|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
RESEARCH ARTICLE |



,¶
Institut de Biologie de Lille, CNRS EP525, Institut Pasteur de Lille, BP
447, 59021 Lille cedex, France
*
Present address: Ecole Normale Supérieure,
CNRS équipe ATIPE/UMR 8544, 46, rue d'Ulm,
75230 Paris cedex 05, France
Present address: UMR 146, Institut Curie- Section de recherche, Centre
Universitaire, Bâtiment 110, 91405 Orsay Cedex,
France
Present address: UMR 144, Institut Curie, 26, rue d'Ulm, 75248 Paris cedex 5,
France
¶
Author for correspondence (e-mail:
bernard.hoflack{at}curie.fr
)
Accepted May 1, 2001
| SUMMARY |
|---|
|
|
|---|
Key words: AP-3, Retina, Glycoproteins, Sorting, Melanosome
| INTRODUCTION |
|---|
|
|
|---|
, µ3 (Mullins et al.,
1999
-adaptin are altered in the mouse hypopigmentation
mutants pearl and mocha, respectively (Feng et al.,
1999
Pigmented retina cells may provide a good system with which to study the
biogenesis of melanosomes, in particular the sorting machineries responsible
for transport of typical melanosomal proteins. Quail neuroretina (QNR) cells
infected with the v-Myc-expressing retrovirus MC29 have been shown to become
pigmented after several passages in vitro (Martin et al.,
1992
). A subsequent
differential screening lead to the identification of a cDNA (QNR-71)
selectively expressed in the pigmented layer of the retina and in the
epidermis (Turque et al.,
1996
). The derived amino acid
sequence revealed a significant homology with the product of the human
PMEL17 (SILV) gene expected to be the equivalent of the
mouse silver gene (Kwon et al.,
1991
), the chicken matrix
melanosomal protein MMP115, a retinal pigmented epithelium specific protein
(Mochii et al., 1991
) or the
product of human NMB (GPNMB) gene, a gene expressed in low
metastasic melanoma cell lines (Weterman et al.,
1995
). Thus, QNR-71 is likely
to encode a melanosomal protein. The amino acid sequence indicates that it
consists of a 22 hydrophobic amino acid long N-terminal signal sequence
followed by a 464 amino acid long luminal domain containing 11 potential
N-glycosylation sites, a single membrane spanning domain and a 50 amino acid
long cytoplasmic domain. This latter contains a putative tyrosine- (YKPI) and
a putative di-leucine-based (ExxPLL) sorting signal analogous to those found
in many melanosomal proteins, and required for endosomal/lysosomal targeting
(Kirchhausen et al., 1997
; Le
Borgne and Hoflack, 1998a
; Le
Borgne and Hoflack, 1998b
;
Mellman, 1996
; Sandoval,
1994
; Simmen et al.,
1999
).
Despite these sequence homologies, the intracellular distribution and the intracellular trafficking of QNR-71 remains unknown. In this study, we have expressed epitopetagged versions of QNR-71 in pigmented and non-pigmented cells to determine its steady-state distribution. We show here that it localizes into peripheral endosomal/premelanosomal dotted structures in cells from the retinal pigmented epithelium (RPE) and to early and late endocytic compartments when ectopically expressed in HeLa cells. The di-leucine-based sorting motif is shown to be necessary and sufficient to mediate the transport of QNR-71 to these compartments. QNR-71 transport requires the AP-3 complex. Inhibition of AP-3 synthesis causes the misrouting of both endogenous LampI and QNR-71 to the cell surface. Moreover, ectopic expression of QNR-71 in HeLa cells is sufficient to reroute endogenous LampI to the plasma membrane. Together, these results suggest that melanosomal and lysosomal membrane glycoproteins share some aspects of membrane trafficking.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Antibodies
The
-subunit of AP-3 complex were decorated using an affinity
purified rabbit polyclonal antibody (a kind gift from Dr M. S. Robinson,
Cambridge) as previously described (Le Borgne et al.,
1998
). The 100/3 monoclonal
antibody directed against
-adaptin was from Sigma. Early
endosomal-associated antigen 1 (EEA1) was decorated with a mouse monoclonal
antibody (Transduction Laboratories, Lexington, KY). Human LampI was detected
using the H4A3 mouse monoclonal antibody (Developmental Hybridoma Bank, Iowa,
IA). Vesicular somatitis virus-G protein (VSV-G) was detected with a rabbit
polyclonal antibody (Alconada et al.,
1996
) or the P5D4 mouse
monoclonal antibody (a kind gift of Thomas Kreis). Man 6-P/IGF II receptor was
detected using a rabbit polyclonal antibody
(Méresse and Hoflack,
1993
). The anti gpI antibodies
were as described previously (Alconada et al.,
1996
). All secondary antibodies
against the Fc fragments of mouse and rabbit IgGs coupled to FITC or Texas Red
were from Jackson Laboratories (Immunotech, Marseille, France).
