|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
RESEARCH ARTICLE |

1
Cell Cycle Control Laboratory, Swiss Institute for Experimental Cancer
Research (ISREC), Chemin des Boveresses 155, 1066 Epalinges, Switzerland
2
Instituto de Microbiologia Bioquimica, CSIC/Universidad de Salamanca, Edificio
Departamental, Campus Miguel de Unamuno, 37007 Salamanca, Spain
*
These authors contributed equally to this paper
Author for correspondence (e-mail:
viesturs.simanis{at}isrec.unil.ch
)
Accepted April 14, 2001
| SUMMARY |
|---|
|
|
|---|
Key words: Mitosis, Cytokinesis, Phosphatase, Mitotic exit
| INTRODUCTION |
|---|
|
|
|---|
Release of Cdc14p from the nucleolus, and exit from mitosis requires the
activity of the mitotic exit network (MEN) proteins (Visintin et al.,
1999
). Loss-of-function MEN
mutants arrest at the end of mitosis with a phenotype similar to that of
cdc14 mutants. Increased expression of CDC14 can rescue MEN
mutants, but not vice-versa, leading to the suggestion that the essential
function of the MEN is to mediate release of Cdc14p from the nucleolus
(Jaspersen et al., 1998
;
Visintin et al., 1999
).
Functional homologues of Cdc14p have been identified in higher eukaryotes,
although their role remains enigmatic (Li et al.,
1997
).
In the fission yeast Schizosaccharomyces pombe, the orthologues of
the MEN genes control the onset of septum formation, and are collectively
referred to as the septation initiation network (SIN) (Balasubramanian et al.,
2000
; Le Goff et al.,
1999a
; Sawin,
2000
). Activation of the spg1p
GTPase switch is central to signalling the onset of septum formation, which
also involves the concerted action of four protein kinases (cdc7p, sid1p,
sid2p and plo1p); cdc14p, which binds to sid1p; mob1p, which binds to sid2p;
and sid4p, which acts as a scaffold for localisation of these proteins to the
spindle pole body. (Note that fission yeast cdc14p bears no structural
similarity to its S. cerevisiae namesake.) Cdc11p encodes the fission
yeast orthologue of the S. cerevisiae nud1 gene product (A. Krapp and
V.S., unpublished). Mutants defective in SIN signalling make a medial F-actin
ring at the onset of mitosis to mark the division site but do not make a
septum at the end of mitosis, becoming elongated and multinucleated (Chang and
Gould, 2000
; Fankhauser and
Simanis, 1993
; Fankhauser and
Simanis, 1994
; Guertin et al.,
2000
; Hou et al.,
2000
; Nurse et al.,
1976
; Salimova et al.,
2000
; Schmidt et al.,
1997
; Sparks et al.,
1999
). Failure to turn off SIN
signalling at the end of mitosis results in multiple rounds of septum
formation without cell cleavage (Cerutti and Simanis,
1999
; Minet et al.,
1979
; Ohkura et al.,
1995
; Schmidt et al.,
1997
; Song et al.,
1996
). Signalling via the SIN
is negatively effected by a two-component GTPase-activating protein comprised
of the products of the byr4 and cdc16 genes (Furge et al.,
1998
). Both genes are
essential (Fankhauser et al.,
1993
; Song et al.,
1996
). Loss of cdc16p function
gives rise to two kinds of septated cell, depending upon the cell cycle stage
of the inactivation: type I cells, which are binucleate, and undergo multiple
rounds of septum formation after mitosis, and type II, which are mononucleate,
and probably result from inactivation of cdc16p in G1 (Minet et
al., 1979
). The ultimate
target of the SIN remains enigmatic. However, the budding yeast paradigm
suggested an attractive hypothesis, which we have tested, that it might be a
phosphoprotein phosphatase analogous to Cdc14p. In this paper, we present the
characterisation of flp1, a fission yeast orthologue of the S.
cerevisiae CDC14 gene. Our data indicate that the
flp1+ gene performs a different role in cell cycle
progression to that of S. cerevisiae Cdc14p.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Oligonucleotides used for cloning of the flp1+
gene and construction of flp1-containing plasmids
The full ORF was amplified by PCR from a genomic DNA library in pUR19
(Barbet et al., 1992
), digested
with SmaI and cloned into the SmaI sites of pDW232 and pREP
vectors. Primers used for amplification: forward,
ACTGCCCCGGGTTCGCAATTACTTGTCTGATGGA; reverse,
GCTCGCCCGGGAACCAGTAATTACAGGTTTATTAAG.
The flp1 null and C-terminally tagged (GFP and 3HA) strains were constructed by direct chromosome integration of PCR fragments generated using plasmid pFA6a-kanMX6 as a template. Forward primer for deletion: CCACCAACACCCAGGTACACAATTTAGAACTCAACCATTACGGGTTTGACGAATATAGACGAGATTCGCAATTACTTGTCTGCGGATCCCCGGGTTAATTAA. Forward primer for tagging: GTGTTAGCATGTCATCACTTAACAATACTTCTAATGGCCGTGTTGCTAAACCTAAGCCTTCTAAAAGCCGGCTAATTTCTCGGATCCCCGGGTTAATTAA. Reverse primer for tagging and deletion GGTGCGCTAAATCAGGGAATATTTGTAAAGTTAATTAATGAAAAATTATGCAGGGTTGACACAGTATAATTCAAAGTTAGTGAATTCGAGCTCGTTTAAAC.
PCR fragments were gel-purified and introduced into a leu1-32 h- strain following the protocol described previously (Bähler et al., 1998). Transformants were selected on YE G418 plates (100 mg/l). Correct integration was verified by PCR and Southern hybridization for the deletion and by PCR and western blotting for tagged strains.
For creation of flp1p (C286S) the following pair of oligonucleotides were used for PCR amplification of the gene: ATTGCTGTTCATTCTAAAGCAGGGCTC, GAGCCCTGCTTTAGAATGAACAGCAAT. The presence of the desired mutation was verified by sequencing.
Antisera and tagged strains
Antisera and tagged strains permitting detection of cdc15, cdc7, spg1,
cdc14, sid1, sid2, sid4, mob1 and ste9 have been described
previously (Blanco et al.,
2000
; Chang and Gould,
2000
; Fankhauser et al.,
1995
; Fankhauser and Simanis,
1994
; Guertin et al.,
2000
; Hou et al.,
2000
; Moreno et al.,
1990
; Salimova et al.,
2000
; Sohrmann et al.,
1996
; Sohrmann et al.,
1998
; Sparks et al.,
1999
). Rabbit antiserum
against S. cerevisiae nop1p (fibrillarin) was a gift from Susan
Gasser (University of Geneva).
Microscopy, flow cytometry and determination of cell number,
septation and mitotic indices
Approximately 107 cells were collected by centrifugation, washed
once with water, fixed in 70% ethanol and processed for flow cytometry or DAPI
staining, as described previously (Moreno et al.,
1991
). A Becton-Dickinson
FACScan was used for flow cytometry. To estimate the proportion of
G1 cells we determined the percentage of cells with a DNA content
less than a value midway between 1C and 2C. The mitotic index was determined
by counting the percentage of anaphase cells (cells with two nuclei and
without a septum) after DAPI staining. The septation index was determined by
counting the percentage of cells with septum after calcofluor staining. Cell
number was determined using a Casy® cell number counter. DAPI-Calcofluor
staining, and staining for F-actin and tubulin staining were done as described
previously (Balasubramanian et al.,
1997
; Hagan and Hyams,
1988
; Marks et al.,
1986
; Moreno et al.,
1991
). For examination of
GFP-tagged proteins in living cells, TILLvisION software (v3.3; TILL Photonics
GmBH) was used to analyse data captured with an IMAGO CCD camera mounted on an
Olympus IX70 microscope. Deconvoultion was performed with BitPlane software.
