|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
RESEARCH ARTICLE |
Vollum Institute, L474, Oregon Health Sciences University, 3181 S.W. Sam Jackson Park Rd, Portland, OR 97201-3098, USA
*Author for correspondence (e-mail: stauffer{at}ohsu.edu)
Accepted January 18, 2001
| SUMMARY |
|---|
|
|
|---|
Key words: Biological transport, Endosomes, Vacuoles, Carboxypeptidases, Nuclear matrix, Gene silencing
| INTRODUCTION |
|---|
|
|
|---|
Since MVB formation occurs in simple eukaryotes (Hicke et al., 1997; Li et al., 1999; Prescianotto-Baschong and Riezman, 1998; Wurmser and Emr, 1998), budding yeast is a useful model system for delineating this process. Genetic screens in Saccharomyces cerevisiae have identified a set of genes, the class E VPS, required for MVB sorting (Odorizzi et al., 1998; Odorizzi et al., 2000). These genes belong to a much larger group whose mutation results in defective vacuolar protein sorting (vps) (Bankaitis et al., 1986; Robinson et al., 1988; Rothman et al., 1989; Rothman and Stevens, 1986). vps mutants aberrantly secrete a soluble vacuolar hydrolase, carboxypeptidase Y (CPY), to the extracellular space (Bryant and Stevens, 1998; Raymond et al., 1992; Robinson et al., 1988; Rothman and Stevens, 1986). Class E vps mutants exhibit an additional, distinctive defect in protein sorting: an integral-membrane hydrolase, carboxypeptidase S (CPS), cannot be targeted to the vacuole lumen, its normal site of action. Instead, CPS remains on the vacuole membrane, a fate shared with endocytosed alpha-factor receptor in class E vps mutants (Li et al., 1999; Odorizzi et al., 1998). Ultrastructural analysis of class E vps mutants by electron microscopy reveals an enlarged, aberrant endosomal structure comprising stacked membranes, the class E compartment (Raymond et al., 1992; Rieder et al., 1996). In combination, these observations strongly suggest that the primary defect in class E vps mutants is the inability to properly invaginate endosomal membrane to form an MVB (Odorizzi et al., 1998).
CPY missorting screens in budding yeast have identified 13 class E VPS genes (Raymond et al., 1992). Six of these genes have been analyzed molecularly: VPS4, VPS23, VPS24, VPS27, VPS28 and SNF7/VPS32 (Babst et al., 2000; Babst et al., 1997; Babst et al., 1998; Li et al., 1999; Piper et al., 1995; Rieder et al., 1996). The encoded proteins have no reported structural similarity, and only a pair of functional inter-relationships has been described: the ATPase Vps4p couples ATP hydrolysis with membrane release of Vps24p and Snf7p/Vps32p (Babst et al., 1998). The membrane association of these and other class E Vps proteins is thought to be linked to the presence of a specific bis-phosphorylated phosphatidylinositol on the endosomal membrane (Odorizzi et al., 1998; Odorizzi et al., 2000). This novel phosphoinositide is hypothesized to play a pivotal role in initiating or regulating MVB formation but, to date, no class E Vps protein has been demonstrated to bind it directly. In addition, the relationship between the identified class E Vps proteins and a postulated coat complex has not been elucidated (Wurmser et al., 1999).
Mammals have structural relatives of many or all identified yeast class E Vps proteins (Odorizzi et al., 1998), and functional conservation of two members has been demonstrated. Overexpression of an ATPase-defective human SKD1/VPS4 in mammalian cells results in altered protein sorting and dilated endosomal compartments, structures potentially analogous to the class E compartment observed in vps4 mutant yeast (Bishop and Woodman, 2000; Yoshimori et al., 2000). Similarly, deletion of mouse HRS, which encodes a mammalian structural counterpart to yeast Vps27p (Komada et al., 1997), produces enlarged, transferrin receptor-positive endosomal structures (Komada and Soriano, 1999).
We have identified a mammalian protein, CHMP1, which physically interacts with human SKD1, localizes to early endosomes and can disrupt membrane trafficking when overexpressed in mutant form. CHMP1 is structurally conserved in simple and complex eukaryotes and has led to the identification of a family of proteins (Chmps) required for yeast MVB sorting. Structural similarities within the CHMP/Chmp family suggest cooperative or sequential action of these proteins in a related aspect of MVB formation.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Two hybrid bait plasmid pLex-CHMP1 was constructed by introducing the full-length human CHMP1 coding sequence (GenBank AF281063) into the unique BamHI site of pLex-A. The full-length human SKD1 coding sequence (GenBank AF159063), obtained from two-hybrid screening with CHMP1, was mutagenized with sense and antisense 5' CATCATCTTCATCGACCAGGTCGATTCCCTCTGCGGG 3' primers using the QuikChange Site-Directed Mutagenesis kit (Stratagene) to produce SKD1(E228Q). The entire open reading frames of SKD1 and SKD1(EQ) were transferred to pmal-c2 (New England Biolabs) to generate pMBP-SKD1 and pMBP-SKD1(EQ). In addition, the SKD1(EQ) coding sequence was introduced into p2FLAG to generate p2FLAG-SKD1(EQ).
Plasmid expression vectors for Escherichia coli expression of CHMP1 fusion proteins were constructed using the EcoRI/BamHI fragment of CHMP1. This fragment was end-filled and introduced into pmal-c2 (New England Biolabs) or pGEX-kT (Guan and Dixon, 1991) to produce MBP-CHMP1 or GST-CHMP1, respectively.
GFP fusion expression vectors were constructed as follows. The CHMP1 termination codon was removed by amplification with a sense primer and antisense primer 5' GGCAATCGATAGTTCCTCAAGGCGGCCAACCT 3'. The product was fused to GFP coding sequences at its C-terminus in the vector CS2+ to create CS-CHMP1-GFP. The coding sequence of SKD1(EQ) was fused at its N-terminus to GFP sequences and introduced into ßAct (see above) to create ßAct-GFP-SKD1(EQ). The plasmid encoding a GFP-CPS fusion was constructed based on the strategy described previously (Odorizzi et al., 1998). Briefly, an expression cassette was constructed that contained the following elements: the ADH promoter from pBTM116 controlling a GFP-CPS fusion, with GFP fused at its C-terminus to full-length CPS coding sequences. This expression cassette was introduced in pRS421, a 2 µm MET15 plasmid (Brachmann et al., 1998) to generate 421-GFP-CPS. 316-ADH-CHM1 was constructed from 316-ADH (see above) by introducing the S. cerevisiae CHM1 open reading frame generated by amplification with 5' GCAAGGATCCACCATGTCACGTAATTCTGCAGCAGGTTTG 3' and 5' GGCACTCGAGTGAACTAAAAATGCATGACCTGTTAGCATG 3'.
