|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
RESEARCH ARTICLE |
1
Wellcome Trust Laboratories for Molecular Parasitology, Imperial College of
Science Technology and Medicine, Department of Biochemistry, Exhibition Road,
London, SW7 2AY, UK
2
Sir William Dunn School of Pathology, University of Oxford, South Parks Road,
Oxford, OX1 3RE, UK
*
Author for correspondence (e-mail:
m.field{at}ic.ac.uk
)
| SUMMARY |
|---|
|
|
|---|
Key words: VSG, Clathrin, Trypanosome, Endocytosis, Endosome, Adaptin
| INTRODUCTION |
|---|
|
|
|---|
T. brucei is the causative agent of sleeping sickness in humans
and Nagana in cattle, a major cause of morbidity and economic hardship in
endemic regions of Africa. The life cycle of T. brucei alternates
between the mammalian bloodstream form (BSF) and tsetse fly vector procyclic
form (PCF), each stage possessing a unique surface coat. As the parasite:host
interface, the plasma membrane is clearly an important immune system target.
To survive in the mammalian host the parasite exploits antigenic variation of
the variant surface glycoproteins (VSG), which comprise the bloodstream form
coat, to avoid recognition by the humoral immune response. Recent evidence has
shown that during infection of rabbits, specific IgM and IgG anti-VSG
antibodies are produced more rapidly than the average VSG switch, indicating
that the major variant trypanosomes must be able to survive, at least
temporarily, in the presence of specific VSG antibodies (O'Beirne et. al.,
1998
). Such antibodies cause
aggregation of BSF T. brucei in immune serum in vitro, but
metabolically active parasites disaggregate after continued incubation and
remain fully infective. Disaggregation is dependent on normal endocytic
activity and, critically, results in proteolysis of internalised
immunoglobulin (O'Beirne et al.,
1998
), suggesting that the
endocytic/exocytic cycle plays a role in removal of coat-associated anti-VSG
antibodies from the parasite surface, contributing to parasite defence against
the host.
Clathrin-mediated vesicular traffic is a major mechanism by which proteins
and lipids are transported between membrane-bound organelles and is
responsible for a large proportion of import from the plasma membrane
(endocytosis) and transport from the trans-Golgi network (TGN) towards the
endosomal system (reviewed by Kirchhausen,
2000
). Clathrin may also be
involved in carrying protein and lipid from the TGN to vacuoles and lysosomes
(Hirst and Robinson, 1998
).
Cytoplasmic clathrin is a trimer (termed a triskelion) of three heavy chains
of 190 kDa radiating from a central hub; each of the heavy chains binds a
25 kDa light chain (Ungewickell and Branton,
1981
; Crowther and Pearse,
1981
; Kirchhausen and Harrison,
1981
). When the triskelions
associate with the membrane, they assemble into a planer lattice of hexagons
(Crowther and Pearse, 1981
).
The conversion of this lattice to one of hexagons and pentagons provides the
driving force for local deformation of the membrane and formation of
clathrin-coated pits and vesicles (Kirchhausen,
2000
).
During the process of clathrin-coated vesicle formation, clathrin interacts
with a network of protein partners in a coordinated manner. Adaptor proteins
(APs) are involved in the recruitment of cargo, whereas others such as AP180,
auxilin, amphiphysin, eps15 and epsin have regulatory functions (Kirchhausen,
1999
). The most abundant
proteins in the clathrin coat, after clathrin itself, are the heterotetrameric
AP complexes, which are present at a ratio of about one per two triskelions.
Several distinct, but closely related, classes of multimeric adaptors have
been identified in mammals. The best characterised are the AP-1 complex
specific for traffic from the TGN to the endosome and the AP-2 complex
specific for traffic from the plasma membrane to the endosome. Each complex
contains two large
100 kDa subunits (ß1- and
-adaptin for
AP-1, and ß2 and
-adaptin for AP-2), a medium
50 kDa subunit
(µ1 or µ2) and a small
20 kDa subunit (
1 or
2). Other
adaptor protein complexes AP-3 (
3, ß3, µ3,
3) found near
endosomes (Dell' Angelica et al.,
1997
; Simpson et al.,
1997
) and AP-4 (
,
ß4, µ4,
4) found close to the TGN (Dell' Angelica et al.,
1999
; Hirst et al.,
1999
) have been identified but
have not yet been unambiguously shown to associate with clathrin. The
analogous subunit complexes are structurally related and probably fulfil
similar functions; for example, the µ-subunits are involved in the
recognition of tyrosine-based sorting signals (Heuser and Keen,
1988
) and the ß-subunits
interact with cargo carrying the LL motif (Greenberg et al.,
1997
; Rapaport et al., 1998)
and with clathrin heavy chain (Shih et al.,
1995
; Owen et al.,
2000
).