Images were assembled in Adobe PhotoShop 5.5 and PowerPoint 97. For
immunofluorescence of flp1p-GFP, cells were fixed and processed as previously
described (Salimova et al.,
2000
).
Immunoprecipitations and western blot analysis
Protein extracts were prepared from 3-5x108 cells in
exponential phase, that had been collected by centrifugation and frozen on dry
ice. All subsequent manipulations were done on ice or in the cold room
(4°C). For immunoprecipitation, soluble protein extracts were prepared by
vortexing with glass beads in HEN buffer (50 mM Hepes pH 8.0; 150 mM NaCl; 5
mM EDTA; 1 mM EGTA; 50 mM ß-glycerophosphate with inhibitors: 0.1 mM
sodium orthovanadate, 50 µg/ml leupeptin, 1% aprotinin; 1 mM DTT; 1 mM
PMSF). Beads were washed by brief vortexing in the same buffer containing 1%
NP-40. Cell extracts were clarified by two successive centrifugations. Protein
concentration was measured using Bradford assay (BioRad). For each
immunoprecipitation, 2-3 mg of soluble protein was incubated overnight with 10
µl of either 9E10 or 12CA5 monoclonal antibodies covalently coupled to the
sepharose-Protein G beads (Sigma; P3296) (
2 µg of Ab). Beads were
washed three times with 1 ml of HEN-NP-40 buffer (by pelleting in a microfuge
for 5 seconds), resuspended in FRB loading buffer.
Total protein extracts were prepared from 3x108 cells collected by centrifugation, washed in Stop buffer (150 mM NaCl, 50 mM NaF, 10 mM EDTA, 1 mM NaN3 pH 8.0) and resuspended in 25 µl of RIPA buffer (10 mM sodium phosphate, 1% Triton X-100, 0.1% SDS, 10 mM EDTA, 150 mM NaCl, pH 7.0) containing the following protease inhibitors: 10 µg/ml leupeptin, 10 µg/ml aprotinin, 10 µg/ml pepstatin, 10 µg/ml soybean trypsin inhibitor, 100 µM 1-chloro-3-tosylamido-7-amino-L-2-heptanone (TLCK), 100 µM N-tosyl-L-phenyalanine chloromethyl ketone (TPCK), 100 µM PMSF (phenylmethylsulfonyl fluoride), 1 mM phenanthroline and 100 µM N-acetyl-leu-leu-norleucinal. Cells were boiled for 5 minutes, broken using 750 mg of glass beads (0.4 mm Sigma) for 15 seconds in a Fast-Prep machine (Bio101 Inc.) and the crude extract was recovered by washing with 0.5 ml of RIPA. Protein concentration was determined by BCA protein assay kit (Pierce).
For western blots, 75 µg of total protein extract was run on a 12%
SDS-PAGE gel, transferred to nitrocellulose and probed with rabbit affinity
purified anti-ste9-C-ter (1:200), SP4 anti-cdc13 (1:250) and anti-rum1 (1:250)
polyclonal antibodies. Goat anti-rabbit or goat anti-mouse conjugated to
horseradish peroxidase (Amersham) (1:3,500) was used as secondary antibody.
Mouse TAT1 anti-tubulin monoclonal antibodies (1:500) and goat anti-mouse
conjugated to horseradish peroxidase (1:2,000) as secondary antibody was used
to detect tubulin as loading control. Immunoblots were developed using the ECL
kit (Amersham) or Super Signal (Pierce). CIP treatment of immunoprecipitates
was performed as previously described (Fankhauser et al.,
1995
).
| RESULTS |
|---|
|
|
|---|
|
To determine whether the flp1 gene is essential for cell viability and proliferation, one copy of the gene was replaced in a diploid by the kanMX6 cassette (Fig. 2A), which was generated by PCR amplification using flp1-specific oligonucleotides (see Materials and Methods). Dissection of tetrads indicated that all gave rise to four colonies, of which two were resistant to Geneticin, and two were not. To confirm correct deletion of the flp1 gene, the haploid flp1::kanMX6 cells were checked for the absence of the flp1+ gene by Southern blotting (Fig. 2B). We conclude that the S. pombe flp1 gene is not essential for cell viability or proliferation.
|
Although viable, and capable of colony formation at all temperatures,
flp1::kanMX6 cells are not phenotypically identical to wild-type
(Fig. 2C,D). Measurement of the
length of septated cells at 25°C indicated that flp1::kanMX6
cells divide at an average size of 11.5 µm, compared with 14 µm for
wild-type. The cells are thus advanced into mitosis and may be considered
`semi-wee'. At 36°C, multi-compartmented cells
(Fig. 2D, cell 1),
multinucleated postmitotic cells (Fig. 2D,
cell 2, C, cell 1), anucleate compartments
(Fig. 2D, cell 3), and `cut'
nuclei (Fig. 2D, cell 4) were
all observed. Staining with Rhodamine-conjugated Phalloidin indicated that no
medial ring was present in the post-mitotic, multinucleated cells, indicating
that this phenotype does not result from activation of the S. pombe
morphology checkpoint (Liu et al.,
2000
). Together, these classes
of aberrant cells represented approximately 8.5% of the population. Similar
defects were also observed at 25°C, but these cells represented only 2% of
the population. Thus, although they are viable, flp1::kanMX6 cells
display a defect in septum formation and cleavage, and are slightly advanced
into mitosis.
Staining of cells with TAT-1 revealed a normal pattern of interphase
microtubules and mitotic spindles (data not shown). Staining with
Rhodamine-conjugated Phalloidin revealed patterns of F-actin staining similar
to wild-type cells (data not shown). Examination of the SIN components cdc7p,
mob1p, plo1p, spg1p and sid2p showed that their localisation was normal in
flp1::kanMX6 cells (not shown). The localisation of the medial ring
components cdc15p and mid1p was also normal. Both cdc15p and mid1p undergo
changes in phosphorylation during mitosis (Fankhauser et al.,
1995
; Sohrmann et al.,
1996
); these changes occurred
normally in flp1::kanMX6 cells, indicating that they are not
substrates of flp1p, or that another phosphatase can substitute for flp1p in
these cells (not shown).
Flp1p is phosphorylated during mitosis
Northern blotting of total RNA extracted from synchronised cells indicated
that the steady state level of flp1 mRNA does not vary significantly
throughout the cell cycle (data not shown). To examine whether flp1p varies in
level during the cell cycle, cells carrying the flp1-HA allele were
synchronised by arrest release of cdc25-22 and protein samples were
prepared as cells passed through mitosis and cytokinesis
(Fig. 3A). Western blotting
showed that, although the steady state level of flp1p-HA did not change
significantly, there was a marked alteration in the apparent molecular weight
of the protein at the time corresponding to anaphase, medial ring formation
and septation (Fig. 3B, 30-80
minutes). As most cells completed cleavage and entered the next cell cycle,
flp1p-HA returned to the faster-migrating form seen in G2 arrested
cells (Fig. 3B, 100-160
minutes). Flp1p-HA was immunoprecipitated from cell extracts prepared 45
minutes after release from the G2 arrest, and the immunoprecipitate
treated with alkaline phosphatase. This treatment shifted most of the protein
back to the faster-migrating form (Fig.
