|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
RESEARCH ARTICLE |
Wellcome Trust Laboratories for Molecular Parasitology, Imperial College
of Science, Technology and Medicine, Department of Biochemistry, Exhibition
Rd, London, SW7 2AY, UK
*
Author for correspondence (e-mail:
mfield{at}ic.ac.uk
)
Accepted April 5, 2000
| SUMMARY |
|---|
|
|
|---|
Key words: Rab11, Trypanosome, Recycling, Endosome, Flagellar pocket
| INTRODUCTION |
|---|
|
|
|---|
Endosomal endomembrane compartments can be viewed as being at the
crossroads of flux through the endocytic and secretory pathways (Lemmon and
Traub, 2000
). For example, in
S. cerevisiae, endosomal elements receive secretory traffic from
Golgi elements and endocytosed material from the cell surface (Vida et al.,
1993
; Mulholland et al.,
1999
). Cargo is sorted in
endosomes such that vacuolar destined proteins are routed to the late
endosomal prevacuolar compartment while internalised resident surface membrane
proteins may be recycled to the surface along with nascent plasma membrane
proteins delivered from the Golgi (Gerrard et al.,
2000
; Wiederkehr et al.,
2000
). Mammalian cells appear
to possess a more complex endosomal network. Endocytosed material initially
traffics to early endosomes, regions characterised by the presence of Rab5
(Bucci et al., 1992
), and may
be targeted to late endosomes and ultimately lysosomes, recycled through
Rab4-positive peripheral endosomal elements (Bottger et al., 1997) or recycled
through deeper, centriole-proximal Rab11-containing recycling endosomes
(Ullrich et al., 1996
).
Trypanosoma brucei is a parasitic protozoan with a digenetic life
cycle. The procyclic form (PCF) resides within the tsetse fly whereas the
bloodstream form (BSF) infects mammals and is exposed to immunological
recognition. BSF parasites have a surface coat comprised predominately of the
GPI-anchored variant surface glycoprotein (VSG; Ferguson,
1997
). Through antigenic
variation, antigenically distinct VSG isoforms are expressed throughout an
infection (Pays et al., 1994
),
ensuring that the host is unable to accumulate levels of anti-VSG antibody
sufficient to clear the infection. Large quantities of VSG are constitutively
internalised at a specialised region of the plasma membrane known as the
flagellar pocket (Duszenko and Seyfang,
1993
), the sole site of
endocytic membrane transport. The vast majority of internalised VSG is
recycled to the plasma membrane (Seyfang et al.,
1990
). IgM and IgG anti-VSG
antibodies may be generated faster than the VSG switch, but addition of
anti-VSG antibody in vitro results in internalisation and recycling of the
anti-VSG/VSG complexes; during this process the antibody is proteolytically
degraded, but the VSG is returned intact to the plasma membrane. Hence,
trafficking of VSG through the trypanosome endosomal system is likely to be
important in immune evasion (O'Beirne et al.,
1998
).
The ultrastructure of the endocytic network of T. brucei has been
described (Webster, 1989
;
Brickman et al., 1995
).
Following internalisation via coated pits at the flagellar pocket, endocytic
cargo is delivered to tubular structures termed collecting tubules, where
sorting occurs. Material destined for degradation (e.g. transferrin) is
targeted to lysosomes whereas recycling cargo (e.g. VSG) is returned to the
flagellar pocket. Whether these collecting tubules represent a homogenous
membrane population has not been determined. To gain insight into collecting
tubule organisation, VSG turnover and other endocytic mechanisms we are
characterising the trypanosome endocytic system at the molecular level.
Several constitutively expressed endosomal Rabs have been characterised,
including TbRAB5A and TbRAB5B, implicated as early endosomal, and TbRAB4,
potentially involved in a recycling pathway (Field et al.,
1998
). More recently we
reported on TbRAB31, localised to the trans Golgi complex, and which
may also have a role in recycling processes (Field et al.,
2000
). Here we describe a
developmentally regulated Rab (TbRAB11), which is implicated in the recycling
of two GPI-anchored proteins: VSG and the trypanosomal transferrin
receptor.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Northern analysis
Total RNA was isolated from 108 PCF and BSF parasites (Ausubel
et al., 1994
). RNA was resolved
through a denaturing formaldehyde gel (Parry and Alphey,
1994
), blotted onto nylon
membranes (Sambrook et al.,
1989
) and crosslinked using a
UV Stratalinker (Stratagene) and hybridised overnight with a probe generated
by the random priming method (Parry and Alphey,
1994
) using the full
TbRAB11 open reading frame (ORF) as a template. Membranes were washed
three times for 20 minutes in 0.2x SSC/0.1% SDS before exposure against
X-Ray film (Kodak).