Two-hybrid screen
Yeast strain L40 containing pLex-CHMP1 was used to screen human brain and leukocyte libraries in pAct2 (Clontech). Transformants were plated onto CSM(-His, -Trp, -Leu) (Bio101) containing 1 mM 3-aminotriazole.
Cell culture, immunocytochemistry and antibodies
HEK-293 (human embryonic kidney) or COS7 (African green monkey kidney) cells were cultured on eight-well Nunc SuperCell culture slides (Intermountain Scientific) in Dulbeccos modified eagle medium with 10% fetal calf serum, 100 units/ml penicillin G, and 100µg/ml streptomycin (Gibco BRL). Twenty-four hours after plating, cells were directly fixed (see below) or transfected using LipofectAMINE in the presence of Opti-MEM1 (Gibco BRL). Five hours post-transfection, cells were washed, fed using DMEM with serum, and incubated for another 24 hours. Cells were fixed with 4% paraformaldehyde, washed, blocked, permeabilized and exposed to primary and secondary antibodies. Rabbit polyclonal anti-CHMP1 (1:300) was made by injection of GST-CHMP1 fusion protein mixed with Freunds incomplete adjuvant into rabbits by Pocono Rabbit Farm & Laboratory Inc. The antibody was subsequently purified over a MBP-CHMP1 Affigel (Bio-Rad) column and eluted with low pH. The CHMP1 antibody does not crossreact with any of the other CHMP proteins we have identified, including closely related CHMP2. Mouse monoclonal antibodies used were specific for transferrin receptor (B3/25.4, 1:100; a gift of Ian Trowbridge, The Salk Institute), lysobisphosphatidic acid (6C4, 1:10; a gift of Jean Gruenberg, University of Geneva), Rab7 (1:300; a gift of Suzanne Pfeffer, Stanford), early endosomal antigen-1 (EEA1; Transduction Laboratories; 1:200), cation-independent mannose-6 phosphate receptor (M6PR, 1:300; a gift of William Brown, Cornell University), LAMP-1 (PharMingen; 1:100), mannosidase II (1:20; a gift of Kelly Moremen, University of Georgia), and
-adaptin (H4A3; Sigma; 1:50). Secondary antibodies used were anti-rabbit Alexa 488 (Molecular probes; 1:300) and anti-mouse Cy3 (Jackson ImmunoResearch Laboratories Inc; 1:300), and included Hoechst 33258 (Molecular Probes) at 1.0 µg/ml. Samples were visualized with a Zeiss Axioplan microscope or by laser scanning confocal microscopy on a BioRad MRC 1000.
Percoll gradient and membrane fractionation
The Percoll gradient analysis was performed with HEK293 cells, as described previously (Czekay et al., 1997) with some modifications (Press et al., 1998). Membrane fractionation analysis was carried out based on a published method (Wan et al., 1998). HEK293 cells were harvested and washed in PBS. Cells were resuspended in 1.5 ml of lysis buffer (10 mM Tris-HCl pH 7.4, 2.5 mM MgCl2, protease inhibitors) and transferred to ice for 15 minutes. Cells were lysed with 25-60 strokes of a dounce homogenizer and the lysate was gently layered over a sucrose cushion (0.5 M sucrose, 10 mM Tris-HCl pH 7.4, 2.5 mM MgCl2). Nuclei were pelleted by centrifugation at 5000 g for 10 minutes at 4°C in a Sorvall HB4 rotor. The upper layer consisting of cytoplasmic extract was collected and concentrated to 100 µl in a Centricon 10 column. This fraction was centrifuged at 100,000 g for 1 hour at 4°C in a TLA 45 rotor (Beckman), resulting in a soluble supernatant and membrane-associated pellet. The pellet was either resuspended in 100 µl of RIPA buffer (50 mM Tris-HCl pH 7.4, 5 mM DTT, 150 mM NaCl, 1% NP-40, 0.5% deoxycholate, 0.1% SDS, protease inhibitors) for gel analysis or resuspended in 100 µl of high salt buffer (10 mM Tris-HCl pH 7.4, 750 mM NaCl, with protease inhibitors) and centrifuged for 1 hour at 100,000 g yielding a high salt supernatant and pellet. This pellet was then resuspended in 100 µl of high pH buffer (10 mM Tris-HCl pH 11.0, 100 mM Na2CO3, protease inhibitors) and centrifuged for 1 hour at 100,000 g yielding a high pH supernatant and final pellet. The final pellet was resuspended in 100 µl of RIPA buffer. Equal cell equivalents were resolved by SDS-PAGE and CHMP1 was visualized by western blot analysis.
Co-immunoprecipitation and pulldown assays
For co-immunoprecipitations, 293 cells were transfected with LipofectAMINE (Gibco-BRL). Forty-eight hours after transfection the cells were washed twice in ice cold PBS, scraped in PBS, pelleted, resuspended in 0.1 M sodium phosphate, pH 7.8, containing 0.1% NP-40, and lysed by repeated freeze-thaw cycles. Co-immunoprecipitation reactions contained 20 µl anti-FLAG M2 affinity gel (Sigma) and 200 µg cell lysate, and were incubated for 2 hours at 4°C. Following several washes in TENN (20 mM Tris-Cl, 5 mM EDTA, 150 mM NaCl, 0.5% NP-40), proteins bound to the resin were resolved by SDS-PAGE and analyzed by western analysis with anti-CHMP1 antibody.