3C), confirming that the slower-migrating forms are the result of
phosphorylation.
|
Localisation of flp1p
To study the in vivo localisation of flp1p, the chromosomal copy of the
gene was modified to add either Green Fluorescent protein (GFP) or the 12CA5
influenza virus hemagglutinin epitope tag (HA) to the C-terminus of flp1p.
Both tagged proteins were considered to be functional since the tagged
flp1 allele did not show any of the strong genetic interactions shown
by the flp1::kanMX6. Observation of both living and fixed cells
demonstrated that in interphase cells the flp1p-GFP was localised in the
nucleolus and on the spindle pole body
(Fig. 4Aa,B,C,D). The nucleolar
staining was not uniform: dots and more intensely staining regions were
observed (Fig. 4Aa). The nature
of these structures is unknown. Although the nuclear signal of flp 1p-GFP was
predominantly located in the non-DAPI staining (nucleolar) region of the
nucleus, a weaker signal was also observed in the DAPI-staining region of the
nucleus in fixed cells (Fig.
4B). The localisation to the nucleolus was confirmed by
co-localisation with the nucleolar marker fibrillarin (nop1; Aris and Blobel,
1991
; Henriquez et al.,
1990
; Potashkin et al.,
1990
)
(Fig. 4C), while localisation
to the SPB was confirmed by staining with antibodies against sad1p
(Fig. 4D) (Hagan and Yanagida,
1995
).
|
In early mitotic cells, flp 1p-GFP was observed on both spindle pole bodies
(Fig. 4Ab), along the mitotic
spindle (Fig. 4Ac,d,e), and in
the medial ring (Fig. 4Ad,e).
In some cells, the staining was continuous along the short spindle
(Fig. 4Ad), while in others it
was discontinuous (Fig. 4Ae).
The reason for this difference is presently unclear. In early mitotic cells,
the flp 1p-GFP signal was present throughout the nucleus. Previous studies
(Hirano et al., 1989
) of the
localisation of nuc 1p (the large subunit of RNA polymerase I) have shown that
in mitotic cells the nucleolar domain can be clearly distinguished from the
DAPI-staining, chromatin region. We therefore conclude that flp 1p-GFP leaves
the nucleolar region early in mitosis. This is in contrast to the result
observed with S. cerevisiae Cdc 14p, which appears to leave the
nucleolus only at the end of mitosis (Shou et al.,
1999
).
Treatment of exponentially growing flp 1-GFP cells with Latrunculin A resulted in the appearance of centrally located flp 1p-GFP dots in mitotic cells (Fig. 4G1,2). Interphase localisation to the spindle pole body and nucleolus was unaffected (Fig. 4G1i, 3). Staining of fixed flp 1::kanMX6 nda3-KM311 cells that had been arrested by incubation at 19°C, indicated that, in early mitosis, flp 1p-GFP co-localised with the F-actin ring (Fig. 4E), and was dispersed throughout the nucleus (Fig. 4F).
In late anaphase cells, flp 1p-GFP remained associated with both poles of the mitotic spindle, although the signals were weaker than in early mitotic cells (Fig. 4Af, and the medial ring (Fig. 4Af, 4Ag). The spindle staining became concentrated in the spindle mid-zone (Fig. 4Ag). During septum synthesis, flp 1p-GFP was seen in the contractile ring at the leading edge of the division septum, the spindle pole bodies, and the nucleolus (Fig. 4Ah). Upon completion of the division septum (which is coincident with late G1/S-phase in terms of the nuclear cycle), flp 1p-GFP was observed uniquely on the spindle pole body and in the nucleolus, as was the case in late interphase cells (Fig. 4Ai).
Activation of the SIN is not required for flp 1p-GFP relocalisation
during mitosis
Previous studies have demonstrated that, in S. cerevisiae, MEN
function is required for Cdc 14p to leave the nucleolus at the end of mitosis
(Shirayama et al., 1999
; Shou
et al., 1999
; Visintin et al.,
1999
). To test whether SIN
function is required for the cell cycle relocalisations described above, the
flp 1-GFP allele was introduced into SIN null allele backgrounds. The
use of heat-sensitive SIN mutants was precluded because the spindle and medial
ring staining of flp 1p was found to be labile in cells fixed at high
temperatures (>32°C), as has been described previously for some other
SIN proteins (Salimova et al.,
2000
; Sparks et al.,
1999
). Nucleolar and spindle
pole body localisation were unaffected. The flp 1-GFP allele was
crossed to haploid SIN null strains in which the deletion is rescued by the
presence of an episomal plasmid. Spores were germinated at 25°C selecting
for the null allele and the flp 1-GFP allele (see Materials and
Methods). The flp 1p-GFP structures present in multinucleated cells were
examined. Interphase nucleolar and spindle pole body staining were observed in
germinating cdc7 null (Fig.
5A1), cdc14 null (Fig.
5B2) and spg1 null
(Fig. 5C3) spores. Likewise,
all three mutants showed spindle (Fig.
5A2,B1,C1,2) and medial ring
(Fig. 5A2,5B1,5C1) staining
although, in the spg1 null cells, the rings appeared less well
defined that those seen in cdc7 null cells. Note that some SIN
mutants do not always form multiple medial rings in the later nuclear cycles
after shift (see for example, Balasubramanian et al.,
1998
; Schmidt et al.,
1997
), explaining why in some
cases only a single ring is seen. Similar results were obtained using
thermosensitive alleles of sid2 and sid1 that die at
29°C (not shown). We therefore conclude that SIN signalling is not
required for the changes in subcellular localisation of flp 1p-GFP.
|
Inactivation of SIN signalling is required for flp 1p-GFP
relocalisation to the nucleolus at the end of mitosis
The effect of deregulation of SIN signalling upon flp 1p-GFP localisation
was also examined. Inactivation of cdc 16p, which is part of the GTPase
activating protein (GAP) for spg1p (Furge et al.,
1998
) results in multiple
rounds of septum formation without cell cleavage (Minet et al.,
1979
). In germinating
cdc16 null spores, type II cells showed an interphase-like
localisation of flp 1p-GFP (Fig.
5D5). By contrast, type I cells showed no discrete localisation of
flp 1p-GFP (Fig. 5D1-4).
Occasionally, one or more of the cell compartments contained what appeared to
be aggregates of flp 1p-GFP (Fig.
5D2, arrows).
Since type I cells have entered mitosis, whereas type II cells have not
(see Introduction), one explanation for these data could be that once cells
have entered mitosis, SIN signalling must be attenuated for flp 1p-GFP to
return to the interphase configuration once septation has been completed. To
test this hypothesis, the localisation of flp 1p-GFP was examined in cells
where the lethality of a cdc16 null allele is rescued by attenuation
of the SIN (Fournier et al.,
2001
; Salimova et al.,
2000
). The double mutant
sid2-1 cdc16::ura4+ is viable at 25°C, although some
errors of septum formation still occur (Fournier et al.,
2001
). Normal interphase
(Fig. 5E1-4), and mitotic
(Fig. 5E5) distribution of flp
1p-GFP was observed, although occasional aggregates of the protein were also
seen (Fig. 5E2, arrows). A
normal interphase distribution of flp 1p-GFP was also seen in cells that had
formed a second division septum (Fig.
5E1,2) indicating that the presence of a additional septa does not
per se inhibit flp 1p-GFP localisation in a SIN-independent manner.
Together, these data are consistent with the hypothesis that SIN signalling
must be inactivated or attenuated for flp 1p-GFP to return to the nucleolus
after septation is completed.