Cloning and expression of TbRAB11
5' and 3' regions of a Rab11 homologue
(TbRAB11) were identified on sheared DNA clones in the TIGR T.
brucei database (www.tigr.org/tdb/mdb/tbdb/index.html). Primers to the
ends of the Rab11 homologue were used to amplify a product of
approximately 650 bp that was cloned into pCR-Script (Stratagene). Sequencing
of the product followed by BLAST analysis confirmed this gene as being highly
homologous to Rab11. The nucleotide sequence has been deposited at
GenBank, accession number AF152531. The TbRAB11 ORF was cloned into
the expression vector pGEX-2TK (Pharmacia) using the 5' primer Tb11XF,
which contained a BamHI site (GACGTGGGATCCATGGAAGACCTGAACCTT) and the
3' primer Tb11XB which contained an EcoRI site
(TCTGTCATGAATTCGTTAACAGCACCCGCCACT). The amplified product was cloned into the
expression vector. All constructs were verified by DNA sequencing with a 377
DNA sequencer (Perkin Elmer) using Dye Terminator chemistry.
Recombinant protein expression and production of antibodies
TbRAB11 was expressed as a GST-fusion protein from pGEX-2TK in E.
coli BL21 (Stratagene). Protein was purified on glutathione-sepharose 4B
(Pharmacia) and cleaved to release TbRAB11 by incubation at room temperature
with thrombin (New England Biolabs) for 30 minutes. Cleaved protein was
quantitated and verified by SDSPAGE followed by Coomassie staining. The
released Rab protein was used to raise polyclonal antibodies in mice and
rabbits using the MPL+TDM+CWS adjuvant system. 100 µg protein was
administered to the rabbit and 20 µg protein to each mouse every injection.
This regime was repeated six times in each case. Affinity purified antibodies
were isolated using recombinant protein coupled to CNBr-activiated-sepharose
4B (Pharmacia). Recombinant protein was bound to the beads according to the
manufacturers instructions and remaining reactive groups blocked with 1 M
ethanolamine, pH 8.0 for 2 hours at room temperature. The resin was
resuspended in 5 bed volumes of 10 mM Tris (pH 7.5) and transferred to a
Poly-Prep column (BioRad). The resin was successively washed with 10
bed-volumes 10 mM Tris (pH 7.5), 10 bed-volumes 100 mM triethylamine (pH 11.5)
and finally with 10 mM Tris (pH 7.5). Subsequent to loading, the column was
washed with 20 bed-volumes 10 mM Tris (pH 7.5) and 20 bed-volumes 500 mM NaCl,
10 mM Tris (pH 7.5). Acid-sensitive antibodies were eluted with 10 bed-volumes
of 100 mM glycine (pH 2.5). 1 ml fractions were collected directly onto 100
µl 1 M Tris (pH 8.0).
GTP hydrolysis assay
GTPase activity was determined as described (Foster et al.,
1996
) with modifications
(Field et al., 2000
).
GST-fusion protein was purified as above, omitting the thrombin cleavage and
verified by SDS-PAGE. Approximately 20 µg of protein was loaded with
[
-32P]GTP (10 µCi; 400 Ci/mmol; Amersham) in 50 mM
Tris-HCl (pH 7.5), 50 mM NaCl, 5 mM EDTA, 0.1 mM ethylene
glycol-bis(ß-aminoethyl)n,n,n,n-tetraacetic acid (EGTA), 0.1 mM
dithiothreitol (DTT), 10 mM ATP at 37°C for 10 minutes in a total volume
of 100 µl. Beads were washed three times at 4°C in buffer (50 mM
Tris-HCl pH 7.5, 20 mM MgCl2, 1 mM DTT and 1 mg/ml bovine serum
albumin (BSA)). Samples were resuspended in wash buffer prewarmed to 37°C.
Samples were taken and added to an equal volume of ice cold quench buffer (5
mM EDTA, 50 mM GTP, 50 mM GDP) and bound nucleotide eluted by incubation at
65°C for 5 minutes in elution buffer (1% SDS, 20 mM EDTA). Elutes were
spotted onto polyethyleneimine-cellulose plates (Merck) and resolved by thin
layer chromatography (TLC) in 0.75 M KH2PO4 (pH 3.4) and
visualised on a phosphorimager screen (Molecular Dynamics). Following
conversion of the data to TIFF, GDP/GTP ratios were calculated using NIH Image
v.1.59.
Immunochemistry
Trypanosome cell pellets (107 cells) were resuspended in 100
µl boiling sample buffer and resolved by SDS-PAGE. Proteins were
electrophoretically transferred to nitrocellulose membranes by semidry
electrophoresis under standard conditions for 40 minutes. Equivalence of
loading was verified by Ponceau-S (Sigma) staining. Nonspecific binding sites
were blocked in BLOTTO (0.2% Tween-20, 5% freeze dried milk, phosphate
buffered saline pH7.6 (PBS)). Antibodies were also diluted in BLOTTO. Rabbit
or mouse anti-TbRAB11 were used at 1:1000 and 1:100, respectively, and
detected with mouse anti-rabbit horseradish peroxidase conjugate (Sigma) or
goat anti-mouse horseradish peroxidase conjugate (Sigma). Bound conjugate was
detected with ECL reagent.