MBP-fusions for in vitro binding assays were purified over amylose resin according to the manufacturers instructions (New England Biolabs). The yield and purity of each fusion protein was determined by SDS-PAGE. Based on this analysis, equal amounts of fusion protein and resin were added to an equal volume of binding buffer. CHMP1 and GFP were synthesized using the TNT SP6 coupled reticulocyte lysate system (Promega) in the presence of [35S]methionine. An aliquot of in vitro translated protein was incubated with amylose resin-bound protein (MBP, MBP-SKD1, or MBP-SKD1(EQ)) in 25 µl NETT (20 mM Tris, pH 8.0, 100 mM NaCl, 1 mM EDTA, 0.2% Triton X-100) for 2 hours at 4°C. Binding reactions were subsequently washed in NETT, and analyzed by SDS-PAGE and autoradiography.
Yeast strains
BY4741 and isogenic deletions of chm2, vps24, snf7, chm6 and vps4 were obtained from the Saccharomyces Deletion Project through Research Genetics. CHM1 and CHM5 were replaced by LEU2 in either BY4741 or the snf7 deletion strain using PCR-mediated gene disruption (Wach, 1996). Homologous recombination was confirmed by 5' and 3' PCR amplification.
Carboxypeptidase S sorting assay
Yeast cultures expressing GFP-CPS were cultured in CSM(-Met) (Bio101), harvested at mid-log phase, and pulse-labeled with 20 mM FM4-64 (Molecular Probes) at 30°C (Vida and Emr, 1995). Samples were visualized by laser scanning confocal microscopy on a BioRad MRC 1000.
CPY sorting assay
CPY sorting was measured based on several previously described methods (Gaynor et al., 1994; Klionsky et al., 1988; Vida et al., 1990). Yeast was grown in CSM (-Met) to mid-log phase. Cells were spheroplasted for 30 minutes in 0.5 ml CSM containing 1 M sorbitol and 2 µl zymolyase 100T, washed in 1.2 M sorbitol, and resuspended to 10 OD600/ml with 135 µl CSM (-Met) containing 1 M sorbitol, 1 mg/ml BSA, and 0.2 U
2-macroglobulin. Cells were pulse-labeled for 10 minutes with 100 µCi [35S]methionine at 30°C. Chase was initiated with the addition of chase solution (to a final concentration of 0.2% yeast extract, 5 mM methionine, 1 mM cysteine). After a 40 minute incubation, cultures were spun at 13,000 g to produce supernatant (extracellular; EC) and pellet (intracellular; IC) fractions. EC was adjusted to 1% SDS, IC was resuspended in 150 µl resuspension buffer (50 mM Tris, pH 7.5, 1 mM EDTA, 1% SDS) and samples were boiled for 4 minutes. After brief pelleting, supernatants were transferred to fresh tubes containing 1 ml IP buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 0.1 mM EDTA, 0.5% Tween-20) and immunoprecipitated with 1.75 µg CPY antibody (Molecular Probes, mouse monoclonal 10A5-B5). Antibody was bound with 20 µl 50% Protein A/G beads (Santa Cruz). Complexes were washed with NETT and RIPA (50 mM Tris-Cl, pH 7.4, 150 mM NaCl, 1% Triton X-100, 0.1% SDS, 1% sodium deoxycholate) and resolved by SDS-PAGE.
Electron microscopy
Cells were fixed and stained as described previously (Banta et al., 1988) with the following modifications. Cells were fixed overnight at 4°C in 3% glutaraldehyde. Spheroplasts were produced with 70 units/ml ß-glucuronidase type HP-2S (Sigma) and 2.5 mg/ml Zymolase 20T (Seikagaku Corporation) for 20 minutes at 30°C in 1.2 M sorbitol in 0.1 M KPO4, pH 4.0. Subsequent to staining, samples were dehydrated and embedded in Epon 812 resin. Sections were analyzed on a transmission electron microscope (Phillips CMJ120). Cell counts resulted from inspecting the cytoplasm of cells that were stained sufficiently to visualize the plasma and nuclear membrane. Cells with multi-lamellar cytoplasmic membrane structures were scored as positive.
| RESULTS |
|---|
|
|
|---|
-adaptin). As shown in Fig. 1, although there is considerable overlap between compartments, the CHMP1 pattern is most highly coincident with the early endosomes defined by the transferrin receptor (Trowbridge et al., 1993).
|
|
Human CHMP1 interacts with trafficking protein SKD1
To gain insight into the function of CHMP1, it was fused to LexA and used as bait in a yeast two-hybrid screen (Hollenberg et al., 1995) of human brain and leukocyte cDNA fusion libraries. Remarkably, 80% of the positives corresponded to full-length human VPS4/SKD1 (Bishop and Woodman, 2000; Scheuring et al., 1999; Yoshimori et al., 2000). Mammalian SKD1 is a close structural relative of an ATPase in yeast, Vps4p, which is required for correct vacuolar protein sorting and belongs to the class E VPS group (see Introduction) (Banta et al., 1988; Raymond et al., 1992; Robinson et al., 1988). Babst and co-workers have demonstrated that Vps4p regulates the membrane association of two other class E VPS gene products, Vps24p and SNF7p/Vps32p, through ATP hydrolysis (Babst et al., 1998).
The interaction between CHMP1 and SKD1 has been confirmed using an in vitro binding assay. For this analysis, binding to wild-type SKD1 and an ATPase-defective mutant derivative SKD1(EQ) (Bishop and Woodman, 2000) was compared. Each was expressed in E. coli as a fusion with maltose-binding protein (MBP) and affinity purified. As shown in Fig. 3A, in vitro translated CHMP1 shows significant binding to MBP-SKD1 above MBP alone (compare lanes 6,7). Furthermore, introduction of the inactivating E to Q mutation in SKD1 appears to increase CHMP1 binding (Fig. 3A, compare lanes 7,8). Although the increase is small, it is reproducible within each experiment.