We have identified through database searches EST and whole genome shotgun sequences for several potential components of clathrin-coated vesicles in T. brucei. Here we report on two of these, TbAPß1, a trypanosomal ß-adaptin homologous to yeast ß1-adaptin, and TbCLH, clathrin heavy chain. Both proteins exhibit differential localisation between life stages and the clathrin heavy chain is subject to marked upregulation in the BSF, suggesting clathrin expression levels correlate with the elevated endocytosis and recycling essential to the survival of the BSF parasite.
| MATERIALS AND METHODS |
|---|
|
|
|---|
DNA cloning and manipulation
The complete open reading frame of the T. brucei clathrin heavy
chain gene, TbCLH, was derived from a combination of GSS end
sequences from the T. brucei genome project and PCR fragments
amplified from T. brucei brucei genomic DNA to fill in gaps in the
contig. BLAST searching of the TIGR T. brucei genome project database
(www.tigr.org/tdb/mdb/tbdb) identified nine sheared genomic DNA sequences and
one BAC clone end sequence with homology to several known clathrin heavy chain
genes (Fig. 1A). Based on these
sequences the following primers were designed to generate PCR fragments to
complete the open reading frame, TbCLH1: 5'
GGGGAATTCGCTGGCGCCCCTCTGTGAAC 3'; TbCLH2: 5'
GGGAAGCTTGAACCGCGCAAATAGCAGCAA 3'; TbCLH3: 5'
GGGAAGCTTGCGAAGGGCCAGATCAGC 3'; TbCLH5: 5' GCCATACCTCGAATCCGCAC
3'; TbCHC6: 5' GGCCTGCAGCCTGAGTTTGACGCCTCG 3' TbCLH7:
5' GCCACCACACATCCGTAACAAATGG3'. The amplified fragments were
subcloned using the PCR-Script Amp cloning kit (Stratagene, USA) and
sequenced. The final sequences were assembled with the GSS sequences to
complete the TbCLH open reading frame.
|
During a sequencing screen for components of the trypanosomal secretory
pathway we isolated a partial cDNA identical to an EST fragment (GenBank
accession no. AI881056) homologous to higher eukaryotic ß-adaptins. This
clone was used as a probe to screen a T. brucei
FIX genomic
library by filter hybridisation to obtain the entire TbAPß1
ORF.
Northern blot hybridisation
Total RNA was extracted from mid-logarithmic phase cultures of T.
brucei PCF and BSF cells using TrizolReagent (Gibco Life Technologies
Ltd, Paisley, UK). 20 µg of RNA was separated on a 1.2%
agarose/formaldehyde gel and transferred to a Hybond-N nylon membrane
(Amersham Life Science Ltd, UK). Hybridisation was performed in Church buffer
and the filter was washed in 0.2x SSC/0.1% SDS at 65°C.
Antibody production
Antiserum against TbAPß1 peptide (residues 568-582, CVESTFSDAMTMGDL)
was generated in rabbits and mice using standard procedures. TbCLH antiserum
was generated against an expressed clathrin fragment (residues 1268-1465)
amplified using the following primers TbCLHF1: 5'
CGGGATCCGATGCGGTTAACCATG 3'; TbCLHR1: 5'
CCCAAGCTTGGATTCGAGGTATGGTATGGCAGAATC 3' which was subcloned into the
pQE30 expression vector (Qiagen, Max-Volmer-Strabe, Hilgen) through a
BamHI site introduced the 5' primer and a HindIII site
in the 3' primer. Antibodies were affinity purified on antigen
immobilised on cyanogen bromide activated Sepharose 4B (Pharmacia, St Albans,
UK).
Immunofluorescence microscopy
Cells were washed in 250 mM Hepes pH 7.5 and, applied to polysine-coated
slides and fixed in 4% paraformaldehyde (PFA) in 250 mM Hepes pH 7.5 for 10
minutes on ice, followed by 8% PFA-Hepes for 10 minutes on ice and then 40
minutes at room temperature. All further manipulations were performed at room
temperature. Concanavalin A (ConA) uptake was performed by incubation of cells
in serum-free medium supplemented with 5 µg/ml fluorescein ConA (Vector
Laboratories, Burlingame, CA) at 4°C for 10 minutes before direct transfer
to 37°C for 30 seconds or 1 minute. To follow receptor-mediated
endocytosis, 107 BSF parasites/ml were incubated in serum-free
media containing 50 ug/ml transferrin-Texas Red conjugate (Molecular Probes
Inc., Eugene, OR) at 37°C for 30 minutes. For Golgi complex visualisation,
BODIPY FL ceramide (Molecular Probes Inc.) was coupled to de-fatted bovine
serum albumin (BSA) according to the manufacturer's instructions. Cells were
incubated with the conjugated probe at 37°C before back-extracting twice
with serum-free medium supplemented with 1.8% de-fatted BSA. All cells were
DNA stained with DAPI at 0.5 µg/ml. Cells were examined using a Nikon
Microphot II epifluorescence microscope equipped with a CH350 Slow Scan CCD
camera (Photometrics, Tuscon, AZ). Digital images were captured using IP Lab
spectrum 3.1 (Scanalytics Inc., Fairfax, VA) software or with a Laser Scanning
Microscope 510 (Zeiss, Oberkocken, Germany) and processed for printing using
Adobe PhotoShop (Adobe Systems Inc., San Jose, CA).
Western blots
1x107 cells per lane were electrophoresed on 12% SDS -
polyacrylamide gels and blotted onto Hybond ECL nitrocellulose membrane
(Amersham life Science Ltd, UK) by wet transfer. Filters were processed as
described (Field and Field,
1997
).