Immunofluorescence
Indirect immunofluorescence microscopy was performed as previously
described (Field et al.,
1998
). Antibodies were used at
the following dilutions: rabbit anti-TbRAB11 1:500; mouse anti-TbRAB11 1:50;
rabbit anti-TbRAB5A 1:200; rabbit anti-TbCLH 1:1000; mouse monoclonal anti-p67
1:1000 (gift of J. Bangs, Madison); mouse monoclonal BB4 1:1 (gift of K. Gull,
Manchester), rabbit anti-trypanosome transferrin receptor 1:1000 (gift of P.
Borst, Amsterdam). Secondary antibodies, anti-rabbit Cy3 (Sigma) and
anti-mouse FITC (Sigma), were used according to the manufacturers
instructions. The trypanosomal Golgi complex was stained using BODIPY-TR
ceramide (Molecular probes) as previously described (Denny et al.,
2000
; Field et al.,
2000
). Cells were observed
either on a Nikon Microphot-FX epifluorescent microscope attached to a
Photometrics CH350-CCD camera or with a Laser Scanning Microscope 510 (Zeiss).
Images were false-coloured and assembled using Adobe PhotoShop.
FITC-concanavalin A uptake
Concanavalin A (ConA) uptake was monitored as described, with modifications
(Brickman et al., 1995
). Uptake
was followed by incubating 107 BSF parasites in 1 ml of media
containing 100 µg FITC-ConA (Vector Labs). For pulse-chase experiments,
parasites were harvested at mid-log phase, washed once and resuspended at a
density of 108 parasites/ml in serum free media pre-equilibrated at
4°C. 100 µg of ConA was added per 107 cells and parasites
incubated for 10 minutes. Subsequently, parasites were washed in serum-free
media, resuspended in media pre-equilibrated at the desired temperature and
incubated for 30 minutes. Biotinylated-ConA (Vector Labs) was used for
lysosomal visualisation and FITC-ConA for all other assays.
Anti-VSG uptake
All manipulations were conducted using HMI9/1% BSA/protease inhibitors
(Mini Complete, Sigma). BSF parasites expressing VSG 221 were cultured in
media for 1 hour at 107 parasites/ml. Rabbit anti-VSG 221 (gift of
A. Pal) was added at 10 µg/ml and cells incubated at 37°C for 1 hour.
After incubation, cells were washed twice in PBS, fixed for microscopy and
co-stained using mouse anti-TbRAB11 antibodies. Rabbit and mouse antibodies
were visualised as described above.
Bioinformatics
BLAST searches were conducted at NCBI (www.ncbi.nlm.nih.gov/blast) and the
T. brucei database at TIGR (www.tigr.org/tdb/mdb/tbdb/index.html).
Sequence alignments were performed using ClustalX and presented as SeqVu 1.1
documents. Phylogenetic reconstruction was done using PAUP release 4.0.
| RESULTS |
|---|
|
|
|---|
|
TbRAB11 is developmentally regulated
We have information of the expression profile of six GTPases in T.
brucei, all of which are constitutively expressed (Field et al.,
1995
; Field and Field
1997
; Field et al.,
1998
; Field et al.,
1999
). By contrast, northern
blot analysis using full length TbRAB11 as a probe revealed a
moderately abundant transcript at approximately 3 kb in the BSF stage, which
was barely detectable in the PCF stage
(Fig. 2A), suggesting that
TbRAB11 expression is developmentally regulated at the mRNA level. As
trypanosome gene expression is predominantly controlled at the
post-transcriptional level, we extended analysis to the protein level. Rabbit
polyclonal antibodies raised against recombinant TbRAB11 recognised a single
band at approximately 24 kDa that was significantly more abundant in BSF
lysates compared with PCF (Fig.
2B). Equivalent loading of PCF and BSF lysates was verified by
Ponceau S staining of the blot (data not shown). Reactivity was completely
abolished by preincubation of the antibody with recombinant TbRAB11 confirming
specificity (data not shown).
|
Several GTPase-deficient Rab proteins have been identified in T.
brucei (Field et al.,
2000
; T.R.J. and M.C.F.,
unpublished), hence we wished to determine directly if TbRAB11 was an
authentic GTPase. We compared the GTPase activity of recombinant GST-TbRAB11
fusion protein expressed in E. coli to that of GST-TbRAB2, a well
characterised trypanosome GTPase (Field et al.,
1999
). GST-TbRAB11 bound
levels of GTP similar to GST-TbRAB2, whereas the GTP hydrolytic rate of
GST-TbRAB11 was approximately twofold lower than GST-TbRAB2
(Fig. 2C,D) and are in
agreement with the conserved nucleotide binding motifs in the TbRAB11
sequence.
