quality control of plasma membrane proteins. Mol. Cell. Biol. 19, 3588-3599.[Abstract/Free Full Text]

Luzio, J. P., Rous, B. A., Bright, N. A., Pryor, P. R., Mullock, B. M. and Piper, R. C. (2000). Lysosome-endosome fusion and lysosome biogenesis. J. Cell Sci. 113, 1515-1524.[Abstract]

Mellman, I. (1996). Endocytosis and molecular sorting. Annu. Rev. Cell Dev. Biol. 12, 575-625.[Medline]

Mu, F. T., Callaghan, J. M., Steele-Mortimer, O., Stenmark, H., Parton, R. G., Campbell, P. L., McCluskey, J., Yeo, J. P., Tock, E. P. and Toh, B. H. (1995). EEA1, an early endosome-associated protein. EEA1 is a conserved alpha-helical peripheral membrane protein flanked by cysteine "fingers" and contains a calmodulin-binding IQ motif. J. Biol. Chem. 270, 13503-13511.[Abstract/Free Full Text]

Mullock, B. M., Bright, N. A.. Fearon, C. W., Gray, S. R. and Luzio, J. P. (1998). Fusion of lysosomes with late endosomes produces a hybrid organelle of intermediate density and is NSF dependent. J. Cell. Biol. 140, 591-601.[Abstract/Free Full Text]

Odorizzi, G., Babst, M. and Emr, S. D. 1998. Fab1p PtdIns(3)P 5-kinase function essential for protein sorting in the multivesicular body. Cell 95, 847-58.[Medline]

Odorizzi, G., Babst, M. and Emr, S. D. (2000). Phosphoinositide signaling and the regulation of membrane trafficking in yeast. Trends Biochem. Sci. 25, 229-235.[Medline]

Piper, R. C., Cooper, A. A., Yang, H. and Stevens, T. H. (1995). VPS27 controls vacuolar and endocytic traffic through a prevacuolar compartment in Saccharomyces cerevisiae. J. Cell Biol. 131, 603-617.[Abstract/Free Full Text]

Prescianotto-Baschong, C. and Riezman, H. (1998). Morphology of the yeast endocytic pathway. Mol. Biol. Cell 9, 173-189.[Abstract/Free Full Text]

Press, B., Feng, Y. Hoflack, B. and Wandinger-Ness, A. (1998). Mutant Rab7 causes the accumulation of cathepsin D and cation-independent mannose 6-phosphate receptor in an early endocytic compartment. J. Cell Biol. 140, 1075-1089.[Abstract/Free Full Text]

Raymond, C. K., Howald-Stevenson, I., Vater, C. A. and Stevens, T. H. (1992). Morphological classification of the yeast vacuolar protein sorting mutants: evidence for a prevacuolar compartment in class E vps mutants. Mol. Biol. Cell 3, 1389-1402.[Abstract]

Rieder, S. E., Banta, L. M., Kohrer, K., McCaffery, J. M. and Emr, S. D. (1996). Multilamellar endosome-like compartment accumulates in the yeast vps28 vacuolar protein sorting mutant. Mol. Biol. Cell 7, 985-999.[Abstract]

Robinson, J. S., Klionsky, D. J., Banta, L. M. and Emr, S. D. (1988). Protein sorting in Saccharomyces cerevisiae: isolation of mutants defective in the delivery and processing of multiple vacuolar hydrolases. Mol. Cell. Biol. 8, 4936-4948.[Abstract/Free Full Text]

Rothman, J. H. and Stevens, T. H. (1986). Protein sorting in yeast: mutants defective in vacuole biogenesis mislocalize vacuolar proteins into the late secretory pathway. Cell 47, 1041-1051.[Medline]

Rothman, J. H., Howald, I. and Stevens, T. H. (1989). Characterization of genes required for protein sorting and vacuolar function in the yeast Saccharomyces cerevisiae. EMBO J. 8, 2057-2065.[Medline]

Scheuring, S., Bodor, O., Rohricht, R. A., Muller, S., Beyer, A. and Kohrer, K. (1999). Cloning, characterisation, and functional expression of the Mus musculus SKD1 gene in yeast demonstrates that the mouse SKD1 and the yeast VPS4 genes are orthologues and involved in intracellular protein trafficking. Gene 234, 149-159.[Medline]

Sikorski, R. S. and Hieter, P. (1989). A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122, 19-27.[Abstract/Free Full Text]