Yeast expression of HA epitope-tagged TbAPß1
The full length TbAPß1 gene was amplified by PCR from T.
brucei brucei genomic DNA using the primers, TbBAD1: 5'
CCAAATGCATATGATGGAAGCGGTTCTTCGC 3' and TbBAD2: 5'
GGGGAATTCTCATGAAAACAAATCATCCAG 3'. The resulting 2.1 kb fragment was
subcloned into the NdeI and EcoRI sites of the yeast
expression vector pGADT7 (Clontech) in frame with the N-terminal
haemagglutinin (HA) epitope tag. The resulting construct, pGADT7ßAd, was
transformed into the Saccharomyces cerevisiae strain GPY418 by the
standard lithium acetate procedure. Wild-type yeast were propagated in YPD
medium (1% Bacto-yeast extract, 2% Bacto-peptone and 2% Bacto-dextrose).
Transformed cells were selected on plates containing SD medium lacking leucine
(0.67% yeast nitrogen base, 2% dextrose (Clontech) supplemented with 20
µg/ml adenine, arginine, histidine, methionine, tryptophan and uracil, 30
µg/ml isoleucine, lysine and tryosine, 50 µg/ml phenylalanine, 150
µg/ml valine and 200 µg/ml threonine). Protein was extracted from
wild-type and transformed yeast strains using the urea/SDS procedure.
Electron microscopy
For conventional electron microscopy, cells were fixed in 4%
paraformaldehyde (PFA-250 mM Hepes; pH 7.4) on ice for 10 minutes followed by
8% PFA-Hepes on ice for 10 minutes and then for 50 minutes at room
temperature, washed in PBS and postfixed in 1% osmium tetroxide-1.5% potassium
ferrocyanide for 60 minutes at room temperature. The cells were washed in
water, incubated in 0.5% magnesium-uranyl acetate overnight at 4°C, washed
again in water, dehydrated in ethanol and embedded in Epon. Sections were
collected onto grids and stained with lead citrate for contrast. For
cryosectioning, cells were fixed in PFA as above, then frozen in 2.1 M sucrose
and stored under liquid nitrogen. Thin sections of frozen cells were cut on a
Reichert Ultra S microtome with FCS attachment. The sections were then
incubated with the clathrin antibody, which was visualised using protein
A-gold 6 nm conjugates. All sections were examined using an Omega 912 electron
microscope (Zeiss).
| RESULTS |
|---|
|
|
|---|
adaptins, and one each of
and
adaptin (see Table
1). Blast analysis and alignments of the retrieved sequences
indicate that the African trypanosome has at least two AP complexes. We also
retrieved sequence corresponding to clathrin heavy and light chains. Given the
depth of coverage of the T. brucei genome project sequence pool it is
highly probable that the identified gene products represent the total AP
complement, although the presence of additional sequences cannot be formally
ruled out. Interestingly, the adaptin subunits identified constitute the
correct complement to assemble two AP complexes, containing one ß, a
second heavy chain, and a µ and
chain each. Homology suggests that
these subunits are likely to encode trypanosomal equivalents of the AP-1 and
AP-3 complexes.
|
We decided to characterise the clathrin heavy chain and one of the
ß-adaptins. We obtained a full length sequence for the open reading frame
of 5115 bp of the T. brucei clathrin heavy chain gene (GenBank
accession no. AJ278858), encoding a protein of 1705 amino acids with a
predicted molecular mass of
191 kDa. TbCLH shares
34% identity and
56% similarity with yeast and
38% identity and
60% similarity
with human clathrin heavy chains, respectively, with similar levels of
homology throughout the entire protein
(Fig. 1A). The trypanosomal
heavy chain is slightly larger due to several small insertions. Whereas the
sequence variation of other clathrins is limited to conservative replacements
or infrequent gaps of usually less than three residues, TbCLH has a unique
insertion of 10 residues in the knee region, between the proximal and distal
rod-like domains.
During a screen for components of the trypanosomal secretory pathway we
isolated a partial cDNA corresponding to an EST fragment (GenBank accession
No. AI881056) homologous to higher eukaryotic ß-adaptins. By screening a
-FIX library with this fragment, we isolated genomic DNA containing
full length coding sequence for TbAPß1 (GenBank accession no.
AF152173). The TbAPß1 ORF is 2088 bp in length and encodes a
protein of 696 amino acids with a predicted molecular mass of
76 kDa.
TbAPß1 exhibits greatest homology (
36% identity,
57%
similarity) to higher eukaryotic ß-adaptins of the AP1 and AP2 complexes,
and
31% identity and
50% similarity to yeast ß-adaptins.
To determine the closest homologues of TbCLH and TbAPß1, phylogenetic
reconstruction was performed using PAUP (phylogenetic analysis using
parsimony; Swofford, 1998
). By
this analysis, TbCLH is most similar to yeast and plant clathrin heavy chains
(Fig. 2A), consistent with
current views of eukaryotic evolution. The TbAPß1 is most similar to
yeast APß1 (Ap12p) (Fig.
2B), suggesting involvement in transport from the TGN, but
bootstrap values indicate that an assignment to any one adaptor complex cannot
be made based on sequence homology alone. Southern blot analysis demonstrates
that both TbCLH and TbAPß1 are present as single copy
genes per haploid genome (data not shown).
|
Amino acid sequence features of trypanosomal clathrin heavy chain and
ß1-adaptin
The binding site for ß-arrestin has been localised to the first 100
residues of higher eukaryotic clathrin heavy chain (Goodman et al.,
1997
) and site-directed
mutagenesis implicates Q89, F91, K96 and K98 as critical residues. This domain
in TbCLH is well conserved and the residues instrumental in ß-arrestin
binding are found to be invariant (Fig.