Subcellular localisation of TbRAB11
Developmentally regulated TbRAB11 expression suggests that the TbRAB11
pathway is more active in BSF, whereas all sequence data place TbRAB11 as
being involved in endosomal processes, these are confined to the region
between the nucleus and kinetoplast (Brickman et al.,
1995
; Field et al.,
1998
). By immunofluorescent
microscopy, TbRAB11 localised to one or two distinct spots closely adjacent to
the kinetoplast in PCFs, with extremely well conserved morphology in all cells
analysed (Fig. 3A,B,C;
Fig. 4). By contrast, in BSF
parasites, the TbRAB11 staining was significantly more extensive
(Fig. 3D,E,F), and although
some of the staining retained a position adjacent to the kinetoplast in BSFs
the stain was far more variable between cells, suggesting a more dynamic
TbRAB11 structure, and spread towards the posterior face of the nucleus.
|
|
TbRAB11 is positioned close to the basal body, a microtubule organising
centre in trypanosomatids (Gull,
1999
), as revealed by
co-staining with basal body-specific monoclonal antibody BB4. The association
was maintained throughout the cell cycle
(Fig. 4) and at all stages of
the mitotic process the TbRAB11 loci were closely adjacent to the basal body
and kinetoplast (Fig. 4G-I). Coordinate regulation of endomembrane structures and the basal
body/kinetoplast is a common feature in trypanosomes, and is clearly seen for
early endosomes and the Golgi stack (Field et al.,
1998
; Field et al.,
2000
) and is potentially a
mechanism for faithful organelle segregation. Significantly, juxtaposition of
TbRAB11 with the basal body is reminiscent of the situation observed in
mammalian cells for Rab11, which localises predominately to the pericentriolar
recycling endosome in nonpolarised cells (Ullrich et al.,
1996
) and to the apical
recycling endosome in polarised MDCK cells (Casanova et al.,
1999
), structures that are
located close to the centriole.
TbRAB11 defines a new compartment of the trypanosome endosomal
system
The position of TbRAB11 between the kinetoplast and nucleus is consistent
with an endosomal function. To determine whether TbRAB11 localised to a
previously characterised structure we compared TbRAB11 to a variety of
established trypanosomal organellar markers. First, we looked at lysosomes,
using antibodies to p67, a membrane protein predominately localised to
lysosomes (Kelley et al.,
1999
). TbRAB11 was close to,
but distinct from, the bulk of p67-positive membranes, with a limited
colocalisation to fainter p67 staining membranes
(Fig. 5A-D). This latter
location probably results from p67 being present throughout the trypanosomal
secretory and endosomal network while being concentrated in the lysosomes
(Kelley et al., 1999
). A
second test for lysosomal location was conducted using biotinylated ConA,
which binds to flagellar pocket glycoproteins and is subsequently trafficked
through the cell to lysosomes. ConA chased at 37°C for 30 minutes is
entirely lysosomal (Brickman et al.,
1995
). Using this procedure,
TbRAB11 and lysosomal membranes are clearly distinct, despite the two
organelles being closely associated (Fig.
5E,H). To determine whether TbRAB11 associated with Golgi
membranes, BSF cells were co-stained for TbRAB11 and BODIPY-TR ceramide (Field
et al., 2000
); TbRAB11 was
distinct from the Golgi stack, with TbRAB11 more posterior, extending towards
the kinetoplast (Fig.
5I-L).
|
We next compared TbRAB11 with early endosomes (TbRAB5A) and clathrin
(TbCLH). Co-staining BSF parasites for TbRAB5A and TbRAB11 followed by
confocal microscopy revealed two endomembrane organelles that were
predominately distinct but tightly juxtaposed, with restricted overlap at the
margins of each compartment (Fig.
6A-C). Interestingly, in mammalian cells, Rab11 and Rab5A
compartments rarely juxtapose because Rab5A is found at the periphery and
Rab11 is situated more deeply, closer to the centrosome (Sonnichsen et al.,
2000
). Hence in T.
brucei the relationship of Rab11 and Rab5 is more intimate. Recently we
cloned the T. brucei homologue of the clathrin heavy chain gene
(TbCLH; Morgan et al.,
2001
). Trypanosome clathrin is
located to regions abutting the flagellar pocket and to predicted endosomal
regions extending between the nucleus and kinetoplast. The majority of the
TbRAB11 structures also contained clathrin, which may reflect an involvement
in early endocytic events occurring at the flagellar pocket
(Fig. 6D-F) or clathrin being
situated on endosomal membranes involved in trafficking events to lysosomal
regions and/or recycling events.
|
To discriminate between early and late endosomal compartments, FITC-ConA
was internalised by BSF parasites for 15 seconds or 2 minutes and parasites
stained for TbRAB11 or TbCLH. After 15 seconds FITC-ConA localised to a
punctate spot marking the flagellar pocket with clathrin in close contact
(Fig. 7G-I). By contrast, the
majority of TbRAB11 was more distal from the ConA staining. Following two
minutes of ConA internalisation the ConA has migrated to a more anterior
position with substantial colocalisation with clathrin in both the flagellar
pocket and more anterior regions (Fig.