Stauffer, D. R., Howard, T. L., Nyun, T. and Hollenberg, S. M. (2001). CHMP1 is a novel nuclear matrix protein affecting chromatin structure and cell-cycle progression. J. Cell Sci. 114, 2383-2393.[Abstract/Free Full Text]

Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. and Higgins, D. G. (1997). The CLUSTALX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25, 4876-4882.[Abstract/Free Full Text]

Trowbridge, I. S., Collawn, J. F. and Hopkins, C. R. (1993). Signal-dependent membrane protein trafficking in the endocytic pathway. Annu. Rev. Cell Biol. 9, 129-161.

van Deurs, B., Holm, P. K., Kayser, L. and Sandvig, K. (1995). Delivery to lysosomes in the human carcinoma cell line HEp-2 involves an actin filament-facilitated fusion between mature endosomes and preexisting lysosomes. Eur. J. Cell Biol. 66, 309-323.[Medline]

Vida, T. A. and Emr, S. D. (1995). A new vital stain for visualizing vacuolar membrane dynamics and endocytosis in yeast. J. Cell Biol. 128, 779-792.[Abstract/Free Full Text]

Vida, T. A., Graham, T. R. and Emr, S. D. (1990). In vitro reconstitution of intercompartmental protein transport to the yeast vacuole. J. Cell Biol. 111, 2871-2884.[Abstract/Free Full Text]

Wach, A. (1996). PCR-synthesis of marker cassettes with long flanking homology regions for gene disruptions in S. cerevisiae. Yeast 12, 259-265.[Medline]

Wan, L., Molloy, S. S., Thomas, L., Liu, G., Xiang, Y., Rybak, S. L. and Thomas, G. (1998). PACS-1 defines a novel gene family of cytosolic sorting proteins required for trans-Golgi network localization. Cell 94, 205-216.[Medline]

Wurmser, A. E., and S. D. Emr. 1998. Phosphoinositide signaling and turnover: PtdIns(3)P, a regulator of membrane traffic, is transported to the vacuole and degraded by a process that requires lumenal vacuolar hydrolase activities. EMBO J. 17, 4930-4942.[Medline]

Wurmser, A. E., Gary, J. D. and Emr, S. D. (1999). Phosphoinositide 3-kinases and their FYVE domain-containing effectors as regulators of vacuolar/lysosomal membrane trafficking pathways. J. Biol. Chem. 274, 9129-9132.[Free Full Text]

Yoshimori, T., Yamagata, F., Yamamoto, A., Mizushima, N., Kabeya, Y., Nara, A., Miwako, I., Ohashi, M., Ohsumi, M. and Ohsumi, Y. (2000). The mouse SKD1, a homologue of yeast Vps4p, is required for normal endosomal trafficking and morphology in mammalian cells. Mol. Biol. Cell 11, 747-763.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
J. Virol.Home page
T. Pawliczek and C. M. Crump
Herpes Simplex Virus Type 1 Production Requires a Functional ESCRT-III Complex but Is Independent of TSG101 and ALIX Expression
J. Virol., November 1, 2009; 83(21): 11254 - 11264.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
R. Tandon, D. P. AuCoin, and E. S. Mocarski
Human Cytomegalovirus Exploits ESCRT Machinery in the Process of Virion Maturation
J. Virol., October 15, 2009; 83(20): 10797 - 10807.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
B. McDonald and J. Martin-Serrano
No strings attached: the ESCRT machinery in viral budding and cytokinesis
J. Cell Sci., July 1, 2009; 122(13): 2167 - 2177.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
M. Bajorek, E. Morita, J. J. Skalicky, S. G. Morham, M. Babst, and W. I. Sundquist
Biochemical Analyses of Human IST1 and Its Function in Cytokinesis
Mol. Biol. Cell, March 1, 2009; 20(5): 1360 - 1373.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
O. Rodriguez-Galan, A. Galindo, A. Hervas-Aguilar, H. N. Arst Jr., and M. A. Penalva
Physiological Involvement in pH Signaling of Vps24-mediated Recruitment of Aspergillus PalB Cysteine Protease to ESCRT-III
J. Biol. Chem., February 13, 2009; 284(7): 4404 - 4412.
[Abstract] [Full Text] [PDF]