Genetic interactions of flp 1 with the SIN
In S. cerevisiae, Cdc 14p is thought to be the essential target of
the MEN (Jaspersen et al.,
1998
; Visintin et al.,
1999
). To investigate whether
there were any interactions between flp 1 and the SIN, double mutants
of flp 1::kanMX6 with heat-sensitive SIN mutants were constructed by
tetrad dissection. It was found that the double mutants flp 1::kanMX6 cdc
7-24 and flp 1::kanMX6 mob 1-R4 were inviable at 25°C. A
strong reduction of restrictive temperature was noted for other double mutant
combinations (see Table 1). In
most cases, the double mutants already showed a significant septation defect
at the permissive temperature: the example of the mutant sid2-250 flp
1::kanMX6 is shown in Fig.
6A. In addition, at 36°C, the double mutants accumulated more
nuclei than the single SIN mutant, and the nuclear cycles were no longer
synchronised (Fig. 6A). The
exception to this among the SIN mutants was the double mutant flp
1::kanMX6 sid1-239, which did not display any additive effects.
Interestingly, many multinucleated, non-septated cells were observed when the
double mutant cdc 16-116 flp 1::kanMX6 was grown at 25°C. This
defect was alleviated partially at 29°C, and at 36°C cells showed the
multiseptated phenotype characteristic of cdc 16-116
(Fig. 6B). No additive effects
were observed when double mutants of flp 1::kanMX6 with a number of
mutants defective in medial ring assembly or function were analysed
(Table 1).
|
|
Increased expression of the S. cerevisiae CDC14 can rescue some of
the MEN mutants (Jaspersen et al.,
1998
; Visintin et al.,
1999
). By contrast, increased
expression of the flp 1 gene from a multicopy plasmid did not rescue
any of the heat-sensitive SIN mutants tested (cdc7-24, cdc11-136,
cdc14-118, spg1-B8, sid1-239, sid2-250, sid4-SA1, mob1-R4 and
cdc16-116), whether expressed at low (from its own promoter in
pDW232, or pREP3 non-induced), or high levels (pREP3, induced) (data not
shown).
Increased expression of some SIN genes can induce septation independently
of entry into mitosis (Ohkura et al.,
1995
; Schmidt et al.,
1997
). Expression of either
plo1 (not shown) or spg1
(Fig. 6C) from the nmt1
promoter induced septation in flp1::kanMX6 cells. Likewise, increased
expression of septation inhibitor byr4 (Song et al.,
1996
) blocked septum formation
in flp1::kanMX6 cells, as it does in wild-type
(Fig. 6D). Thus, we conclude
that flp 1p is not an essential effector of spg1-mediated signal transduction.
However, it was noted that increased expression of spg1 induced fewer
multiseptated cells in a flp1::kanMX6 background
(Fig. 6C), suggesting that the
efficiency of SIN signalling was reduced in the absence of flp1p function.
Flp1p is not necessary for dephosphorylation of ste9p in
G1, nor is it required for degradation, or accumulation of cdc13p
or rum1p at the end of mitosis
S. cerevisiae Cdc14p promotes degradation of B-type cyclins at the
end of mitosis, and also favours accumulation of p40sic1 (Visintin
et al., 1998
). The effects of
flp1::kanMX6 upon degradation of the B-type cyclin cdc13p and
accumulation of rum1p were investigated by arrest-release of cdc25-22
and cdc25-22 flp1::kanMX6 strains, extraction of proteins, and
western blotting. Western blotting with antisera recognising either cdc13p or
rum1p indicated that both proteins accumulated and were then degraded in the
flp1::kanMX6 background with similar timing to that seen in
flp1+ cells (Fig.
7A). The kinetics of release from the cdc25-22 block were
similar in the flp1+ and flp1::kanMX6 backgrounds
(Fig. 7B). The timing of
disappearance of cdc13p-myc13 was also examined in exponentially growing
flp1+ and flp1::kanMX6 cells. Fixed cells were
stained with 9E10 and the fluorescence due to cdc13p compared in cells at
similar stages in mitosis. No significant differences were noted between the
flp1+ and flp1::kanMX6 backgrounds
(Fig. 7C). We conclude that
flp1p activity is not required for accumulation or degradation of either
cdc13p or rum1p. Consistent with this, the flp1::kanMX6 cells are
capable of mating.
|
The APC/C accessory factor Cdh1p is thought to be dephosphorylated by
Cdc14p at the end of mitosis, thereby allowing it to associate with the APC/C
to promote B-type cyclin degradation (Jaspersen et al.,
1999
; Visintin et al.,
1998
). The S. pombe
homologue of Cdh1p, ste9p (Kitamura et al.,
1998
; Yamaguchi et al.,
1997
), is also
dephosphorylated and activated in G1 (Blanco et al.,
2000
; Yamaguchi et al.,
2000
). Cells were synchronised
by arrest-release of a cdc10 mutant, and the phosphorylation state of
ste9p was monitored by western blotting. Ste9p was dephosphorylated normally
in G1 arrested cells, and then rephosphorylated upon S-phase entry
in both flp1+ or flp1::kanMX6 backgrounds
(Fig. 7D). The kinetics of
entry into S-phase following release of the cdc10-129 block were
similar in a flp1+ and flp1::kanMX6 background
(Fig. 7E). We conclude that
flp1p is not responsible for dephosphorylation of ste9p in G1.
Increased expression of flp1 arrests cells in
G2
Strong expression of S. cerevisiae CDC14 promotes mitotic exit,
B-type cyclin degradation, accumulation of the CKI p40sic1, and
G1 arrest (Visintin et al.,
1998
). Increased expression of
S. pombe flp1 from the thiamine-regulated nmt1 promoter
produced elongated cells with a single nucleus
(Fig. 8A). FACS analysis
indicated that cells arrested predominantly with 2C DNA content
(Fig. 8B). Staining with
Rhodamine-conjugated Phalloidin indicated that F-actin patches were located at
the tips of the cell consistent with a G2 arrest (data not shown).
Upon prolonged incubation, cells eventually entered mitosis and septated.
Increased expression of the mutant flp1p(C286S), in which the conserved
cysteine that is known to be essential for activity of S. cerevisiae
Cdc14p (Taylor et al., 1997
)
is replaced by serine, did not produce a cell cycle arrest, indicating that
the phosphatase activity of flp1p is essential for cell cycle arrest
(Fig. 8C). Western blotting
showed that the levels of the mitotic B-type cyclin cdc13p and the
cdk-inhibitor rum1p did not change significantly in the arrested cells
(Fig. 8D), indicating that the
arrest does not result from degradation of B-type cyclins or stabilisation of
rum1p. The mitotic inducer cdc25p was shifted to a faster-migrating form
(Fig. 8D). This was confirmed
by expressing flp1 in a strain carrying a myctagged cdc25p
(Fig. 8E), and suggesting that
the G2 arrest might be mediated in part through the mitotic
regulatory system.
|
A cell cycle block was also imposed by increased expression of
flp1 in rum1::ura4+,
ste9::ura4+ and rum1::ura4+
ste9::ura4+ mutants, indicating that neither ste9p nor
rum1p is necessary for the cell cycle arrest induced by increased expression
of flp1p. Expression of flp1 in rad3-,
chk1
, and rad24
backgrounds also blocked cell
division, suggesting that the G2 arrest does not result from
ectopic activation of the DNA structure checkpoint (data not shown).
Mitotic control mutants prevent cell cycle arrest in response to
increased expression of flp1+
The effects of increased flp1 expression were studied in the
mutants wee1-6 (which divide at a reduced size at all temperatures
(Fantes, 1981
) and
cdc25::ura4+ wee1-6 (which lacks the normal size
control over entry into mitosis (Sveiczer et al.,
1999
). Both strains continued
dividing at times following induction of flp1+ expression
when wild-type cells had arrested (Fig.