Cell culture and transfections
Dissociated cells from the retina pigmented epithelium (RPE) dissected from
8-day-old quail embryos were plated on gelatin-coated dishes in Dulbecco's/F12
medium containing 10% fetal calf serum, 1% vitamin modified Eagle's medium
100x and 10% conalbumin (complete medium).
HeLa cells (American Type Tissue Culture Collection, Rockville, MD) were
grown in
-minimum essential medium complemented with 10% fetal calf
serum, 2 mM glutamine, 100 units/ml penicillin and streptomycin. For
transfection, cells were split and grown onto coverslips the day before.
Transient transfections using the PEI reagent were performed as described by
the manufacturer. Briefly, cells were transfected for 12 hours with the
corresponding DNAs and allowed to express the chimeric proteins for 24 to 72
hours. Transient transfection using the recombinant vaccinia virus were
performed as described previously (Le Borgne et al.,
1998
). Briefly, the cells were
infected for 30 minutes with the vT7 recombinant virus and transfected for 1
hour with the different DNAs using the DOTAP reagent. The cells were allowed
to express the different chimeric proteins for 2 to 6 hours in the presence of
5 mM hydroxyurea to avoid cytopathic effects. Under these conditions, the bulk
of the expressed proteins is still present in the perinuclear compartments
(mostly the Golgi apparatus) and have not yet reached their final destination.
Part of the expressed proteins is also present at the cell surface, owing to
their overexpression (Figs 6,
7).
|
|
To inhibit the synthesis of the ubiquitously expressed µ3A chain of
AP-3, a combination of two antisense or sense phosphorothioate-modified
oligonucleotides were added to the cell culture medium at a final
concentration of 10 µM for 48 hours as previously reported (Le Borgne et
al., 1998
).
Plasmid construction and mutagenesis
To generate the VSV-G-QNR-71 chimera, the VSV-G tag was first cloned into
the unique Cell II site of the full-length wild-type QNR-71. The VSV-G tag was
made by annealing the following primers: forward primer,
5'TGAGCCCTTACACCGATATCGAGATGAACAGGCTGGGAAAGGAATGCG3'; reverse
primer, 3'CGGGAATGTGGCTATAGCTCTACTTGTCCGACCCTTTCCTTACGCACT5'. The
fragment was then digested with EcoRI/XhoI and cloned into
the same sites of the pcDNA3 vector (Invitrogen, San Diego, CA).
The L551G, L552G, and Y514A mutated versions of QNR-71 were obtained by PCR using the Quick Change kit (Stratagene, La Jolla, CA) using the wild-type QNR-71 as a template and the following primers: for the L551G mutagenesis, 5'CACTGAGAGAAATCCTGGATTGAAAAGCAAACCAGGCATC3'; for the L552G mutagenesis, 5'CACTGAGAGAAATCCTCTGGGCAAAAGCAAACCAGGCATC3'; for the Y514A mutagenesis, 5'CAAGAGATACAAACAAGCTAAGCCTATTGAGAGAAGTGCG3'.
All the mutants and chimeric molecules were verified by dideoxy sequencing.
For the gpI-QNR chimera, the following primers where used using the
gpI-
1 as a PCR template: forward primer gpI-1 (Alconada et al.,
1996
); and reverse primer,
5'AAGCTTTTAGCTTTTCAACAGAGGATTTCTCTCAGTGCTCTTAGGGAAGAAAAAGGCTTT3'.
The resulting PCR product was then cloned into the XbaI and
HindIII sites of the pSFFV or the pGEM-1 vectors.