7J-L). These structures correspond, at least in part, to
previously described collecting tubules (Brickman et al.,
1995
). However, TbRAB11 still
did not colocalise with FITC-ConA after 2 minutes of lectin uptake
(Fig. 7D-F). Therefore,
although TbRAB11 did not associate directly with lectin-containing endosomal
compartments, the close juxtaposition is suggestive of interaction with these
membrane systems.
|
TbRAB11 is associated with collecting tubules, TbRAB5A-positive
structures
To determine more clearly the nature of the TbRAB11 compartment, we used
defined temperature blockade to specifically label regions of the trypanosome
endosomal system (Brickman et al.,
1995
). BSF cells were loaded
with ConA on ice and transferred to media equilibrated at 4°C or 12°C.
The low temperature prevents ConA from exiting the flagellar pocket, but at
12°C ConA migrates into, and becomes trapped within, the collecting
tubules (Brickman et al.,
1995
). Staining with
anti-TbRAB11 after 4°C chase (Fig.
8A-C) indicated that TbRAB11 was situated away from the flagellar
pocket, but after a 12°C chase, the ConA had migrated to endosomal regions
juxtaposed to TbRAB11 (Fig.
8D-F). By contrast, after a 12°C chase the vast majority of
the anti-TbRAB5A and ConA overlapped (Fig.
8G-L), which was not observed at 4°C. Hence, TbRAB5A localises
to the collecting tubules and TbRAB11 is present on an endomembrane
compartment abutting these structures.
|
TbRAB11 membranes contain recycling cargo
The above data indicate that TbRAB11 is localised to the trypanosome
endosomal system, intimately related with the collecting tubules and
potentially has a role in recycling. To extend this hypothesis, we chose to
determine whether the TbRAB11 compartment contained recycling cargo,
specifically the trypanosomal transferrin receptor (ESAG6/7; Salmon et al.,
1994
; Kabiri and Steverding,
2000
) and internalised
anti-VSG (O'Beirne et al.,
1998
).
By confocal and epifluorescence, ESAG6/7 and TbRAB11 partially colocalise, indicating that this recycling receptor passes through the TbRAB11 compartment (Fig. 9). As TbRAB11 does not appear to be located on a compartment en route to the lysosome, we considered that it may also be involved in recycling of VSG. Internalisation of rabbit anti-VSG for 1 hour clearly demonstrated that the anti-VSG was partially localised within the TbRAB11 compartment, in addition to other regions of the cell (Fig. 10A-F). Hence, the presence of two known recycling markers, absence of lysosomal targeted cargo, close juxtaposition with the TbRAB5A collecting tubules and a high degree of sequence conservation with mammalian Rab11, all suggest that the TbRAB11 compartment is involved in recycling of trypanosomal surface proteins, and that the Rab protein has a role in regulating this process.
|
|
| DISCUSSION |
|---|
|
|
|---|
TbRAB11 localises to a compartment between the kinetoplast and posterior
face of the nucleus. To define this compartment in more detail, BSF parasites
were co-stained for TbRAB11 and a panel of established organellar markers.
TbRAB11 was distanced from the Golgi stack, a location distinct to TbRAB31, a
close homologue. Hence, although these two proteins may mediate closely
integrated transport events, they clearly have disparate functions.
Additionally TbRAB11 was posterior to p67-positive lysosomal regions, tightly
juxtaposed to TbRAB5A collecting tubule elements and overlapped with the
extensive clathrin membrane networks. Further, fluorescent ConA did not
colocalise with TbRAB11, suggesting that the Rab is not associated directly
with early endocytic membranes, despite colocalisation with TbCLH. Under
conditions that accumulate ConA in the collecting tubules (Brickman et al.,
1995
) a close juxtaposition of
part of the ConA-containing compartments with TbRAB11 membranes was observed,
indicating that the TbRAB11 compartment is directly apposed with collecting
tubule elements. Colocalisation with TbCLH suggests TbRAB11 may be involved
with a clathrin dependent process (e.g. early endocytic cargo processing or
transport following a trans-Golgi sorting step) but further work will be
required to determine if these two proteins collaborate in the same process.