9A,B). This demonstrates that the G2 arrest following
increased expression of flp1p requires the mitotic inhibitor wee1p.
|
The effect of increased flp1+ expression in the
presence of activated alleles of cdc2 was also investigated. The
mutant cdc2-1w is less responsive than cdc2+ to
inhibition by wee1p, but still requires cdc25p for activation (Fantes,
1983
; Russell and Nurse,
1987b
). Increased expression
of flp1+ in cdc2-1w resulted in some cell
elongation, but septated, dividing cells were still present, indicating that,
as in the wee1-6 background, the cell cycle arrest was relieved.
Moreover, anucleate compartments and cut nuclei were observed, indicating a
loss of proper co-ordination between mitosis and septum formation
(Fig. 9C). The mutant
cdc2-3w is independent of cdc25p for activation, but still responds
to inhibition by wee1p (Russell and Nurse,
1987b
). In this background,
increased expression of flp1+ arrested cell division.
Approximately 50% of cells had a single nucleus, while the remainder had two,
whose chromatin domains faced each other, indicating that these cells had
completed mitosis without septating (Fig.
9D). Together, these data suggest that the G2 arrest
due to flp1 overexpression is imposed predominantly through the
mitosis regulators cdc25p and wee1p.
Genetic interactions of flp1::kanMX6 with mitotic control
and other mutants
The genetic interactions of flp1::kanMX6 with elements of the
mitotic control system were also examined. Double mutants with wee1-6,
cdc2-1w, and cdc2-3w were constructed. The mutants wee1-6
flp1::kanMX6, cdc2-1w flp1::kanMX6 and cdc2-3w flp1::kanMX6
showed strong additive effects. Multinucleate cells were frequently observed,
indicating that cells had failed to septate. In addition, enlarged nuclei and
nuclei of different sizes in the same compartment were observed, suggesting
that aberrant mitoses had occurred. These phenotypes were more accentuated at
36°C than 25°C (Fig.
10A,B,C). The mutant cdc2-3w is defective in sensing the
completion of DNA replication (Enoch and Nurse,
1990
). Incubation of
cdc2-3w flp1::kanMX6 in medium containing hydroxyurea produced `cut'
phenotypes at both 25°C and 36°C, indicating that the
flp1::kanMX6 mutation does not restore the DNA replication completion
checkpoint function. Consistent with this, flp1::kanMX6 cells
arrested normally in the presence of hydroxyurea, indicating that the DNA
replication completion checkpoint is functional (data not shown). No additive
effects were noted in the double mutants rum1::ura4+
flp1::kanMX6 and ste9::ura4+
flp1::kanMX6 (Table 1; data not shown).
|
Flp1p is required for the nuclear division delay imposed by the
S. pombe morphology checkpoint
Defects in septum construction can trigger a checkpoint that delays the
resumption of tip-growth, and disassembly of the medial F-actin ring. This
delay requires both wee1p and SIN function (Le Goff et al.,
1999b
; Liu et al.,
2000
). Since the
flp1::kanMX6 allele showed strong genetic interactions with the SIN
and mitotic control genes, the effect upon the morphology checkpoint was
examined by constructing the double mutant cps1-N12 flp1::kanMX6. The
cps1-N12 mutant is defective in ß-glucan synthase function (Le
Goff et al., 1999b
). After
shift to 36°C, more than 70% of cells arrest binucleate, with or without a
division septum, having activated the morphology checkpoint
(Fig. 11A,C). By contrast,
although the aberrant septa were not cleaved, the double mutant cps1-N12
flp1::kanMX6 became elongated, and many cells underwent a second round of
nuclear division during the incubation period
(Fig. 11B,C). We conclude that
flp1p function is required for the S. pombe morphology
checkpoint.
|
| DISCUSSION |
|---|
|
|
|---|
Why is flp1p function not essential ? At the time of writing, while the sequence of the fission yeast genome remains incomplete (though only about 50 gene's-worth of DNA remains to be sequenced), it is not possible to exclude formally that there is a second flp1p-like protein in fission yeast, with which flp1p is functionally redundant. Nonetheless, database searches do not identify any other closely related protein, and Southern blotting has not identified any closely related sequences.
Both proteins are nucleolar-located in interphase, from where they are
released during mitosis. However, while release of S. cerevisiae
Cdc14p from the nucleolus requires MEN function, the data presented in this
paper indicate clearly that SIN function is not required to effect flp1p
release from the nucleolus in S. pombe. In budding yeast, Cdc14p is
tethered in the nucleolus by attachment to Net1p, which is a component of the
RENT complex (Shou et al.,
1999
; Straight et al.,
1999
; Visintin et al.,
1999
). Database searches have
failed to identify a Net1p orthologue in S. pombe to date. In this
context, it is noteworthy that the closest S. pombe homologue of
Sir2p (ORF SPBC16d10.07), which is another member of the RENT complex in
S. cerevisiae, is also located in the nucleolus (M. Cockell, V.S. and
S. Gasser, unpublished).
What is the signal for release of flp1p from the nucleolus? Flp1p is phosphorylated during mitosis, at the time when it is associated with the medial ring, the mitotic spindle, and is found throughout the nucleus. It is tempting to speculate that the phosphorylation is the trigger for the relocalisation of flp1p. It is noteworthy that there are two cdc2p consensus sites (S/TPXK/R) in flp1p. However, these are not conserved in the Cdc14p orthologues from other species. The role of phosphorylation in the regulation of flp1p will be the subject of future studies.
In S. pombe, return of flp1p to the nucleolus at the end of
mitosis requires inactivation or attenuation of the SIN. It is possible that
inactivation of SIN signalling marks the successful completion of a division
septum and that. while it is active, it ensures that the flp1p remains
available to dephosphorylate a substrate that is important to permit septation
and/or cell cleavage. It is unlikely that initiation of DNA synthesis is the
trigger for nucleolar localisation of flp1p at the end of mitosis, since a
cdc16-116 mutant undergoes DNA synthesis at the non-permissive
temperature (Minet et al.,
1979
).
Does flp1p play a role in controlling the onset of mitosis ?
Cells lacking flp1p function are advanced into mitosis, suggesting that
flp1p is an inhibitor of mitosis. Consistent with this, increased expression
of flp1+ arrests cells in G2, in a
wee1p-dependent manner. In the arrested cells, cdc25p is in a rapidly
migrating, dephosphorylated form. Since cdc25p is activated by phosphorylation
during mitosis (Creanor and Mitchison,
1996
; Ducommun et al.,
1990
; Moreno et al.,
1990
), it is possible that
this contributes significantly to the G2 arrest. The fact that
flp1 overexpression still marrests the cell cycle in a
cdc25p-independent manner in the cdc2-3w mutant, suggests that it
also acts upon either wee1p, or one of its regulators, such as nim1p (Russell
and Nurse, 1987a
; Wu and
Russell, 1993
), nif1p (Wu and
Russell, 1997
), or cdr2p
(Breeding et al., 1998
; Kanoh
and Russell, 1998
) to delay
mitotic entry. In this context, it is noteworthy that cdr2p has been
implicated in regulating septum formation, although at which level is not
clear (Breeding et al.,
1998
).