1B). Recently, clathrin was shown to interact with ß-adaptins
through the same site that binds ß-arrestins, a groove in the side of the
terminal domain of the ß-propeller (ter Harr et al.,
1998
; ter Harr et al.,
2000
). Although the residues
for adaptin binding are conserved, molecular modelling of TbCLH on the crystal
structure for the N-terminal domain of rat clathrin heavy chain predicts that
the trypanosome protein will have a structure almost indistinguishable from
the mammalian protein. This analysis also demonstrates that one of the
insertions in TbCLH loops out into this binding groove suggesting there may be
a small difference in interactions at this site, the significance of which is
unclear at present (data not shown).
On the basis of in vitro mutagenesis analysis, it has been suggested that
the light chain binding region extends into the trimerisation domain (Pishvaee
et al., 1997
), which is
predicted to form an
-helix (ter Harr et al.,
1998
). In this model, residues
that effect light chain binding without exhibiting strong effects on
trimerisation fall along one face of the helix, enabling the light chain to
regulate trimerisation and self-assembly (Pishvaee and Payne,
1998
). Analysis of the TbCLH
sequence supports this hypothesis, as these residues are highly conserved
(Fig. 1B).
The TbAPß1 sequence lacks the C-terminal globular appendage, or ear,
present in higher eukaryotic ß-adaptins
(Fig. 1C). The appendage
domain, which is also absent in yeast ß-adaptins, is involved in binding
accessory proteins in higher eukaryotes (Owen et al.,
2000
). As shown in
Fig. 1C, both the trypanosomal
and yeast ß1-adaptin (Ap12) terminate with sequences similar to the
canonical clathrin binding box motif (LLpL-, where L denotes leucine, p, a
polar residue and -, a negatively charged residue) found in ß-arrestin,
amphiphysin and the hinge region of other ß-adaptins (Dell'Angelica et
al., 1998
; Kirchhausen,
2000
). This sequence is also
reminiscent of conserved C-terminal LID
clathrin binding sequences (
denotes a hydrophobic residue) in yeast epsin and AP180 proteins (Wendland et
al., 1999
). Hence, the
trypanosome appears to use the same set of peptide signals as higher
eukaryotes, indicative of an ancient origin for this system.
The trypanosomal clathrin heavy chain is developmentally
regulated
Northern blot analysis of RNA from PCF and BSFs indicate that the
TbCLH mRNA is present as a single transcript of
6 kb, and is at
least ten times more abundant in the BSF relative to PCF
(Fig. 3). The
TbAPß1 mRNA is present as a transcript of
2.2 kb and is
approximately five times more abundant in the BSF relative to the PCF
(Fig. 3), suggesting a more
moderate level of developmental regulation than TbCLH mRNA.
|
To characterise the TbCLH and TbAPß1 proteins, we produced affinity
purified rabbit polyclonal antibodies. Anti-TbCLH serum was generated by
expressing a portion of the distal leg and trimerisation domain in
Escherichia coli, which was purified and used as immunogen. The
purified antibodies exhibited strong reactivity against the recombinant
antigen in induced E. coli lysates
(Fig. 4A, left). To obtain
antibodies against TbAPß1, rabbits were immunised with a 15 amino acid
oligopeptide (residues 568-582) corresponding to a sequence near the
C-terminus of the predicted rod domain. We chose to use the peptide route as
several attempts to express TbAPß1 in E. coli were unsuccessful,
and this region of the protein is predicted to be the least conserved between
ß-adaptin family members. The specificity of the anti-peptide antibodies
was confirmed by probing S. cerevisiae that expressed
HA-epitope-tagged TbAPß1, where a band of
76 kDa was detected,
corresponding to the predicted molecular weight of TbAPß1
(Fig. 4B, middle, left). No
reactivity with anti-TbAPß1 antibodies was observed in lysates from yeast
not expressing HA-TbAPß1.
|
Northern data suggest a significant degree of developmental regulation for
both TbAPß1 and TbCLH, but due to the post-transcriptional nature of
control of gene expression in kinetoplastids, mRNA abundance is not always an
accurate reflection of relative protein levels. Hence, to determine the
expression level of TbCLH, we probed BSF and PCF cell lysates
(Fig. 4A, right). The antiserum
identified a single protein of
190 kDa, highly expressed in BSF cells but
barely detectable in PCF. Specificity was confirmed by pre-incubation of the
antibody with recombinant CLH, which ablated immunoreactivity on the blot
(data not shown). Equivalence of loading was confirmed by reprobing the filter
with antibody against T. brucei BiP (Bangs et al.,
1993
), which is expressed about
threefold more in BSF compared with PCF. TbAPß1 affinity purified
antibodies were also used to probe BSF and PCF lysates
(Fig. 4B, right). This analysis
demonstrated a near equivalent level of TbAPß1 expression because a
single band of the appropriate molecular mass (76 kDa) was detectable in both
life stages with approximately equal intensity, indicating that this protein
is not subject to significant stage regulated expression. Constitutive
TbAPß1 expression contrasts with the developmental regulation of TbCLH,
suggesting that, in T. brucei, not all clathrin-mediated transport
steps are under developmental control.