Home page
Eukaryot CellHome page
P. Weiss, S. Huppert, and R. Kolling
ESCRT-III Protein Snf7 Mediates High-Level Expression of the SUC2 Gene via the Rim101 Pathway
Eukaryot. Cell, November 1, 2008; 7(11): 1888 - 1894.
[Abstract] [Full Text] [PDF]


Home page
J. Med. Genet.Home page
R G E van Eijsden, L M T Eijssen, P J Lindsey, C M M van den Burg, L E A de Wit, M E Rubio-Gozalbo, C E M de Die, T Ayoubi, W Sluiter, I F M de Coo, et al.
Termination of damaged protein repair defines the occurrence of symptoms in carriers of the m.3243A>G tRNALeu mutation
J. Med. Genet., August 1, 2008; 45(8): 525 - 534.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
C. Yorikawa, E. Takaya, Y. Osako, R. Tanaka, Y. Terasawa, T. Hamakubo, Y. Mochizuki, H. Iwanari, T. Kodama, T. Maeda, et al.
Human Calpain 7/PalBH Associates with a Subset of ESCRT-III-related Proteins in its N-terminal Region and Partly Localizes to Endocytic Membrane Compartments
J. Biochem., June 1, 2008; 143(6): 731 - 745.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
S. Shim, S. A. Merrill, and P. I. Hanson
Novel Interactions of ESCRT-III with LIP5 and VPS4 and their Implications for ESCRT-III Disassembly
Mol. Biol. Cell, June 1, 2008; 19(6): 2661 - 2672.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
C. Dimaano, C. B. Jones, A. Hanono, M. Curtiss, and M. Babst
Ist1 Regulates Vps4 Localization and Assembly
Mol. Biol. Cell, February 1, 2008; 19(2): 465 - 474.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. E. Row, H. Liu, S. Hayes, R. Welchman, P. Charalabous, K. Hofmann, M. J. Clague, C. M. Sanderson, and S. Urbe
The MIT Domain of UBPY Constitutes a CHMP Binding and Endosomal Localization Signal Required for Efficient Epidermal Growth Factor Receptor Degradation
J. Biol. Chem., October 19, 2007; 282(42): 30929 - 30937.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
Q. Tian, L. Olsen, B. Sun, S. E. Lid, R. C. Brown, B. E. Lemmon, K. Fosnes, D. Gruis, H.-G. Opsahl-Sorteberg, M. S. Otegui, et al.
Subcellular Localization and Functional Domain Studies of DEFECTIVE KERNEL1 in Maize and Arabidopsis Suggest a Model for Aleurone Cell Fate Specification Involving CRINKLY4 and SUPERNUMERARY ALEURONE LAYER1
PLANT CELL, October 1, 2007; 19(10): 3127 - 3145.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
Y. Usami, S. Popov, and H. G. Gottlinger
Potent Rescue of Human Immunodeficiency Virus Type 1 Late Domain Mutants by ALIX/AIP1 Depends on Its CHMP4 Binding Site
J. Virol., June 15, 2007; 81(12): 6614 - 6622.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. Irie, Y. Shimazu, T. Yoshida, and T. Sakaguchi
The YLDL Sequence within Sendai Virus M Protein Is Critical for Budding of Virus-Like Particles and Interacts with Alix/AIP1 Independently of C Protein
J. Virol., March 1, 2007; 81(5): 2263 - 2273.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Zamborlini, Y. Usami, S. R. Radoshitzky, E. Popova, G. Palu, and H. Gottlinger
Release of autoinhibition converts ESCRT-III components into potent inhibitors of HIV-1 budding
PNAS, December 12, 2006; 103(50): 19140 - 19145.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
D. P. Nickerson, M. West, and G. Odorizzi
Did2 coordinates Vps4-mediated dissociation of ESCRT-III from endosomes
J. Cell Biol., November 27, 2006; (2006) jcb.200606113.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
A. Scott, J. Gaspar, M. D. Stuchell-Brereton, S. L. Alam, J. J. Skalicky, and W. I. Sundquist
Structure and ESCRT-III protein interactions of the MIT domain of human VPS4A
PNAS, September 27, 2005; 102(39): 13813 - 13818.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. L. Robinson and J. E. Dixon
The Phosphoinositide-3-phosphatase MTMR2 Associates with MTMR13, a Membrane-associated Pseudophosphatase Also Mutated in Type 4B Charcot-Marie-Tooth Disease
J. Biol. Chem., September 9, 2005; 280(36): 31699 - 31707.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Lin, L. A. Kimpler, T. V. Naismith, J. M. Lauer, and P. I. Hanson