In S. pombe, both cdc25p and wee1p are nuclear proteins, found
predominantly, although not exclusively, in the DAPI-staining region of the
nucleus (Aligue et al., 1997
;
Wu et al., 1996
; Zeng and
Piwnica-Worms, 1999
). It is
also noteworthy that some flp1p-GFP is observed in the non-nucleolar part of
the nucleus. It is therefore possible that during interphase, cdc25p and wee1p
phosphorylation states are modulated by flp1p to maintain them in an inactive
and active state, respectively. Whether this is direct or indirect remains to
be determined. Thus, although flp1p function is not essential for entry into
(or exit from) mitosis, flp1p may play a `fine-tuning' role in regulating
entry into mitosis. The fact that flp1 function is not essential either for
mitotic onset or completion may be due to the presence of multiple control
systems, which can compensate for each other.
How does flp1p function in controlling the onset of septation?
It has been suggested that S. cerevisiae Cdc14p is the essential
effector of the MEN. By contrast, flp1p is not an essential effector of SIN
signalling. Nonetheless, SIN mutants that appear wild-type at 25°C in a
flp1+ background show a strong septation phenotype in the
absence of flp1p function. It is therefore possible that one of the roles of
flp1p is to potentiate SIN signalling, for example, by activating one or more
elements of the network. Two observations are consistent with this: first,
flp1::kanMX6 cells show defects in septation signalling, and second,
induction of septation by spg1 overexpression is less efficient in
the flp1::kanMX6 background, suggesting that the absence of flp1p
attenuates SIN signalling. In this context, it is noteworthy that in S.
cerevisiae, Cdc14p may activate the MEN component Cdc15p providing the
potential for a positive feedback loop to promote exit from mitosis (Jaspersen
and Morgan, 2000
). Whether
this is the case in S. pombe will be addressed in future studies.
Septation is partially inhibited in the flp1::kanMX6 cdc16-116
mutant at 25°C. The single cdc16-116 mutant does not show any
obvious septation defect at 25°C (Minet et al.,
1979
). However, increased
expression of the cloned cdc16-116 allele in wild-type cells blocks
septum formation, while cdc16+ does not (L. Cerutti and
V.S., unpublished), suggesting that the mutant cdc16-116p may be a more
effective negative regulator of SIN signalling. If the absence of flp1p also
attenuates SIN signalling, a combination of these mutants may produce a
synergistic effect. Growth at a higher temperature, such as 29°C, may
partially inactivate cdc16-116p, reducing the inhibitory effect.
Previous studies have demonstrated that cdc2p kinase activity during
mitosis is antagonistic to septum formation (Cerutti and Simanis,
1999
; He et al.,
1998
; He et al.,
1997
). Thus, premature
activation of cdc2p, and its delayed or incomplete inactivation during mitosis
might account for the strong negative genetic interactions of
flp1::kanMX6 with mutants that have reduced SIN signalling, and the
greatly enhanced septation defects shown by flp1::kanMX6 in
wee1- and cdc2w backgrounds.
What is the role of flp1p in the morphology checkpoint?
The involvement of flp1p in the S. pombe morphology checkpoint
could be at several levels. One possibility is that it is an essential
effector of the checkpoint, and that its activation (or release from the
nucleolus) is required to delay the next cycle of nuclear division, and the
resumption of tip-growth. Alternatively, since the morphology checkpoint
requires both wee1p and SIN signalling for its activity, it is possible that
the failure of the checkpoint results from reduced SIN signalling in the
flp1::kanMX6 cells.
What are the physiological substrates of flp1p?
Our studies suggest that elements of the mitotic control system (or their
upstream regulators) may be targets of flp1p. Flp1p is also located on the
spindle pole body, mitotic spindle and the contractile ring. It is known that
many regulators of mitosis and septum formation, are located on the spindle
pole body (Alfa et al., 1990
;
Bahler et al., 1998a
; Cerutti
and Simanis, 1999
; Chang and
Gould, 2000
; Eng et al.,
1998
; Guertin et al.,
2000
; Hou et al.,
2000
; Mulvihill et al.,
1999
; Sohrmann et al.,
1998
; Sparks et al.,
1999
), so these may be among
the targets of flp1p. The diversity of phenotypes associated with loss of
flp1p function may reflect the fact that it has more than one important
substrate, and so its absence may reduce the fidelity, or efficiency, of
several processes. Identification of the substrates and anchors of flp1p on
the mitotic spindle, the contractile ring and the nucleolus will be the
subject of future studies.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Alfa, C. E., Ducommun, B., Beach, D. and Hyams, J. S. (1990). Distinct nuclear and spindle pole body population of cyclin-cdc2 in fission yeast. Nature 347,680 -682.[Medline]
Aligue, R., Wu, L. and Russell, P. (1997).
Regulation of Schizosaccharomyces pombe Wee1 tyrosine kinase. J.
Biol. Chem. 272,13320
-13325.
Aris, J. P. and Blobel, G. (1991). cDNA cloning
and sequencing of human fibrillarin, a conserved nucleolar protein recognized
by autoimmune antisera. Proc. Natl. Acad. Sci. USA
88,931
-935.
Bahler, J., Steever, A. B., Wheatley, S., Wang, Y., Pringle, J.
R., Gould, K. L. and McCollum, D. (1998a). Role of polo
kinase and Mid1p in determining the site of cell division in fission yeast.
J. Cell Biol. 143,1603
-1616.
Bahler, J., Wu, J. Q., Longtine, M. S., Shah, N. G., McKenzie, A., III, Steever, A. B., Wach, A., Philippsen, P. and Pringle, J. R. (1998b). Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe. Yeast 14,943 -951.[Medline]
Balasubramanian, M. K., McCollum, D., Chang, L., Wong, K. C.,
Naqvi, N. I., He, X., Sazer, S. and Gould, K. L. (1998).
Isolation and characterization of new fission yeast cytokinesis mutants.
Genetics 149,1265
-1275.
Balasubramanian, M. K., McCollum, D. and Gould, K. L. (1997). Cytokinesis in fission yeast Schizosaccharomyces pombe. Methods Enzymol. 283,494 -506.[Medline]
Balasubramanian, M. K., McCollum, D. and Surana, U. (2000). Tying the knot: linking cytokinesis to the nuclear cycle. J. Cell Sci. 113,1503 -1513.[Abstract]
Barbet, N., Muriel, W. J. and Carr, A. M. (1992). Versatile shuttle vectors and genomic libraries for use with Schizosaccharomyces pombe. Gene 114, 59-66.[Medline]
Basi, G., Schmid, E. and Maundrell, K. (1993). TATA box mutations in the Schizosaccharomyces pombe nmt1 promoter affect transcription efficiency but not the transcription start point or thiamine repressibility. Gene 123,131 -136.[Medline]
Blanco, M. A., Sanchez-Diaz, A., de Prada, J. M. and Moreno, S. (2000). APC(ste9/srw1) promotes degradation of mitotic cyclins in G(1) and is inhibited by cdc2 phosphorylation. EMBO J. 19,3945 -3955.[Medline]
Breeding, C. S., Hudson, J., Balasubramanian, M. K., Hemmingsen,
S. M., Young, P. G. and Gould, K. L. (1998). The cdr2(+) gene
encodes a regulator of G2/M progression and cytokinesis in Schizosaccharomyces
pombe. Mol. Biol. Cell
9,3399
-3415.
Cerutti, L. and Simanis, V. (1999). Asymmetry of the spindle pole bodies and spg1p GAP segregation during mitosis in fission yeast. J. Cell Sci. 112,2313 -2321.[Abstract]
Chang, L. and Gould, K. L. (2000). Sid4p is
required to localize components of the septation initiation pathway to the
spindle pole body in fission yeast. Proc. Natl. Acad. Sci.
USA 97,5249
-5254.