|
Mutant CHMP1 and SKD1 produce similar effects on endosomal trafficking
To further define the properties of CHMP1, its C-terminus was fused to GFP and the subcellular pattern analyzed after transient transfection. CHMP1-GFP localizes to structures in the cytoplasm that are visible by phase-contrast microscopy (Fig. 4A, arrowhead). Similar structures are produced by expression of GFP-SKD1(EQ) (Bishop and Woodman, 2000; Yoshimori et al., 2000), but not by unfused GFP (Fig. 4A). The physical interaction between CHMP1 and SKD1, and the similar appearance of the corresponding, overexpressed GFP-fusions, suggest that each GFP-fusion is altering common aspects of endosomal trafficking, and that the fusion of GFP to CHMP1 changes the properties of the protein. We therefore consider GFP-CHMP1 to be a functionally mutant protein. We have tested this idea by comparing the effects of each fusion protein on the morphology of endosomal structures. As shown in Fig. 4B, comparison of untransfected (arrows) with transfected cells (arrowheads) shows that each of these GFP-fusion proteins strongly affects the distribution of both early (EEA1) and late (LBPA/M6PR) endosomal markers. In general, the fine punctate distribution produced with each marker is converted to larger diameter structures, indicating dilation and fusion of trafficking compartments. The GFP-signal from these fusion proteins only partially colocalizes with the endosomal patterns, suggesting both direct and indirect effects on membrane flow within several trafficking pathways. This analysis provides further support for functional similarity between CHMP1 and SKD1 and for a CHMP1 role in vesicle trafficking.
|
|
The entire yeast CHM family is required for high fidelity carboxypeptidase Y sorting
Several observations suggest that the yeast CHM family might function in a specific aspect of vacuolar protein sorting. Studies outlined above demonstrate that mammalian CHMP1 localizes to endosomes, physically interacts with SKD1, and can disrupt trafficking in a manner similar to SKD1. In addition, CHMP1 shows structural similarity to Vps24p and Snf7p/Vps32p (Fig. 5A), class E Vps proteins that function with the budding yeast counterpart of SKD1. Therefore, we have used a genetic strategy to test the role in vacuolar protein sorting of CHM1 and three other previously uncharacterized CHM family members, CHM2, CHM5 and CHM6.
The standard assay which identifies vps mutants measures maturation and targeting of a soluble hydrolase, CPY, to the vacuole lumen (Bankaitis et al., 1986; Robinson et al., 1988; Rothman et al., 1989; Rothman and Stevens, 1986). We have constructed or obtained deletions of each member of the S. cerevisiae CHM family, including previously characterized VPS24 and SNF7/VPS32 (Babst et al., 1998), and analyzed their ability to sort and process CPY. Cells were collected at mid-log phase, converted to spheroplasts, pulse-chase labeled with [35S]methionine, separated into secreted and spheroplast fractions, and then analyzed for the presence of CPY by immunoprecipitation. As shown in Fig. 6A, each chm deletion strain (and vps4) correctly processes over half of its CPY to an intracellular (I) form of 61 kDa (Fig. 6A). The remaining CPY migrates as an immature, unprocessed form of 69 kDa in both the intracellular (I) and extracellular (E) fractions. By contrast, the parental strain (+) quantitatively processes and targets all CPY. All chm single mutants show a comparable defect in CPY sorting, which is not increased in chm double mutants (Fig. 6A; chm1 snf7; and data not shown). The inability of double mutants to increase the phenotypic severity suggests that CHM gene products function in a common pathway required for high fidelity CPY sorting.
|
Each yeast CHM gene is required for sorting to the multivesicular body
Odorizzi and coworkers have demonstrated that missorting of CPS is a hallmark of class E vps mutants (Odorizzi et al., 1998). In their analysis, all known class E vps mutations were unable to sort a GFP-CPS fusion protein to the vacuole lumen. Instead, the GFP signal accumulated on the vacuolar membrane. These studies suggested that class E VPS genes function in sorting proteins (and lipid) to the multivesicular body (see Introduction). To confirm the EM assignment of the CHM family as class E VPS, we tested each chm deletion mutant in this CPS sorting assay. The parental strain (+) shows a GFP-CPS fluorescence that is internal to the vacuolar membranes identified with the vital membrane dye FM4-64 (Fig. 7). By contrast, deletion of each chm gene dramatically changes the GFP pattern. These mutants show a GFP signal that is largely excluded from the vacuole interior, but colocalizes with the FM4-64 membrane signal instead. In addition, intense GFP signals are visible in a perivacuolar location, which presumably corresponds to the class E vps compartment (Fig. 6B-D). The sorting defect observed with GFP-CPS for the chm1 mutant can be efficiently rescued by expression of CHM1 from a CEN plasmid under control of the ADH promoter. CHM2, CHM5 and CHM6 genes at single copy and expressed from their own promoters also rescue their corresponding mutations (T.L.H. and S.M.H., unpublished).
|
| DISCUSSION |
|---|
|
|
|---|
Identification of four new yeast class E vps mutants
The phenotypic consequences of CHM1, -2, -5 and -6 deletion categorizes them as class E VPS genes. For example, these new deletion mutants show aberrant secretion of unprocessed CPY into the extracellular space, a phenotype common to all vps mutants, but most similar to other class E vps mutations in correctly targeting the majority of CPY (Raymond et al., 1992). It will be important to determine whether these four CHM genes are allelic to previously identified class E vps mutations, which have not been characterized at the molecular level, or are novel class E VPS genes. The identification of new, non-allelic class E vps mutations would not be completely unexpected. The weak CPY missorting phenotype exhibited by class E vps mutants probably reduced the efficiency with which some were isolated during the initial vps mutant screens (Bankaitis et al., 1986; Robinson et al., 1988; Rothman et al., 1989; Rothman and Stevens, 1986).
Structural conservation in MVB formation
With the addition of Chm1p, Chm2p, Chm5p and Chm6p, the yeast Chmp family now totals six structurally related proteins. Since each protein is required for CPS internalization in yeast, each Chmp must play a distinct, non-redundant role in the process. Nevertheless, these proteins show a similar, well-conserved size and charge distribution in the absence of strong primary sequence conservation. How might these proteins function in MVB sorting? One explanation for these conserved features envisions a structural role for Chm proteins on the endosome membrane, where Chm proteins might participate in formation of a membrane coat. Consistent with this hypothesis, CHMP1, Vps24p and Snf7p/Vps32p all show partial membrane association (this study and Babst et al., 1998). This proposed coat would be created by Chm proteins as a membrane-associated lattice (Babst et al., 1998). Within this lattice, the common structural features shared by Chm proteins might allow these proteins to be interchangeable to some extent, which could alter the curvature and/or membrane attachment properties of the lattice. Additional studies directed toward testing this model will determine whether CHMP proteins physically interact within one complex, interact in distinct complexes, or act in a sequential fashion on the endosome membrane.