Indirect immunofluorescence and image processing
Cells were processed for immunofluorescence as previously described (Le
Borgne et al., 1998
) and
observed using an axioplan 2 microscope (Zeiss, Jena, Germany) and a
63x/1.4 numerical aperture immersion oil lens. Images were captured
using a cooled charged-coupled device (CCD; Micromax from Princeton
Instruments; Trenton, NJ) that had a Kodak RTE/CCD-1317K/1 chip (grade 1) for
12 bit image collection and was controlled by the IpLab Spectrum (Signal
Analytics Corp., Vienna). To quantify AP-3 recruitment, randomly chosen fields
were captured using the Micromax camera. In every field, the
-adaptin
labeled areas from transfected and non-transfected cells were selected and the
flourescence intensity (mean intensity/pixel) was calculated using the IpLab
Spectrum software.
Pulse-chase experiments and immunoprecipitations
Cells from the RPE or HeLa cells grown on plastic were infected and
transfected as mentioned above. They were then pulse labeled for 30 minutes
with 0.2 mCi/ml of [35S] methionine/cysteine and chased for the
indicated time. Cells were then lysed for 30 minutes on ice in lysis buffer
(50 mM Tris, pH 7.4, 100 mM NaCl, 1% Triton X-100, 2 mM EDTA, 1 mM
phenylmethylsulfonyl fluoride and benzamidine, 5 µg/ml aprotinin and 1
µg/ml leupeptin) and spun for 15 minutes in an Eppendorf centrifuge. After
a pre-clearing with a preimmune rabbit serum, samples were incubated with the
indicated antibodies overnight at 4°C, spun for 15 minutes, and incubated
for 1 hour with protein A-Sepharose. After washes, the immune complexes were
resolved on 10% SDS-PAGE followed by fluorography.
| RESULTS |
|---|
|
|
|---|
|
|
We then determined the distribution of QNR-71 in non-pigmented human HeLa
cells. When transiently expressed in these cells, QNR-71 also distributed to
dotted structures. The localization of QNR-71 was then compared with that of
several known endocytic markers. First, QNR-71 was consistently detected in
EEA1-positive compartments (Mu et al.,
1995
), indicating that some
QNR-71 molecules were present in early endosomal compartments. This
distribution correlates with the partial co-localization of PMEL17, a
gene product related to QNR-71, with EEA1 observed in MNT-1 melanocytes
(Raposo et al., 2001
). QNR-71
also exhibits some partial co-localization with the LampI late
endosomal/lysosomal marker (Fig.
3c,d). Consistent with this, the VSV-G-tagged QNR-71 was found to
be more stable in HeLa cells than in pigmented quail cells
(Fig. 2c). We also observed a
partial co-localization with the Man-6-P/IGF II receptor
(Fig. 3e,f), which is mostly
present in the trans-Golgi network (TGN) in this cell type (S. Waguri and
B.H., unpublished). Treatment with 50 µg/ml of cycloheximide for 1 hour
before fixation led to an almost complete disappearance of QNR-71 from the
Man-6-P/IGF II receptor-positive structures (data not shown), indicating that
the TGN staining observed in untreated Hela cells most likely represents the
newly synthesized QNR-71 en route to endosomes. Thus, when ectopically
expressed in non-pigmented cells, QNR-71 behaves in a similar manner to
tyrosinase, the major melanogenic enzyme that is located in endocytic
organelles (Calvo et al., 1999
;
Simmen et al., 1999
).
|
QNR-71 transport and sorting signals
QNR-71 contains several potential sorting signals similar to those found in
proteins transported to endosomal compartments
(Fig. 1; Kirchhausen et al.,
1997
; Le Borgne and Hoflack,
1998b
; Mellman,
1996
; Sandoval,
1994
). Its cytoplasmic tail
contains a putative tyrosine-based motif (Y514KPI517).
There is also a di-leucine-based sorting motif with a negatively charged
residue in position -4 from the first leucine
(E547RNPLL552). A similar motif is present in other
melanosomal proteins such as tyrosinase (Calvo et al.,
1999
), the major melanogenic
enzyme, and TRP-1 (tyrosinase related protein-1) (Jimenez et al.,
1991
), PMEL17 (Kwon et al.,
1991
) and NMB (Weterman et
al., 1995
), and appears to be
evolutionary conserved (see Fig.