Creanor, J. and Mitchison, J. M. (1996). The kinetics of the B cyclin p56cdc13 and the phosphatase p80cdc25 during the cell cycle of the fission yeast Schizosaccharomyces pombe. J. Cell Sci. 109,1647 -1653.[Abstract]
Ducommun, B., Draetta, G., Young, P. and Beach, D. (1990). Fission yeast cdc25 is a cell-cycle regulated protein. Biochem. Biophys. Res. Commun. 167,301 -309.[Medline]
Eng, K., Naqvi, N. I., Wong, K. C. and Balasubramanian, M. K. (1998). Rng2p, a protein required for cytokinesis in fission yeast, is a component of the actomyosin ring and the spindle pole body. Curr. Biol. 8,611 -621.[Medline]
Enoch, T. and Nurse, P. (1990). Mutation of fission yeast cell cycle control genes abolishes dependence of mitosis on DNA replication. Cell 60,665 -673.[Medline]
Fankhauser, C., Marks, J., Reymond, A. and Simanis, V. (1993). The S. pombe cdc16 gene is required both for maintenance of p34cdc2 kinase activity and regulation of septum formation: a link between mitosis and cytokinesis? EMBO J. 12,2697 -2704.[Medline]
Fankhauser, C., Reymond, A., Cerutti, L., Utzig, S., Hofmann, K. and Simanis, V. (1995). The S. pombe cdc15 gene is a key element in the reorganization of F- actin at mitosis. Cell 82,435 -444.[Medline]
Fankhauser, C. and Simanis, V. (1993). The Schizosaccharomyces pombe cdc14 gene is required for septum formation and can also inhibit nuclear division. Mol. Biol. Cell 4, 531-539.[Abstract]
Fankhauser, C. and Simanis, V. (1994). The cdc7 protein kinase is a dosage dependent regulator of septum formation in fission yeast. EMBO J. 13,3011 -3019.[Medline]
Fantes, P. A. (1981). Isolation of cell size
mutants of a fission yeast by a new selective method: characterization of
mutants and implications for division control mechanisms. J.
Bacteriol. 146,746
-754.
Fantes, P. A. (1983). Control of timing of cell cycle events in fission yeast by the wee 1+ gene. Nature 302,153 -155.[Medline]
Fitzpatrick, P. J., Toyn, J. H., Millar, J. B. and Johnston, L. H. (1998). DNA replication is completed in Saccharomyces cerevisiae cells that lack functional Cdc14, a dual-specificity protein phosphatase. Mol. Gen. Genet. 258,437 -441.[Medline]
Fournier, N., Cerutti, L., Beltraminelli, N., Salimova, E. and Simanis, V. (2001). Bypass of the requirement for cdc16p GAP function in Schizosaccharomyces pombe by mutation of the septation initiation network genes. Arch. Microbiol. 175, 62-69.[Medline]
Furge, K. A., Wong, K., Armstrong, J., Balasubramanian, M. and Albright, C. F. (1998). Byr4 and Cdc16 form a two-component GTPase-activating protein for the Spg1 GTPase that controls septation in fission yeast. Curr. Biol. 8, 947-954.[Medline]
Guertin, D. A., Chang, L., Irshad, F., Gould, K. L. and McCollum, D. (2000). The role of the sid1p kinase and cdc14p in regulating the onset of cytokinesis in fission yeast. EMBO J. 19,1803 -1815.[Medline]
Hagan, I. and Yanagida, M. (1995). The product
of the spindle formation gene sad1+ associates with the fission yeast spindle
pole body and is essential for viability. J. Cell
Biol. 129,1033
-1047.
Hagan, I. M. and Hyams, J. S. (1988). The use
of cell division cycle mutants to investigate the control of microtubule
distribution in the fission yeast Schizosaccharomyces pombe. J.
Cell Sci. 89,343
-357.
He, X., Jones, M. H., Winey, M. and Sazer, S. (1998). Mph1, a member of the Mps1-like family of dual specificity protein kinases, is required for the spindle checkpoint in S. pombe. J. Cell Sci. 111,1635 -1647.[Abstract]
He, X., Patterson, T. E. and Sazer, S. (1997).
The Schizosaccharomyces pombe spindle checkpoint protein mad2p blocks anaphase
and genetically interacts with the anaphase-promoting complex.
Proc. Natl. Acad. Sci. USA
94,7965
-7970.
Henriquez, R., Blobel, G. and Aris, J. P.
(1990). Isolation and sequencing of NOP1. A yeast gene encoding a
nucleolar protein homologous to a human autoimmune antigen. J.
Biol. Chem. 265,2209
-2215.
Hirano, T., Konoha, G., Toda, T. and Yanagida, M.
(1989). Essential roles of the RNA polymerase I largest subunit
and DNA topoisomerases in the formation of fission yeast nucleolus.
J. Cell Biol. 108,243
-253.
Hou, M. C., Salek, J. and McCollum, D. (2000). Mob1p interacts with the sid2p kinase and is required for cytokinesis in fission yeast. Curr. Biol. 10,619 -622.[Medline]
Hoyt, M. A. (2000). Exit from mitosis: spindle pole power. Cell 102,267 -270.[Medline]
Jaspersen, S. L., Charles, J. F. and Morgan, D. O. (1999). Inhibitory phosphorylation of the APC regulator Hct1 is controlled by the kinase Cdc28 and the phosphatase Cdc14. Curr. Biol. 9,227 -236.[Medline]
Jaspersen, S. L., Charles, J. F., Tinker-Kulberg, R. L. and
Morgan, D. O. (1998). A late mitotic regulatory network
controlling cyclin destruction in Saccharomyces cerevisiae. Mol.
Biol. Cell 9,2803
-2817.
Jaspersen, S. L. and Morgan, D. O. (2000). Cdc14 activates cdc15 to promote mitotic exit in budding yeast. Curr. Biol. 10,615 -618.[Medline]
Kanoh, J. and Russell, P. (1998). The protein
kinase Cdr2, related to Nim1/Cdr1 mitotic inducer, regulates the onset of
mitosis in fission yeast. Mol. Biol. Cell
9,3321
-3334.
Kitamura, K., Maekawa, H. and Shimoda, C.
(1998). Fission yeast Ste9, a homolog of Hct1/Cdh1 and
Fizzy-related, is a novel negative regulator of cell cycle progression during
G1-phase. Mol. Biol. Cell
9,1065
-1080.
Le Goff, X., Utzig, S. and Simanis, V. (1999a). Controlling septation in fission yeast: finding the middle, and timing it right. Curr. Genet. 35,571 -584.[Medline]
Le Goff, X., Woollard, A. and Simanis, V. (1999b). Analysis of the cps1 gene provides evidence for a septation checkpoint in Schizosaccharomyces pombe. Mol. Gen. Genet. 262,163 -172.[Medline]
Li, L., Ernsting, B. R., Wishart, M. J., Lohse, D. L. and Dixon,
J. E. (1997). A family of putative tumor suppressors is
structurally and functionally conserved in humans and yeast. J.
Biol. Chem. 272,29403
-29406.
Liu, J., Wang, H. and Balasubramanian, M. K. (2000). A checkpoint that monitors cytokinesis in schizosaccharomyces pombe. J. Cell Sci. 113,1223 -1230.[Abstract]
Marks, J., Hagan, I. M. and Hyams, J. S. (1986). Growth polarity and cytokinesis in fission yeast: the role of the cytoskeleton. J. Cell. Sci. Suppl. 5, 229-241.[Medline]
Minet, M., Nurse, P., Thuriaux, P. and Mitchison, J. M.