Localisation of trypanosomal clathrin heavy chain and
ß1-adaptin
To determine the subcellular localisations of TbCLH and TbAPß1 the
affinity purified antibodies were used in immunofluorescence analysis of BSF
and PCF parasites following paraformaldehyde fixation
(Fig. 5). The location of the
nucleus and the kinetoplast (mitochondrial DNA) were revealed by DAPI
staining. In PCF cells, the clathrin heavy chain is localised between the
kinetoplast and the nucleus (Fig.
5A). This localisation is typical of flagellar pocket, endocytic
and Golgi structures (Field et al.,
2000
). In the BSF, TbCLH is
extensively distributed throughout the posterior of the cell and is present on
numerous large vesicular or tubular structures
(Fig. 5B), confirming the
extensive upregulation observed by northern and western analysis.
|
In PCF cells, TbAPß1 is largely localised to perinuclear vesicles with a lesser amount being diffusely distributed in tubular structures throughout the cell (Fig. 5C). When BSF cells were examined, the distribution of TbAPß1 was found to be dramatically different to that observed in the PCF and was predominantly localised to two large perinuclear structures in the posterior of the cell between the kinetoplast and the nucleus (Fig. 5D). The near equivalent level of TbAPß1 immunofluorescence signals in the two life stages is consistent with the western data.
The Golgi complex plays a vital role in clathrin/adaptin-mediated
anteriograde transport steps in higher eukaryotes, we therefore investigated
the association of trypanosomal clathrin and adaptin protein with the
membranes of this organelle. We used BODIPY ceramide to label the Golgi stacks
(Field et al., 1998
; Field et
al., 2000
) and observed that
TbCLH was localised to elements juxtaposed to the Golgi complex in BSFs
(Fig. 6A). Significantly, no
complete colocalisation was observed. Association of clathrin with vesicular
and tubular elements, close to the Golgi complex was confirmed at the
ultrastructural level by cryoimmunomicroscopy (see below). Counter-staining
BSF cells with BODIPY ceramide and anti-TbAPß1 demonstrated that the more
anterior TbAPß1-positive structure partially localises to the Golgi
complex, most probably the trans face (Fig.
6B). Association of TbAPß1 with the trans-Golgi complex and
the virtual absence of this protein from the region of the flagellar pocket
suggests that TbAPß1 is probably an AP1ß-adaptin orthologue.
However, the differential distribution of the protein in BSF and PCF suggests
that TbAPß1 could be involved in more than one transport system.
Co-staining PCF and BSF cells for TbCLH and TbAPß1 demonstrated only
partial colocalisation of these two proteins
(Fig. 6C,D). Failure to detect
significant colocalisation for clathrin and TbAPß1 in the BSF is most
likely a consequence of the large amount of clathrin involved in mediating the
massive levels of endocytosis relative to a far smaller population of clathrin
molecules associated with the Golgi, and localising with TbAPß1.
|
By DAPI staining of the kinetoplast and nucleus, it is possible to position
cells at particular points during the cell cycle (Woodward and Gull,
1990
). The distribution of
TbCLH during the cell cycle of PCF and BSF cells is shown in
Fig. 7. Overall expression
levels of the protein do not alter significantly and the major features of
individual structures remain, suggesting that there is no morphological
alteration of the clathrin apparatus during mitosis. Throughout the PCF cell
cycle TbCLH remains tightly associated with the kinetoplast but most
significantly, when the kinetoplast initiates division, the TbCLH structures
are also seen to divide into two pools, both of which remain juxtaposed to the
kinetoplast (Fig. 7). This
behaviour is consistent with the highly coordinated fashion in which T.
brucei replicates organelles, including those of the endomembrane system
and the Golgi complex (Field et al.,
1998
; Field et al.,
2000
).
|
Clathrin heavy chain is associated with endocytic vesicles
To demonstrate directly that TbCLH is involved in endocytosis in T.
brucei, ConA was used as a marker for membrane bound ligands at the
flagellar pocket and endocytic vesicles (Brickman et al.,
1995
). When bloodstream form
parasites incubated with fluorescently labelled ConA at 4°C were warmed to
37°C for 30 seconds, most ConA is confined to the flagellar pocket, with a
lesser amount present in adjacent vesicular structures
(Fig. 8A). Under these
conditions, there is little co-localisation of ConA with TbCLH, which
underlies the flagellar pocket. Following a 1 minute incubation at 37°C, a
greater fraction of ConA has internalised and there is increased
co-localisation with TbCLH (Fig.
8B). To demonstrate more precisely the involvement of TbCLH in the
process of receptor-mediated endocytosis, we analysed uptake of fluorescent
transferrin, which is endocytosed by a GPI-anchored heterodimeric receptor
complex, ESAG6/7 (Steverding et al.,
1994
). In this case we
observed almost complete colocalisation of transferrin with TbCLH
(Fig. 8C). We conclude that
TbCLH is indeed a component of endocytic vesicles and the greatest
concentration of TbCLH is not on the flagellar pocket membrane but vesicular
and tubular structures underlying it. Significantly, the TbCLH-containing
structures receive endocytic traffic rapidly and hence represent true
clathrin-coated vesicles. Interestingly, the presence of transferrin in
clathrin-containing structures suggests that, in trypanosomes, GPI-anchored
proteins can be endocytosed by a clathrin-dependent mechanism.