These data indicate that TbRAB11 is associated with the endosomal system, but
does not appear to be involved with early endocytic events or transport
towards the lysosome. Based on the sequence, we considered that TbRAB11 was
most likely to mediate a recycling process.
The relationship of the TbRAB11 compartment with recycling pathways was
examined. Internalisation of anti-VSG antibody by BSF parasites revealed a
tubular network of structures, which partially represents early endosomal
regions, defined by TbRAB5A (B. Hall and M.C.F., unpublished), and presumably
additional compartments involved in post-endocytic processing of internalised
antibody. Significantly, we found TbRAB11 localised to a subdomain of the
VSG-containing region. As TbRAB11 is not involved in early endocytic processes
this subdomain most likely represents a compartment involved in returning the
antibody to the flagellar pocket. ESAG6/7 (Salmon et al.,
1994
) is the trypanosome
transferrin receptor, and recycles through the endosomal system (Kabiri and
Steverding, 2000
). By confocal
microscopy ESAG6/7 localised to tubular-like structures situated between the
flagellar pocket and nucleus, part of which colocalised with TbRAB11. This
subpopulation of ESAG6/7 cannot be in the early endosome and hence likely
represents recycling cargo.
VSG is the major surface coat protein in BSF T. brucei (Ferguson,
1997
) and a vital component of
the trypanosome immune evasion system. Additional virulence mechanisms also
operate; most relevant here is trafficking of VSG and bound antibody through
the trypanosomal endocytic/recycling system such that VSG is returned intact
to the cell surface while antibodies are proteolysed and released into the
medium (O'Beirne et al.,
1998
), resulting in cleaning
of surface immunoglobulin from the parasite. In addition, many observations
have shown that the BSF form of the parasite has a far greater level of
endocytosis than the PCF (Overath et al.,
1997
), but this is unlikely to
be simply based on nutrient requirement, as the generation times of the insect
and mammalian forms of T. brucei are not vastly different. Although
PCF parasites endocytose material (Overath et al.,
1997
) and can recycle cell
surface receptors such as CRAM (Liu et al.,
2000
), these processes occur
at a much reduced rate compared with the BSF stage. However, a need to rapidly
clear immune complexes or antibody from the surface is clearly restricted to
BSFs, and may represent a primary reason for the rapid endocytosis in this
form.
Our evidence indicates that TbRAB11 defines a compartment associated with
the early endosomes, and which contains two known recycling proteins. Based on
sequence homology and other data, we suggest that TbRAB11 is most likely
involved in recycling of VSG and ESAG6/7, and possibly other trypanosomal
proteins. Importantly, both VSG and ESAG6/7 are anchored to the membrane via a
GPI lipid, and hence we have no information at present on transmembrane
proteins. An important feature of TbRAB11 is that it is strongly
developmentally regulated. So far, this is a unique feature for a trypanosomal
Rab protein, and is good evidence that TbRAB11 plays a more pronounced role in
mediating BSF transport pathways than in the PCF, processes that are likely to
be BSF specific. Several proteins involved in protein transport are
upregulated in the BSF stage compared with the PCF; for example BiP is
upregulated threefold, suggested to reflect secretory pathway requirements
(Bangs et al., 1993
), and the
clathrin heavy chain, proposed to be important for control of major endocytic
processes, shows a strong degree of developmental control (G.W.M. et al.,
unpublished). Increased expression of TbRAB11 may facilitate the antibody
induced aggregation/disaggregation by assisting efficient trafficking of
VSG/anti-VSG complexes through the processing endosomal compartments. The
TbRAB11 compartment therefore potentially represents a developmentally
regulated organelle dedicated principally to BSF recycling processes, and as
such may contribute importantly to the survival of T. brucei within
the mammalian host.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. and Struhl, K. (1994). Current Protocols in Molecular Biology. Wiley Interscience, New York.
Bangs, J. D., Uyetake, L., Brickman, M. J., Balber, A. E. and Boothroyd, J. C. (1993). Molecular cloning and cellular localization of a BiP homologue in Trypanosoma brucei. Divergent ER retention signals in a lower eukaryote. J. Cell Sci. 105,1101 -1113.[Abstract]
Bottger, G., Nagelkerken, B. and van der Sluijs, P.
(1996). Rab4 and Rab7 define distinct nonoverlapping endosomal
compartments. J. Biol. Chem.
271,29191
-29197.
Brennwald, P. and Novick, P. (1993). Interactions of three domains distinguishing the Ras-related GTP-binding proteins Ypt1 and Sec4. Nature, 362,560 -563.[Medline]
Brickman, M. J., Cook, J. M. and Balber, A. E. (1995). Low temperature reversibly inhibits transport from tubular endosomes to a perinuclear, acidic compartment in African trypanosomes. J. Cell Sci. 108,3611 -2361.[Abstract]
Bucci, C., Parton, R. G., Mather, I. H., Stunnenberg, H., Simons, K., Hoflack, B. and Zerial, M. (1992). The small GTPase rab5 functions as a regulatory factor in the early endocytic pathway. Cell 70,715 -728.[Medline]
Casanova, J. E., Wang, X., Kumar, R., Bhartur, S. G., Navarre,
J., Woodrum, J. E., Altschuler, Y., Ray, G. S. and Goldenring, J. R.