(1979). Uncontrolled septation in a cell division cycle mutant of
the fission yeast Schizosaccharomyces pombe. J.
Bacteriol. 137,440
-446.
Moreno, S., Hayles, J. and Nurse, P. (1989). Regulation of p34cdc2 protein kinase during mitosis. Cell 58,361 -372.[Medline]
Moreno, S., Klar, A. and Nurse, P. (1991). Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Methods Enzymol. 194,795 -823.[Medline]
Moreno, S., Nurse, P. and Russell, P. (1990). Regulation of mitosis by cyclic accumulation of p80cdc25 mitotic inducer in fission yeast. Nature 344,549 -552.[Medline]
Mulvihill, D. P., Petersen, J., Ohkura, H., Glover, D. M. and
Hagan, I. M. (1999). Plo1 kinase recruitment to the spindle
pole body and its role in cell division in Schizosaccharomyces pombe.
Mol. Biol. Cell. 10,2771
-2785.
Norbury, C. and Moreno, S. (1997). Cloning cell cycle regulatory genes by transcomplementation in yeast. Methods Enzymol. 283,44 -59.[Medline]
Nurse, P., Thuriaux, P. and Nasmyth, K. (1976). Genetic control of the cell division cycle in the fission yeast Schizosaccharomyces pombe. Mol. Gen. Genet. 146,167 -178.[Medline]
Ohkura, H., Hagan, I. M. and Glover, D. M.
(1995). The conserved Schizosaccharomyces pombe kinase plo1,
required to form a bipolar spindle, the actin ring, and septum, can drive
septum formation in G1 and G2 cells. Genes Dev.
9,1059
-1073.
Potashkin, J. A., Derby, R. J. and Spector, D. L.
(1990). Differential distribution of factors involved in pre-mRNA
processing in the yeast cell nucleus. Mol. Cell Biol.
10,3524
-3534.
Russell, P. and Nurse, P. (1987a). The mitotic inducer nim1+ functions in a regulatory network of protein kinase homologs controlling the initiation of mitosis. Cell 49,569 -576.[Medline]
Russell, P. and Nurse, P. (1987b). Negative regulation of mitosis by wee1+, a gene encoding a protein kinase homolog. Cell 49,559 -567.[Medline]
Salimova, E., Sohrmann, M., Fournier, N. and Simanis, V. (2000). The S. pombe orthologue of the S. cerevisiae mob1 gene is essential and functions in signalling the onset of septum formation. J. Cell Sci. 113,1695 -1704.[Abstract]
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning. New York: Cold Spring Harbor Laborator Press.
Sawin, K. E. (2000). Cytokinesis: Sid signals septation. Curr. Biol. 10,R547 -R550.[Medline]
Schmidt, S., Sohrmann, M., Hofmann, K., Woollard, A. and
Simanis, V. (1997). The Spg1p GTPase is an essential,
dosage-dependent inducer of septum formation in Schizosaccharomyces pombe.
Genes Dev. 11,1519
-1534.
Shirayama, M., Toth, A., Galova, M. and Nasmyth, K. (1999). APC(Cdc20) promotes exit from mitosis by destroying the anaphase inhibitor Pds1 and cyclin Clb5. Nature 402,203 -207.[Medline]
Shou, W., Seol, J. H., Shevchenko, A., Baskerville, C., Moazed, D., Chen, Z. W., Jang, J., Charbonneau, H. and Deshaies, R. J. (1999). Exit from mitosis is triggered by Tem1-dependent release of the protein phosphatase Cdc14 from nucleolar RENT complex. Cell 97,233 -244.[Medline]
Sohrmann, M., Fankhauser, C., Brodbeck, C. and Simanis, V.
(1996). The dmf1/mid1 gene is essential for correct positioning
of the division septum in fission yeast. Genes Dev
10,2707
-2719.
Sohrmann, M., Schmidt, S., Hagan, I. and Simanis, V.
(1998). Asymmetric segregation on spindle poles of the
Schizosaccharomyces pombe septum-inducing protein kinase Cdc7p.
Genes Dev. 12,84
-94.
Song, K., Mach, K. E., Chen, C. Y., Reynolds, T. and Albright,
C. F. (1996). A novel suppressor of ras1 in fission yeast,
byr4, is a dosage- dependent inhibitor of cytokinesis. J. Cell
Biol. 133,1307
-1319.
Sparks, C. A., Morphew, M. and McCollum, D.
(1999). Sid2p, a spindle pole body kinase that regulates the
onset of cytokinesis. J. Cell Biol.
146,777
-790.
Straight, A. F., Shou, W., Dowd, G. J., Turck, C. W., Deshaies, R. J., Johnson, A. D. and Moazed, D. (1999). Net1, a Sir2-associated nucleolar protein required for rDNA silencing and nucleolar integrity. Cell 97,245 -256.[Medline]
Sveiczer, A., Novak, B. and Mitchison, J. M. (1999). Mitotic control in the absence of cdc25 mitotic inducer in fission yeast. J. Cell Sci. 112,1085 -1092.[Abstract]
Taylor, G. S., Liu, Y., Baskerville, C. and Charbonneau, H.
(1997). The activity of Cdc14p, an oligomeric dual specificity
protein phosphatase from Saccharomyces cerevisiae, is required for cell cycle
progression. J. Biol. Chem.
272,24054
-24063.
Visintin, R., Craig, K., Hwang, E. S., Prinz, S., Tyers, M. and Amon, A. (1998). The phosphatase Cdc14 triggers mitotic exit by reversal of Cdk-dependent phosphorylation. Mol. Cell 2,709 -718.[Medline]
Visintin, R., Hwang, E. S. and Amon, A. (1999). Cfi1 prevents premature exit from mitosis by anchoring Cdc14 phosphatase in the nucleolus. Nature 398,818 -823.[Medline]
Wan, J., Xu, H. and Grunstein, M. (1992). CDC14
of Saccharomyces cerevisiae. Cloning, sequence analysis, and transcription
during the cell cycle. J. Biol. Chem.
267,11274
-11280.
Weilguny, D., Praetorius, M., Carr, A., Egel, R. and Nielsen, O. (1991). New vectors in fission yeast: application for cloning the his2 gene. Gene 99, 47-54.[Medline]
Wu, L. and Russell, P. (1993). Nim1 kinase promotes mitosis by inactivating Wee1 tyrosine kinase. Nature 363,738 -741.[Medline]
Wu, L. and Russell, P. (1997). Nif1, a novel mitotic inhibitor in Schizosaccharomyces pombe. EMBO J. 16,1342 -1350.[Medline]
Wu, L., Shiozaki, K., Aligue, R. and Russell, P. (1996). Spatial organization of the Nim1-Wee1-Cdc2 mitotic control network in Schizosaccharomyces pombe. Mol. Biol. Cell 7,1749 -1758.[Abstract]
Yamaguchi, S., Murakami, H. and Okayama, H.
(1997). A WD repeat protein controls the cell cycle and
differentiation by negatively regulating Cdc2/B-type cyclin complexes.
Mol. Biol. Cell 8,2475
-2486.
Yamaguchi, S., Okayama, H. and Nurse, P. (2000). Fission yeast Fizzy-related protein srw1p is a G(1)-specific promoter of mitotic cyclin B degradation. EMBO J. 19,3968 -3977.[Medline]
Zeng, Y. and Piwnica-Worms, H. (1999). DNA
damage and replication checkpoints in fission yeast require nuclear exclusion
of the Cdc25 phosphatase via 14-3-3 binding. Mol. Cell
Biol. 19,7410
-7419.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||