|
Ultrastructural localisation of TbCLH
Previous workers have reported the presence of vesicular coats on membrane
structures associated with the flagellar pocket region that have a clear
similarity to the clathrin coats of higher eukaryotes (Webster and Shapiro,
1990
). Analysis of PFA fixed
Epon-embedded BSF cells demonstrated the presence of clathrin-like coated
vesicles and collecting tubules in the vicinity of the flagellar pocket
indicated by the presence of an electron dense fibrillar coat
(Fig. 9A). To further refine
the localisation of TbCLH and to determine if these structures do indeed
represent trypanosome clathrin, cryo-immunogold electron microscopy was
performed using the TbCLH antibodies. The location of the gold particles
confirmed that clathrin is indeed a component of the coat on the collecting
tubules (Fig. 9B). In addition,
TbCLH immunoreactivity is widely distributed amongst membrane structures in
the posterior region of the cell, as demonstrated by the digitally enhanced
gold particles shown in Fig.
9C. A minority of TbCLH is also associated with membranes
associated with the trans-Golgi face (Fig.
9C) and coated vesicles (Fig.
9D).
|
| DISCUSSION |
|---|
|
|
|---|
TbCLH is extremely highly conserved, as has been observed for other heavy
chain sequences from yeast to humans, but the evolutionary distance between
trypanosomes and higher eukaryotes is rather more significant. The high
pressure to preserve the primary structure of the heavy chain is probably a
reflection of the highly extended inter leg contacts required for assembly of
the triskelions and the large number of interactions also required for cargo
binding and the regulation of coat formation (Kirchhausen,
2000
). The N-terminal domain
of TbAPß1 exhibits significant similarity to higher eukaryotic adaptins
and is most homologous to yeast ß1-adaptin. However, the appendage domain
is absent indicating it is possible to efficiently form clathrin cages without
this specialised binding platform for accessory proteins. TbAPß1 is found
to terminate with a sequence similar to the clathrin binding box motif.
Several components of the endo-membrane system of T. brucei, such
as BiP and p67, are subject to a degree of developmental regulation, being
more highly expressed in the BSF than the PCF (Bangs,
1998
). The observation that
TbCLH is subject to strong upregulation in the BSF, whereas the
Golgi-associated TbAPß1 is expressed at more equivalent levels, is
consistent with the elevated endocytosis and recycling in the BSF. A high rate
of endocytosis at the flagellar pocket is proposed to be the result of
dependence on host nutrients, but may also play a vital role in immune
evasion. Nutrient acquisition via receptor-mediated endocytosis is presumably
also required in the PCF, but only the BSF has to face the mammalian host
immune system (Overath et al.,
1997
; O'Beirne et al.,
1998
), and this may be a
primary reason for elevated endocytic levels in BSFs.
Both TbCLH- and TbAPß1-containing compartments exhibit dramatic morphological restructuring between life stages. In the PCF, TbCLH has a limited distribution, localising predominantly to the flagellar pocket, whereas in the BSF it is extensively distributed to large and numerous tubulo-vesicular structures throughout the cytoplasm. In the BSF, the trypanosomal clathrin heavy chain is involved in endocytosis at the flagellar pocket and is present on coated vesicles near to the TGN. We cannot rule out the possibility that the more limited PCF distribution is due, at least in part, to threshold effects, but the presence of significantly more bright foci in BSF immunofluorescence images compared with the PCF suggests that the BSF does indeed contain a more elaborate set of clathrin compartments.
The endocytic system of BSF trypanosomes has a characteristic morphology
consisting not only of discrete vesicles but also of stacks of collecting
tubules (Langreth and Balber,
1975
; Brickman et al.,
1995
; Jeffries et al.,
2001
). By cryoimmuno-EM, the
clathrin heavy chain is shown to be present on coated vesicles and highly
extended tubules adjacent to the flagellar pocket, as well as structures
associated with the TGN. These tubules have been proposed to be analogous to
tubular endosomes and are the site of endocytosed material trapped at low
temperatures (Brickman et. al.,
1995
). Clathrin has previously
been found in peripheral endosomes (Sorkina et al.,
1999
), where it may be
associated with AP-3. Whether the clathrin-coated tubules identified in this
study are part of the endocytic apparatus or the endosomal network remains to
be elucidated
The distribution of TbAPß1 in PCF cells is observed to be atypical of
previously studied ß-adaptins. In the PCF it is concentrated in several
small perinuclear vesicles and to a lesser degree in reticular structures
reminiscent of the ER (Bangs et al.,
1993
). In the BSF, TbAPß1
is redistributed to two large membranous structures adjacent to the nucleus on
the posterior side and there is reduced visible reticular staining. The
structure nearest to the nucleus partially localises to the Golgi complex.
There is only partial colocalisation of TbCLH and TbAPß1, suggesting that
adaptin is not associated with the majority of the clathrin involved in
endocytosis and is most likely associated with the TGN. This localisation and
phylogenetic data indicate that the adaptin studied here is most likely to be
a component of the AP-1 complex. In mammals, AP-1 has been localised to
early/recycling endosomes (Futter et al.,
1998
), which may account for
some of the peripheral staining observed with the anti-TbAPß1 antibodies.