(1999). Association of Rab25 and Rab11 with the apical recycling
system of polarized Madin-Darby canine kidney cells. Mol. Biol.
Cell 10,47
-61.
Chavrier, P. and Goud, B. (1999). The role of ARF and Rab GTPases in membrane transport. Curr. Opin. Cell Biol. 11,466 -475.[Medline]
Chen, W., Feng, Y., Chen, D. and Wandinger-Ness, A.
(1998). Rab11 is required for trans-Golgi network-to-plasma
membrane transport and a preferential target for GDP dissociation inhibitor.
Mol. Biol. Cell 9,3241
-3257.
Denny, P. W., Gokool, S., Russell, D. G., Field, M. C. and
Smith, D. F. (2000). Acylation-dependent protein export in
Leishmania. J. Biol. Chem.
275,11017
-21105.
Duszenko, M. and Seyfang, A. (1993) Membrane Traffic in Protozoa. In Advances in Cell and Molecular Biology of Membranes. Vol. 2B, pp.227 -258, JAI Press.
Echard, A., Jollivet, F., Martinez, O., Lacapere, J. J.,
Rousselet, A., Janoueix-Lerosey, I. and Goud, B. (1998).
Interaction of a Golgi-associated kinesin-like protein with Rab6.
Science 279,580
-585.
Ferguson, M. A. (1997). The surface glycoconjugates of trypanosomatid parasites. Philos. Trans. R. Soc. Lond. B Biol. Sci. 352,1295 -1302.[Medline]
Ferro-Novick, S. and Novick, P. (1993). The role of GTP-binding proteins in transport along the exocytic pathway. Annu. Rev. Cell Biol. 9,575 -599.
Field, M. C., Field, H. and Boothroyd, J. C. (1995). A homologue of the nuclear GTPase Ran/TC4 from Trypanosoma brucei. Mol. Biochem. Parasitol. 69,131 -134.[Medline]
Field, H. and Field, M. C. (1997). Tandem
duplication of rab genes followed by sequence divergence and acquisition of
distinct functions in Trypanosoma brucei. J. Biol.
Chem. 272,10498
-10505.
Field, H., Farjah, M., Pal, A., Gull, K. and Field, M. C.
(1998). Complexity of trypanosomatid endocytosis pathways
revealed by Rab4 and Rab5 isoforms in Trypanosoma brucei. J. Biol.
Chem. 273,32102
-32110.
Field, H., Ali, B. R., Sherwin, T., Gull, K., Croft, S. L. Field, M. C. (1999). TbRAB2, a marker for the endoplasmic reticulum of Trypanosoma brucei, localises to the ERGIC in mammalian cells. J. Cell Sci. 112,147 -156.[Abstract]
Field, H., Sherwin, T., Smith, A. C., Gull, K. and Field, M. C. (2000). Cell-cycle and developmental regulation of TbRAB31 localisation, a GTP-locked Rab protein from Trypanosoma brucei. Mol. Biochem. Parasitol. 106, 21-35.[Medline]
Foster, R., Hu, K.-Q., Lu, Y., Nolan, K. M., Thissen, J. and Settleman, J. (1996). Identification of a novel human Rho protein with unusual properties: GTPase deficiency and in vivo farnesylation. Mol. Biol. Cell. 16,2689 -2699.
Gerrard, S. R., Bryant, N. J. and Stevens, T. H.
(2000). VPS21 controls entry of endocytosed and biosynthetic
proteins into the yeast prevacuolar compartment. Mol. Biol.
Cell 11,613
-626.
Gull, K. (1999). The cytoskeleton of trypanosomatid parasites. Annu. Rev. Microbiol. 53,629 -655.[Medline]
Jedd, G., Mulholland, J. and Segev, N. (1997).
Two new Ypt GTPases are required for exit from the yeast trans-Golgi
compartment. J. Cell Biol.
137,563
-580.
Kabiri, M. and Steverding, D. (2000) Studies on the recycling of the transferrin receptor in Trypanosoma brucei using an inducible gene expression system. Eur. J. Biochem. 267,3309 -3314.[Medline]
Kelley, R. J., Alexander, D. L., Cowan, C., Balber, A. E. and Bangs, J. D. (1999). Molecular cloning of p67, a lysosomal membrane glycoprotein from Trypanosoma brucei. Mol. Biochem. Parasitol. 98,17 -28.[Medline]
Lemmon, S. K. and Traub, L. M. (2000). Sorting in the endosomal system in yeast and animal cells. Curr. Opin. Cell Biol. 12,457 -466.[Medline]
Liu, J., Qiao, X., Du, D. and Lee, M. G.