CHMP1-SKD1/VPS4 interaction
The model proposed above for Chmp action in MVB formation would require restructuring of a membrane lattice to create concave curvature to effect invagination. This restructuring might require changes in protein conformation or protein-protein interaction. The protein previously suggested to carry out this function is yeast Vps4p, a class E Vps protein structurally unrelated to the Chmp family (Babst et al., 1997; Babst et al., 1998). Interestingly, we have demonstrated that mammalian CHMP1 is a physical partner of human SKD1 as measured by two-hybrid, co-immunoprecipitation and in vitro binding studies. This is likely to be a fundamental, conserved functional interaction, since yeast Chm1p shows an equally strong two-hybrid signal with human SKD1 (T.L.H. and S.M.H., unpublished). Two hybrid analysis of interactions between SKD1 and the several other members of the mammalian CHMP family identifies a strong interaction with CHMP2, also known as BC-2 (Keesee et al., 1999), but no signal above background with CHMP3, CHMP4 or CHMP5 (T.L.H. and S.M.H., unpublished). Analysis of yeast CHM mutants supports this specificity of SKD1 interaction: deletion of yeast CHM1 or CHM2, but not CHM5 or CHM6, results in predominant membrane association of Snf7p (C.R.D. and S.M.H., unpublished). The extent of membrane binding is equivalent to that observed in a vps4 background (Babst et al., 1998). Based on these observations, it is likely that SKD1/Vps4p is acting directly on CHMP1/Chm1p and CHMP2/Chm2p, but indirectly on other CHMP/Chm proteins to mediate restructuring and/or membrane dissociation. In conclusion, by identifying a family of divergent but functionally related proteins responsible for MVB formation, this study provides compelling groundwork for the analysis of the role of the CHMP proteins in cellular trafficking.
Note added in proof
While our manuscript was in review, CHM1 (DID2) and CHM2 (DID4) were identified in a screen for suppressors of the doa-1 (deubiquitinating enzyme) mutation. This publication verifies our observation that these proteins are class E Vps factors (Amerik et al., 2000).
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Amerik, Y. A., Nowak, J., Swaminathan, S. and Hochstrasser, M. (2000). The Doa4 deubiquitinating enzyme is functionally linked to the vacuolar protein-sorting and endocytic pathways. Mol. Biol. Cell 11, 3365-3380.
Babst, M., Sato, T. K., Banta, L. M. and Emr, S. D. (1997). Endosomal transport function in yeast requires a novel AAA-type ATPase, Vps4p. EMBO J. 16, 1820-1831.[Medline]
Babst, M., Wendland, B., Estepa, E. J. and Emr, S. D. (1998). The Vps4p AAA ATPase regulates membrane association of a Vps protein complex required for normal endosome function. EMBO J. 17, 2982-2993.[Medline]
Babst, M., Odorizzi, G., Estepa, E. J. and Emr, S. D. (2000). Mammalian tumor susceptibility gene 101 (TSG101) and the Yeast Homologue, Vps23p, both function in late endosomal trafficking. Traffic 1, 248-258.[Medline]
Bankaitis, V. A., Johnson, L. M. and Emr, S. D. (1986). Isolation of yeast mutants defective in protein targeting to the vacuole. Proc. Natl. Acad. Sci. USA 83, 9075-9079.
Banta, L. M., Robinson, J. S., Klionsky, D. J. and Emr, S. D. (1988). Organelle assembly in yeast: characterization of yeast mutants defective in vacuolar biogenesis and protein sorting. J. Cell Biol. 107, 1369-1383.
Bishop, N. and Woodman, P. (2000). ATPase-defective mammalian VPS4 localizes to aberrant endosomes and impairs cholesterol trafficking. Mol. Biol. Cell 11, 227-239.
Brachmann, C. B., Davies, A., Cost, G. J., Caputo, E., Li, J., Hieter, P. and Boeke, J. D. (1998). Designer deletion strains derived from Saccharomyces cerevisiae S288C: a useful set of strains and plasmids for PCR-mediated gene disruption and other applications. Yeast 14, 115-132.[Medline]
Bright, N. A., Reaves, B. J., Mullock, B. M. and Luzio, J. P. (1997). Dense core lysosomes can fuse with late endosomes and are re-formed from the resultant hybrid organelles. J. Cell Sci. 110, 2027-2040.[Abstract]
Bryant, N. J. and Stevens, T. H. (1998). Vacuole biogenesis in Saccharomyces cerevisiae: protein transport pathways to the yeast vacuole. Microbiol. Mol. Biol. Rev. 62, 230-247.
Chen, C. M., Kraut, N., Groudine, M. and Weintraub, H. (1996). I-mf, a novel myogenic repressor, interacts with members of the MyoD family. Cell 86, 731-741.[Medline]
Czekay, R. P., Orlando, R. A., Woodward, L., Lundstrom, M. and Farquhar, M. G. (1997). Endocytic trafficking of megalin/RAP complexes: dissociation of the complexes in late endosomes. Mol. Biol. Cell 8, 517-532.[Abstract]
Felder, S., Miller, K., Moehren, G., Ullrich, A., Schlessinger, J. and Hopkins, C. R. (1990). Kinase activity controls the sorting of the epidermal growth factor receptor within the multivesicular body. Cell 61, 623-634.[Medline]
Friend, D. S. (1969). Cytochemical staining of multivesicular body and golgi vesicles. J. Cell Biol. 41, 269-279.
Futter, C. E., Pearse, A., Hewlett, L. J. and Hopkins, C. R. (1996). Multivesicular endosomes containing internalized EGF-EGF receptor complexes mature and then fuse directly with lysosomes. J. Cell Biol. 132, 1011-1023.
Gaynor, E. C., te Heesen, S., Graham, T. R., Aebi, M. and Emr, S. D. (1994). Signal-mediated retrieval of a membrane protein from the Golgi to the ER in yeast. J. Cell Biol. 127, 653-665.