However, we cannot formally rule out the possibility that TbAPß1 is a
component of the TGN-associated AP3 complex. The trypanosomal database
contains partial sequences for at least one other trypanosomal ß-adaptin
and sufficient AP subunits to form two distinct full AP complexes. It is
noteworthy that it is not possible to clearly define sequences for three
adaptor complexes as observed in other eukaryotes and there are no sequences
for the large
subunit of the AP2 complex currently in the
databases.
Phylogenetic analysis of major components of the eukaryotic
heterotetrameric transport coat proteins indicates that they have evolved
through gene duplication of a common heterodimer ancestor (Schledzewski et
al., 1999
). Gene duplication
has also been demonstrated to be a mechanism for elaboration of other
components of the secretory pathway (Field and Field,
1997
). The most recent gene
duplication of the heterotetrameric transport coat proteins was that giving
rise to the AP1 and AP2 complexes and from current T. brucei genome
sequence data, only two AP complexes are discernible in this divergent
eukaryote. Further work is required to assign the T. brucei AP
complexes as orthologues of the mammalian complexes.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Bangs, J. D., Uyetake, L., Brickman, M. J., Balber, A. E. and Boothroyd, J. C. (1993). Molecular cloning and cellular localisation of a BiP homologue in Trypanosoma brucei. Divergent ER retention signals. J. Cell Sci. 105,1101 -1113.[Abstract]
Bangs, J. D. (1998). Surface coats and secretory trafficking in African trypanosomes. Curr. Opin. Microbiol. 1,448 -454.[Medline]
Brickman, M. J., Cook, J. M. and Balber, A. E. (1995). Low temperature reversibly inhibits transport from tubular endosomes to a perinuclear, acidic compartment. J. Cell Sci. 108,3611 -3621.[Abstract]
Coppens, I., Baudhuin, P., Opperdoes, F. R. and Courtoy, F.
J. (1988). Receptors for the host low density lipoproteins on
the hemoflagellate Trypanosoma brucei: Purification and involvement
in the growth of the parasite. Proc. Natl. Acad. Sci.
USA 85,6753
-6757.
Crowther, R. A. and Pearse, B. M. (1981).
Assembly and packing of clathrin into coats. J. Cell
Biol. 91,790
-797.
Dell'Angelica, E. C., Ohno, H., Ooi, C. E., Rabinovich, E., Roche, K. W. and Bonicino, J. S. (1997). AP-3: an adaptor-like protein complex with ubiquitous expression. EMBO J. 16,917 -928.[Medline]
Dell'Angelica, E., Klumperman, J., Stoorvogel, W. and
Bonifacino, J. (1998). Association of the AP-3 adaptor
complex with clathrin. Science
280,431
-434.
Dell'Angelica, E. C., Mullins, C. and Bonifacino, J. S.
(1999). AP-4, a novel protein complex related to clathrin
adaptors. J. Biol. Chem.
274,7278
-7285.
Field, H. and Field, M. C. (1997) Tandem
duplication of Rab genes followed by sequence divergence and acquisition of
distinct functions in Trypanosoma brucei. J. Biol.
Chem. 272,10498
-10505.
Field, H., Farjah, M., Pal, A., Gull, K. and Field, M. C.
(1998). Complexity of trypanosomatid endocytosis pathways
revealed by Rab4 and Rab5 isoforms in Trypanosoma brucei. J. Biol.
Chem. 273,32102
-32110.
Field, H., Sherwin, T., Smith, A., Gull, K. and Field, M. C. (2000). Cell-cycle and developmental regulation of TbRAB31 localisation, a GTP-locked Rab protein from Trypanosoma brucei.Mol. Biochem. Parasitol. 106, 21-35.[Medline]
Futter, C. E., Gibson, A., Allchin, E. H., Maxwell, S., Ruddock,
L. J., Odorizzi, G., Domingo, D., Trowbridge, I. S. and Hopkins, C. R.
(1998). In polarized MDCK cells basolateral vesicles arise from
clathrin-gamma-adaptin-coated domains on endosomal tubules. J. Cell
Biol. 141,611
-623.
Goodman, O. B., Jr, Krupnick, J. G., Gurevich, V. V., Benovic,
J. L. and Keen, J. H. (1997). Arrestin/clathrin interaction.
Localization of the arrestin binding locus to the clathrin terminal domain.
J. Biol. Chem. 272,15017
-15022.
Greenberg, M. E., Bronson, S., Lock, M., Neumann, M., Pavlakis, G. N. and Skowronski, J. (1997). Co-localization of HIV-1 Nef with the AP-2 adaptor protein complex correlates with Nef-induced CD4 down-regulation. EMBO J. 16,6964 -6976.[Medline]
Heuser, J. E. and Keen, J. (1988). Deep-etch
visualisation of proteins involved in clathrin assembly. J. Cell
Biol. 107,877
-886.
Hirst, J., Bright, N. A., Rous, B. and Robinson, M. S.
(1999). Characterization of a fourth adaptor-related protein
complex. Mol. Biol. Cell
10,2787
-2802.
Hirst, J. and Robinson, M. S. (1998). Clathrin and adaptors. Biochim. Biophys. Acta, 1404,173 -193.[Medline]
Jeffries, T. R., Morgan, G. W. and Field, M. C. (2001). A developmentally regulated Rab 11 homologue in Trypanosoma brucei is involved in recycling processes. J. Cell Sci. 114,2617 -2626.