Interaction of the Mammalian Endosomal Sorting Complex Required for Transport (ESCRT) III Protein hSnf7-1 with Itself, Membranes, and the AAA+ ATPase SKD1
J. Biol. Chem., April 1, 2005; 280(13): 12799 - 12809.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. M. Ward, M. B. Vaughn, S. L. Shiflett, P. L. White, A. L. Pollock, J. Hill, R. Schnegelberger, W. I. Sundquist, and J. Kaplan
The Role of LIP5 and CHMP5 in Multivesicular Body Formation and HIV-1 Budding in Mammalian Cells
J. Biol. Chem., March 18, 2005; 280(11): 10548 - 10555.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
E. Reid, J. Connell, T. L. Edwards, S. Duley, S. E. Brown, and C. M. Sanderson
The hereditary spastic paraplegia protein spastin interacts with the ESCRT-III complex-associated endosomal protein CHMP1B
Hum. Mol. Genet., January 1, 2005; 14(1): 19 - 38.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
T. Pisitkun, R.-F. Shen, and M. A. Knepper
Identification and proteomic profiling of exosomes in human urine
PNAS, September 7, 2004; 101(36): 13368 - 13373.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
H. Fujita, Y. Umezuki, K. Imamura, D. Ishikawa, S. Uchimura, A. Nara, T. Yoshimori, Y. Hayashizaki, J. Kawai, K. Ishidoh, et al.
Mammalian class E Vps proteins, SBP1 and mVps2/CHMP2A, interact with and regulate the function of an AAA-ATPase SKD1/Vps4B
J. Cell Sci., June 15, 2004; 117(14): 2997 - 3009.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
J. Martin-Serrano, A. Yarovoy, D. Perez-Caballero, and P. D. Bieniasz
Divergent retroviral late-budding domains recruit vacuolar protein sorting factors by using alternative adaptor proteins
PNAS, October 14, 2003; 100(21): 12414 - 12419.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Whitley, B. J. Reaves, M. Hashimoto, A. M. Riley, B. V. L. Potter, and G. D. Holman
Identification of Mammalian Vps24p as an Effector of Phosphatidylinositol 3,5-Bisphosphate-dependent Endosome Compartmentalization
J. Biol. Chem., October 3, 2003; 278(40): 38786 - 38795.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Katoh, H. Shibata, H. Suzuki, A. Nara, K. Ishidoh, E. Kominami, T. Yoshimori, and M. Maki
The ALG-2-interacting Protein Alix Associates with CHMP4b, a Human Homologue of Yeast Snf7 That Is Involved in Multivesicular Body Sorting
J. Biol. Chem., October 3, 2003; 278(40): 39104 - 39113.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
S. C. L. Yeo, L. Xu, J. Ren, V. J. Boulton, M. D. Wagle, C. Liu, G. Ren, P. Wong, R. Zahn, P. Sasajala, et al.
Vps20p and Vta1p interact with Vps4p and function in multivesicular body sorting and endosomal transport in Saccharomyces cerevisiae
J. Cell Sci., October 1, 2003; 116(19): 3957 - 3970.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. Shen, C. Li, Z. Min, R. B. Meeley, M. C. Tarczynski, and O.-A. Olsen
sal1 determines the number of aleurone cell layers in maize endosperm and encodes a class E vacuolar sorting protein
PNAS, May 27, 2003; 100(11): 6552 - 6557.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
H. Fujita, M. Yamanaka, K. Imamura, Y. Tanaka, A. Nara, T. Yoshimori, S. Yokota, and M. Himeno
A dominant negative form of the AAA ATPase SKD1/VPS4 impairs membrane trafficking out of endosomal/lysosomal compartments: class E vps phenotype in mammalian cells
J. Cell Sci., January 15, 2003; 116(2): 401 - 414.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
D. R. Stauffer, T. L. Howard, T. Nyun, and S. M. Hollenberg
CHMP1 is a novel nuclear matrix protein affecting chromatin structure and cell-cycle progression
J. Cell Sci., January 7, 2001; 114(13): 2383 - 2393.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Howard, T. L.
Right arrow Articles by Hollenberg, S. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Howard, T. L.
Right arrow Articles by Hollenberg, S. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?