Gruenberg, J. and Maxfield, F. R. (1995). Membrane transport in the endocytic pathway. Curr. Opin. Cell Biol. 7, 552-563.[Medline]
Guan, K. L. and Dixon, J. E. (1991). Eukaryotic proteins expressed in Escherichia coli: an improved thrombin cleavage and purification procedure of fusion proteins with glutathione S-transferase. Anal. Biochem. 192, 262-267.[Medline]
Hicke, L., Zanolari, B., Pypaert, M., Rohrer, J. and Riezman, H. (1997). Transport through the yeast endocytic pathway occurs through morphologically distinct compartments and requires an active secretory pathway and Sec18p/N-ethylmaleimide-sensitive fusion protein. Mol. Biol. Cell 8, 13-31.[Abstract]
Hollenberg, S. M., Sternglanz, R., Cheng, P. F. and Weintraub, H. (1995). Identification of a new family of tissue-specific basic helix-loop-helix proteins with a two-hybrid system. Mol. Cell. Biol. 15, 3813-3822.[Abstract]
Hopkins, C. R. and Trowbridge, I. S. (1983). Internalization and processing of transferrin and the transferrin receptor in human carcinoma A431 cells. J. Cell Biol. 97, 508-521.
Keesee, S. K., Obar, R. and Wu, Y.-J. (1999). Materials and methods for detection of breast cancer. US Patent 5,914,238.
Klionsky, D. J., Banta, L. M. and Emr, S. D. (1988). Intracellular sorting and processing of a yeast vacuolar hydrolase: proteinase A propeptide contains vacuolar targeting information. Mol. Cell. Biol. 8, 2105-2116.
Kobayashi, T., Stang, E., Fang, K. S., de Moerloose, P., Parton, R. G. and Gruenberg, J. (1998). A lipid associated with the antiphospholipid syndrome regulates endosome structure and function. Nature 392, 193-197.[Medline]
Komada, M. and Soriano, P. (1999). Hrs, a FYVE finger protein localized to early endosomes, is implicated in vesicular traffic and required for ventral folding morphogenesis. Genes Dev. 13, 1475-1485.
Komada, M., Masaki, R., Yamamoto, A. and Kitamura, N. (1997). Hrs, a tyrosine kinase substrate with a conserved double zinc finger domain, is localized to the cytoplasmic surface of early endosomes. J. Biol. Chem. 272, 20538-20544.
Li, Y., Kane, T., Tipper, C., Spatrick, P. and Jenness, D. D. (1999). Yeast mutants affecting possible quality control of plasma membrane proteins. Mol. Cell. Biol. 19, 3588-3599.
Luzio, J. P., Rous, B. A., Bright, N. A., Pryor, P. R., Mullock, B. M. and Piper, R. C. (2000). Lysosome-endosome fusion and lysosome biogenesis. J. Cell Sci. 113, 1515-1524.[Abstract]
Mellman, I. (1996). Endocytosis and molecular sorting. Annu. Rev. Cell Dev. Biol. 12, 575-625.[Medline]
Mu, F. T., Callaghan, J. M., Steele-Mortimer, O., Stenmark, H., Parton, R. G., Campbell, P. L., McCluskey, J., Yeo, J. P., Tock, E. P. and Toh, B. H. (1995). EEA1, an early endosome-associated protein. EEA1 is a conserved alpha-helical peripheral membrane protein flanked by cysteine "fingers" and contains a calmodulin-binding IQ motif. J. Biol. Chem. 270, 13503-13511.
Mullock, B. M., Bright, N. A.. Fearon, C. W., Gray, S. R. and Luzio, J. P. (1998). Fusion of lysosomes with late endosomes produces a hybrid organelle of intermediate density and is NSF dependent. J. Cell. Biol. 140, 591-601.
Odorizzi, G., Babst, M. and Emr, S. D. 1998. Fab1p PtdIns(3)P 5-kinase function essential for protein sorting in the multivesicular body. Cell 95, 847-58.[Medline]
Odorizzi, G., Babst, M. and Emr, S. D. (2000). Phosphoinositide signaling and the regulation of membrane trafficking in yeast. Trends Biochem. Sci. 25, 229-235.[Medline]
Piper, R. C., Cooper, A. A., Yang, H. and Stevens, T. H. (1995). VPS27 controls vacuolar and endocytic traffic through a prevacuolar compartment in Saccharomyces cerevisiae. J. Cell Biol. 131, 603-617.
Prescianotto-Baschong, C. and Riezman, H. (1998). Morphology of the yeast endocytic pathway. Mol. Biol. Cell 9, 173-189.
Press, B., Feng, Y. Hoflack, B. and Wandinger-Ness, A. (1998). Mutant Rab7 causes the accumulation of cathepsin D and cation-independent mannose 6-phosphate receptor in an early endocytic compartment. J. Cell Biol. 140, 1075-1089.
Raymond, C. K., Howald-Stevenson, I., Vater, C. A. and Stevens, T. H. (1992). Morphological classification of the yeast vacuolar protein sorting mutants: evidence for a prevacuolar compartment in class E vps mutants. Mol. Biol. Cell 3, 1389-1402.[Abstract]
Rieder, S. E., Banta, L. M., Kohrer, K., McCaffery, J. M. and Emr, S. D. (1996). Multilamellar endosome-like compartment accumulates in the yeast vps28 vacuolar protein sorting mutant. Mol. Biol. Cell 7, 985-999.[Abstract]
Robinson, J. S., Klionsky, D. J., Banta, L. M. and Emr, S. D. (1988). Protein sorting in Saccharomyces cerevisiae: isolation of mutants defective in the delivery and processing of multiple vacuolar hydrolases. Mol. Cell. Biol. 8, 4936-4948.