(2000). Receptor-mediated endocytosis in the procyclic form of
Trypanosoma brucei. J. Biol. Chem.
275,12032
-12040
Lupashin, V. V. and Waters, M. G. (1997).
t-SNARE activation through transient interaction with a rab-like guanosine
triphosphatase. Science
276,1255
-1258.
Mauricio de Mendonca, S. M., Nepomuceno da Silva, J. L., Cunha e-Silva, N., de Souza, W. and Gazos Lopes, U. (2000). Characterisation of a Rab11 homolog in Trypanosoma cruzi.Gene 243,179 -185.[Medline]
Morgan, G. W., Allen, C. L., Jeffries, T. R., Hollinshead, M. and Field, M. C. (2001). Developmental and morphological regulation of clathrin-mediated endocytosis in Trypanosoma brucei.J. Cell Sci. 114,2605 -2615.
Mulholland, J., Konopka, J., Singer-Kruger, B., Zerial, M. and
Botstein, D. (1999). Visualisation of receptor-mediated
endocytosis in yeast. Mol. Biol. Cell
10,799
-817.
Nuoffer, C. and Balch, W. E. (1994). GTPases: multifunctional molecular switches regulating intracellular traffic. Annu. Rev. Biochem. 63,949 -990.[Medline]
O'Beirne, C., Lowry, C. M. and Voorheis, H. P. (1998). Both IgM and IgG anti-VSG antibodies initiate a cycle of aggregation-disaggregation of bloodstream forms of Trypanosoma brucei without damage to the parasite. Mol. Biochem. Parasitol. 91,165 -193.[Medline]
Overath, P. Stierhof, Y. and Wiese, M. (1997). Endocytosis and secretion in trypanosomatid parasites tumultuous traffic in a pocket. Trends Cell Biol. 7, 27-33.
Parry, H. D. and Alphey L. (1994). Making nucleic acid probes. In DNA Cloning 1: Core Techniques (ed. D. M. Glover and B. D. Homes), pp. 121-163, IRL Press.
Pays, E., Vanhamme, L. and Berberof, M. (1994). Genetic controls for the expression of surface antigens in African trypanosomes. Annu. Rev. Microbiol. 48, 25-52.[Medline]
Salmon, D., Geuskens, M., Hanocq, F., Hanocq-Quertier, J., Nolan, D., Rubel, L. and Pays, E. (1994). A novel heterodimeric transferrin receptor encoded by a pair of VSG expression site-associated genes in T. brucei. Cell 78, 75-86.[Medline]
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning A Laboratory Manual. 2nd edn. Cold Spring Harbour Laboratory Press, Cold Spring Harbor.
Seyfang, A., Mecke, D. and Duszenko, M. (1990) Degradation, recycling, and shedding of Trypanosoma brucei variant surface glycoprotein. J. Protozool. 37,546 -552.[Medline]
Sonnichsen, B., De Renzis, S., Nielsen, E., Rietdorf, J. and
Zerial, M. (2000). Distinct membrane domains on endosomes in
the recycling pathway visualised by multicolour imaging of Rab4, Rab5, and
Rab11. J. Cell Biol.
149,901
-914.
Ullrich, O., Reinsch, S., Urbe, S., Zerial, M. and Parton, R.
G. (1996). Rab11 regulates recycling through the
pericentriolar recycling endosome. J. Cell Biol.
135,913
-924.
Ungermann, C. Sato, K. and Wickner, W. (1998). Defining the functions of trans-SNARE pairs. Nature 396,543 -548.[Medline]
Vida, T. A., Huyer, G. and Emr, S. D. (1993).
Yeast vacuolar proenzymes are sorted in the late Golgi complex and transported
to the vacuole via a prevacuolar endosome-like compartment. J. Cell
Biol. 121,1245
-1256.
Webster, P. (1989). Endocytosis by African trypanosomes. I. Three-dimensional structure of the endocytic organelles in Trypanosoma brucei and T. congolense. Eur. J. Cell Biol. 49,295 -302.[Medline]
Wiederkehr, A., Avaro, S., Prescianotto-Baschong, C.,
Haguenauer-Tsapis, R. and Riezman, H. (2000). The F-box
protein Rcy1p is involved in endocytic membrane traffic and recycling out of
an early endosome in Saccharomyces cerevisiae. J. Cell
Biol. 149,397
-410.
Wilcke, M., Johannes, L., Galli, T., Mayau, V., Goud, B. and
Salamero, J. (2000). Rab11 regulates the compartmentalization
of early endosomes required for efficient transport from early endosomes to
the trans-golgi network. J. Cell Biol.
151,1207
-1220.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||