Kirchhausen, T. (1999). Adaptors for clathrin-mediated traffic. Annu. Rev. Cell. Dev. Biol. 15,705 -732.[Medline]
Kirchhausen, T. (2000). Clathrin. Annu. Rev. Cell. Biochem. 69,699 -727.
Kirchhausen, T. and Harrison, S. C. (1981). Protein organization in clathrin trimmers. Cell 3, 755-761.
Langreth, S. G. and Balber, A. E. (1975). Protein uptake and digestion in bloodstream and culture forms of Trypanosoma brucei. J. Protozool. 22, 40-53.[Medline]
Liu, J., Qioa, X., Du, D. and Lee, M. G.
(2000). Receptor mediated endocytosis in the procyclic form of
Trypanosoma brucei. J. Biol. Chem.
275,12032
-12040.
O'Beirne, C., Lowry, C. M. and Voorheis, H. P. (1998). Both IgM and IgG anti-VSG antibodies initiate a cycle of aggregation-disaggregation of bloodstream forms of Trypanosoma brucei without damage to the parasite. Mol. Biochem. Parasitol. 91,165 -193.[Medline]
Overath, P., Stierhof, Y. and Wiese, M. (1997). Endocytosis and secretion in trypanosomatid parasites-tumultuous traffic in a pocket. Trends Cell Biol. 7, 27-33.
Owen, D. J., Vallis, Y., Pearse, B. M., McMahon, H. T. and Evans, P. R. (2000). The structure and function of the beta2-adaptin appendage domain. EMBO J. 19,4216 -4227.[Medline]
Pishvaee, B., Munn, A. and Payne, G. S. (1997). A novel structural model of clathrin function. EMBO J. 16,2227 -2239.[Medline]
Pishvaee, B. and Payne, G. (1998). Clathrin coats - threads laid bare. Cell 95,443 -446.[Medline]
Schledzewski, K., Brinkmann, H. and Mendel, R. R. (1999). Phylogenetic analysis of components of the eukaryotic vesicle transport system reveals a common origin of adaptor complexes 1, 2, and 3 and the F sub-complex of coatomer COPI. J. Mol. Evol. 48,770 -778.[Medline]
Shapiro, S. Z. and Webster, P. (1989). Coated vesicles from the protozoan parasite Trypanosoma brucei: purification and characterisation. J. Protozool. 36,344 -349.[Medline]
Shih, W., Gallusser, T. and Kirchhausen, T.
(1995). A clathrin-binding site in the hinge of the beta2 chain
of mammalian AP-2 complexes. J. Biol. Chem.
270,31083
-31090.
Simpson, F., Peden, A. A., Christopoulou, L. and Robinson, M.
S. (1997). Characterization of the adaptor-related protein
complex, AP-3 J. Cell Biol.
137,835
-845.
Sorkina, T., Bild, A., Tebar, F. and Sorkin, A. (1999). Clathrin, adaptors and eps15 in endosomes containing activated epidermal growth factor receptors. J. Cell Sci. 112,317 -327.[Abstract]
Steverding, D., Stierhof, Y. D., Chaudhri, M., Ligtenberg. M., Schell, D., Beck-Sickinger, A. G. and Overath, P. (1994). ESAG 6 and 7 products of Trypanosoma brucei form a transferrin binding protein complex. Eur. J. Cell Biol. 64, 78-87.[Medline]
Swofford, D. L. (1998).PAUP*, phylogenetic analysis using parsimony (*and other methods) . Version 4. Sinauer Associates, Sunderland, MA.
ter Haar, E., Musacchio, A., Harrison, S. C. and Kirchhausen, T. (1998). Atomic structure of clathrin: a beta propeller terminal domain joins an alpha zigzag linker. Cell 95,563 -573.[Medline]
ter Haar, E., Harrison, S. C. and Kirchhausen, T.
(2000). Peptide-in-groove interactions link target proteins to
the beta-propeller of clathrin. Proc. Natl. Acad. Sci.
USA 97,1096
-1100.
Ungewickell, E. and Branton, D. (1981). Assembly units of clathrin coats. Nature 289,420 -422.[Medline]
Webster. P. and Shapiro, S. Z. (1990). Trypanosoma brucei: a membrane-associated protein in coated endocytic vesicles. Exp. Parasitol. 70,154 -163.[Medline]
Webster, P. and Russell, D. G. (1993). The flagellar pocket of trypanosomatids. Parasitol. Today 9, 201-206.
Webster, P. and Griffiths, G. (1994). A novel method mean cell volume estimation. J. Microsc. 174, 85-92.
Wendland, B., Steece, K. E. and Emr, S. D. (1999). Yeast epsins contain an essential N-terminal ENTH domain, bind clathrin and are required for endocytosis. EMBO J. 18,4383 -4393.[Medline]
Woodward, R. and Gull, K. (1990). Timing of
nuclear and and kinetoplast DNA replication and early morphological events in
the cell cycle of Trypanosoma brucei. J. Cell Sci.
95, 49-57.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
A. Atrih, J. M. Richardson, A. R. Prescott, and M. A. J. Ferguson Trypanosoma brucei Glycoproteins Contain Novel Giant Poly-N-acetyllactosamine Carbohydrate Chains J. Biol. Chem., January 14, 2005; 280(2): 865 - 871. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||