Rothman, J. H. and Stevens, T. H. (1986). Protein sorting in yeast: mutants defective in vacuole biogenesis mislocalize vacuolar proteins into the late secretory pathway. Cell 47, 1041-1051.[Medline]
Rothman, J. H., Howald, I. and Stevens, T. H. (1989). Characterization of genes required for protein sorting and vacuolar function in the yeast Saccharomyces cerevisiae. EMBO J. 8, 2057-2065.[Medline]
Scheuring, S., Bodor, O., Rohricht, R. A., Muller, S., Beyer, A. and Kohrer, K. (1999). Cloning, characterisation, and functional expression of the Mus musculus SKD1 gene in yeast demonstrates that the mouse SKD1 and the yeast VPS4 genes are orthologues and involved in intracellular protein trafficking. Gene 234, 149-159.[Medline]
Sikorski, R. S. and Hieter, P. (1989). A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. Genetics 122, 19-27.
Stauffer, D. R., Howard, T. L., Nyun, T. and Hollenberg, S. M. (2001). CHMP1 is a novel nuclear matrix protein affecting chromatin structure and cell-cycle progression. J. Cell Sci. 114, 2383-2393.
Thompson, J. D., Gibson, T. J., Plewniak, F., Jeanmougin, F. and Higgins, D. G. (1997). The CLUSTALX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 25, 4876-4882.
Trowbridge, I. S., Collawn, J. F. and Hopkins, C. R. (1993). Signal-dependent membrane protein trafficking in the endocytic pathway. Annu. Rev. Cell Biol. 9, 129-161.
van Deurs, B., Holm, P. K., Kayser, L. and Sandvig, K. (1995). Delivery to lysosomes in the human carcinoma cell line HEp-2 involves an actin filament-facilitated fusion between mature endosomes and preexisting lysosomes. Eur. J. Cell Biol. 66, 309-323.[Medline]
Vida, T. A. and Emr, S. D. (1995). A new vital stain for visualizing vacuolar membrane dynamics and endocytosis in yeast. J. Cell Biol. 128, 779-792.
Vida, T. A., Graham, T. R. and Emr, S. D. (1990). In vitro reconstitution of intercompartmental protein transport to the yeast vacuole. J. Cell Biol. 111, 2871-2884.
Wach, A. (1996). PCR-synthesis of marker cassettes with long flanking homology regions for gene disruptions in S. cerevisiae. Yeast 12, 259-265.[Medline]
Wan, L., Molloy, S. S., Thomas, L., Liu, G., Xiang, Y., Rybak, S. L. and Thomas, G. (1998). PACS-1 defines a novel gene family of cytosolic sorting proteins required for trans-Golgi network localization. Cell 94, 205-216.[Medline]
Wurmser, A. E., and S. D. Emr. 1998. Phosphoinositide signaling and turnover: PtdIns(3)P, a regulator of membrane traffic, is transported to the vacuole and degraded by a process that requires lumenal vacuolar hydrolase activities. EMBO J. 17, 4930-4942.[Medline]
Wurmser, A. E., Gary, J. D. and Emr, S. D. (1999). Phosphoinositide 3-kinases and their FYVE domain-containing effectors as regulators of vacuolar/lysosomal membrane trafficking pathways. J. Biol. Chem. 274, 9129-9132.
Yoshimori, T., Yamagata, F., Yamamoto, A., Mizushima, N., Kabeya, Y., Nara, A., Miwako, I., Ohashi, M., Ohsumi, M. and Ohsumi, Y. (2000). The mouse SKD1, a homologue of yeast Vps4p, is required for normal endosomal trafficking and morphology in mammalian cells. Mol. Biol. Cell 11, 747-763.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
B. McDonald and J. Martin-Serrano No strings attached: the ESCRT machinery in viral budding and cytokinesis J. Cell Sci., July 1, 2009; 122(13): 2167 - 2177. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Bajorek, E. Morita, J. J. Skalicky, S. G. Morham, M. Babst, and W. I. Sundquist Biochemical Analyses of Human IST1 and Its Function in Cytokinesis Mol. Biol. Cell, March 1, 2009; 20(5): 1360 - 1373. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Rodriguez-Galan, A. Galindo, A. Hervas-Aguilar, H. N. Arst Jr., and M. A. Penalva Physiological Involvement in pH Signaling of Vps24-mediated Recruitment of Aspergillus PalB Cysteine Protease to ESCRT-III J. Biol. Chem., February 13, 2009; 284(7): 4404 - 4412. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Weiss, S. Huppert, and R. Kolling ESCRT-III Protein Snf7 Mediates High-Level Expression of the SUC2 Gene via the Rim101 Pathway Eukaryot. Cell, November 1, 2008; 7(11): 1888 - 1894. [Abstract] [Full Text] [PDF] |
||||
![]() |
R G E van Eijsden, L M T Eijssen, P J Lindsey, C M M van den Burg, L E A de Wit, M E Rubio-Gozalbo, C E M de Die, T Ayoubi, W Sluiter, I F M de Coo, et al. Termination of damaged protein repair defines the occurrence of symptoms in carriers of the m.3243A>G tRNALeu mutation J. Med. Genet., August 1, 2008; 45(8): 525 - 534. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Yorikawa, E. Takaya, Y. Osako, R. Tanaka, Y. Terasawa, T. Hamakubo, Y. Mochizuki, H. Iwanari, T. Kodama, T. Maeda, et al. Human Calpain 7/PalBH Associates with a Subset of ESCRT-III-related Proteins in its N-terminal Region and Partly Localizes to Endocytic Membrane Compartments J. Biochem., June 1, 2008; 143(6): 731 - 745. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Shim, S. A. Merrill, and P. I. Hanson Novel Interactions of ESCRT-III with LIP5 and VPS4 and their Implications for ESCRT-III Disassembly Mol. Biol. Cell, June 1, 2008; 19(6): 2661 - 2672. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Dimaano, C. B. Jones, A. Hanono, M. Curtiss, and M. Babst Ist1 Regulates Vps4 Localization and Assembly Mol. Biol. Cell, February 1, 2008; 19(2): 465 - 474. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. E. Row, H. Liu, S. Hayes, R. Welchman, P. Charalabous, K. Hofmann, M. J. Clague, C. M. Sanderson, and S. Urbe The MIT Domain of UBPY Constitutes a CHMP Binding and Endosomal Localization Signal Required for Efficient Epidermal Growth Factor Receptor Degradation J. Biol. Chem., October 19, 2007; 282(42): 30929 - 30937. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Tian, L. Olsen, B. Sun, S. E. Lid, R. C. Brown, B. E. Lemmon, K. Fosnes, D. Gruis, H.-G. Opsahl-Sorteberg, M. S. Otegui, et al. Subcellular Localization and Functional Domain Studies of DEFECTIVE KERNEL1 in Maize and Arabidopsis Suggest a Model for Aleurone Cell Fate Specification Involving CRINKLY4 and SUPERNUMERARY ALEURONE LAYER1 PLANT CELL, October 1, 2007; 19(10): 3127 - 3145. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Usami, S. Popov, and H. G. Gottlinger Potent Rescue of Human Immunodeficiency Virus Type 1 Late Domain Mutants by ALIX/AIP1 Depends on Its CHMP4 Binding Site J. Virol., June 15, 2007; 81(12): 6614 - 6622. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Irie, Y. Shimazu, T. Yoshida, and T. Sakaguchi The YLDL Sequence within Sendai Virus M Protein Is Critical for Budding of Virus-Like Particles and Interacts with Alix/AIP1 Independently of C Protein J. Virol., March 1, 2007; 81(5): 2263 - 2273. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Zamborlini, Y. Usami, S. R. Radoshitzky, E. Popova, G. Palu, and H. Gottlinger Release of autoinhibition converts ESCRT-III components into potent inhibitors of HIV-1 budding PNAS, December 12, 2006; 103(50): 19140 - 19145. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. P. Nickerson, M. West, and G. Odorizzi Did2 coordinates Vps4-mediated dissociation of ESCRT-III from endosomes J. Cell Biol., November 27, 2006; (2006) jcb.200606113. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Scott, J. Gaspar, M. D. Stuchell-Brereton, S. L. Alam, J. J. Skalicky, and W. I. Sundquist Structure and ESCRT-III protein interactions of the MIT domain of human VPS4A PNAS, September 27, 2005; 102(39): 13813 - 13818. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. L. Robinson and J. E. Dixon The Phosphoinositide-3-phosphatase MTMR2 Associates with MTMR13, a Membrane-associated Pseudophosphatase Also Mutated in Type 4B Charcot-Marie-Tooth Disease J. Biol. Chem., September 9, 2005; 280(36): 31699 - 31707. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Lin, L. A. Kimpler, T. V. Naismith, J. M. Lauer, and P. I. Hanson Interaction of the Mammalian Endosomal Sorting Complex Required for Transport (ESCRT) III Protein hSnf7-1 with Itself, Membranes, and the AAA+ ATPase SKD1 J. Biol. Chem., April 1, 2005; 280(13): 12799 - 12809. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Ward, M. B. Vaughn, S. L. Shiflett, P. L. White, A. L. Pollock, J. Hill, R. Schnegelberger, W. I. Sundquist, and J. Kaplan The Role of LIP5 and CHMP5 in Multivesicular Body Formation and HIV-1 Budding in Mammalian Cells J. Biol. Chem., March 18, 2005; 280(11): 10548 - 10555. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Reid, J. Connell, T. L. Edwards, S. Duley, S. E. Brown, and C. M. Sanderson The hereditary spastic paraplegia protein spastin interacts with the ESCRT-III complex-associated endosomal protein CHMP1B Hum. Mol. Genet., January 1, 2005; 14(1): 19 - 38. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Pisitkun, R.-F. Shen, and M. A. Knepper Identification and proteomic profiling of exosomes in human urine PNAS, September 7, 2004; 101(36): 13368 - 13373. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Fujita, Y. Umezuki, K. Imamura, D. Ishikawa, S. Uchimura, A. Nara, T. Yoshimori, Y. Hayashizaki, J. Kawai, K. Ishidoh, et al. Mammalian class E Vps proteins, SBP1 and mVps2/CHMP2A, interact with and regulate the function of an AAA-ATPase SKD1/Vps4B J. Cell Sci., June 15, 2004; 117(14): 2997 - 3009. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Martin-Serrano, A. Yarovoy, D. Perez-Caballero, and P. D. Bieniasz Divergent retroviral late-budding domains recruit vacuolar protein sorting factors by using alternative adaptor proteins PNAS, October 14, 2003; 100(21): 12414 - 12419. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Whitley, B. J. Reaves, M. Hashimoto, A. M. Riley, B. V. L. Potter, and G. D. Holman Identification of Mammalian Vps24p as an Effector of Phosphatidylinositol 3,5-Bisphosphate-dependent Endosome Compartmentalization J. Biol. Chem., October 3, 2003; 278(40): 38786 - 38795. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Katoh, H. Shibata, H. Suzuki, A. Nara, K. Ishidoh, E. Kominami, T. Yoshimori, and M. Maki The ALG-2-interacting Protein Alix Associates with CHMP4b, a Human Homologue of Yeast Snf7 That Is Involved in Multivesicular Body Sorting J. Biol. Chem., October 3, 2003; 278(40): 39104 - 39113. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. L. Yeo, L. Xu, J. Ren, V. J. Boulton, M. D. Wagle, C. Liu, G. Ren, P. Wong, R. Zahn, P. Sasajala, et al. Vps20p and Vta1p interact with Vps4p and function in multivesicular body sorting and endosomal transport in Saccharomyces cerevisiae J. Cell Sci., October 1, 2003; 116(19): 3957 - 3970. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Shen, C. Li, Z. Min, R. B. Meeley, M. C. Tarczynski, and O.-A. Olsen sal1 determines the number of aleurone cell layers in maize endosperm and encodes a class E vacuolar sorting protein PNAS, May 27, 2003; 100(11): 6552 - 6557. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Fujita, M. Yamanaka, K. Imamura, Y. Tanaka, A. Nara, T. Yoshimori, S. Yokota, and M. Himeno A dominant negative form of the AAA ATPase SKD1/VPS4 impairs membrane trafficking out of endosomal/lysosomal compartments: class E vps phenotype in mammalian cells J. Cell Sci., January 15, 2003; 116(2): 401 - 414. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R. Stauffer, T. L. Howard, T. Nyun, and S. M. Hollenberg CHMP1 is a novel nuclear matrix protein affecting chromatin structure and cell-cycle progression J. Cell Sci., January 7, 2001; 114(13): 2383 - 2393. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||