8; Calvo et al.,
1999
).
|
|
|
AP-3 distribution and expression of QNR-71
We and others have previously reported that recruitment of AP-1 or AP-3 can
be enhanced upon overexpression of selected transmembrane proteins (Alconada
et al., 1996
;
Dittié et al.,
1997
; Le Borgne et al.,
1993
; Le Borgne et al.,
1998
; Salamero et al.,
1996
; Teuchert et al.,
1999
). Therefore, QNR-71 was
overexpressed in HeLa cells using the T7-RNA polymerase recombinant vaccinia
virus as previously reported (Le Borgne et al.,
1998
). The cells were then
fixed, processed for indirect immunofluorescence using either a monoclonal
(Fig. 6c) or polyclonal
(Fig. 6a) anti-VSV-G antibody
to detect the transfected cells. Under these conditions, QNR-71 was mostly
found concentrated in a perinuclear compartment, as well as at the plasma
membrane, owing to its overexpression (Fig.
6, see Materials and Methods). The cells were also stained with a
monoclonal anti-
-adaptin antibody to detect the AP-1 complex
(Fig. 6b) or a polyclonal
anti-
-adaptin to detect the AP-3 complex
(Fig. 6d). As previously
reported for lysosomal glycoproteins, overexpression of QNR-71 did not lead to
any detectable effect on AP-1 distribution
(Fig. 6b). However,
overexpression of QNR-71 led to a significant increase in AP-3 staining onto
membranes both in the perinuclear region and on the peripheral punctuate
structures (Fig. 6d). Some of
these peripheral structures could be decorated with antibodies against the
EEA1 (data not shown). The expression of QNR-71 induces an approx. twofold
increase in the amount of endogenous AP-3 associated with membranes (see
Fig. 8). This AP-3 recruitment
was, as expected, totally sensitive to brefeldin A (data not shown). We also
overexpressed QNR-71 mutated on its tyrosine-based or on its di-leucine-based
motifs. Pulse-chase experiments indicated that these different mutants were
expressed at similar levels as the wild-type protein (data not shown). While
QNR-71 with a mutated tyrosine-based motif was still able to promote AP-3
recruitment onto membranes as efficiently as the wild-type protein, QNR-71
mutated on leucine 551 (Fig. 7)
or leucine 552 (not shown) failed to trigger AP-3 recruitment. A similar
increase in AP-3 bound to membranes was also observed upon expression of the
gpI-QNR-71 (data not shown), indicating that the di-leucine-based sorting
signal of QNR-71 is necessary and sufficient to promote AP-3 recruitment.
Inhibition of AP-3 synthesis and QNR 71 intracellular
trafficking
The results described above based on overexpression suggest that QNR-71,
like the Lamps and Limps (Dell' Angelica et al.,
1999
; Le Borgne et al.,
1998
), follows an AP-3
dependent pathway for its delivery into endosomal/premelanosomal compartments.
This interpretation would be consistent with the fact that expression of
QNR-71 results in a measurable missorting of endogenous LampI, as seen by
antibody uptake experiments (Fig.
9a,b,d,e), indicating that QNR-71 compete for the intracellular
targeting machinery required for the lysosomal delivery of LampI. Furthermore,
we have previously shown that inhibition of µ3A synthesis by antisense
oligonucleotides causes a rerouting of endogenous LampI towards the cell
surface. If QNR-71 follows an AP-3 dependent pathway, it could therefore be
anticipated that a decrease in the amount of functional AP-3 should affect its
intracellular targeting. As expected, endogenous LampI does not travel
significantly via the cell surface of untransfected cells that are treated (or
not) with sense-oligonucleotide, as judged by the inability to internalize
exogenously added anti-LampI antibodies
(Fig. 9a,b,d,e). In contrast,
inhibition of AP-3 synthesis results in a partial misrouting of LampI to the
cell surface in these cells (Fig.
9f). Cells expressing QNR-71 exhibit an even higher uptake of
anti-LampI antibody when treated with antisense oligonucleotides
(Fig. 9f). Anti VSV-G antibody
experiments indicate that QNR-71 is partially transiting via the cell surface
in every situation. Although we cannot ruled out the possibility that this
transport of QNR-71 to the cell surface could be an indirect effect of its
ectopic expression, it is interesting to note that endogenous PMEL17 also
transits to the cell surface in MNT-1 cells (Raposo et al.,
2001
). Thus, the cytoplasmic
tail of QNR-71 probably contains more sorting information than that of LampI.
Collectively, these results strongly argue that QNR-71, like the lysosomal
glycoprotein LampI, makes use of the AP-3 dependent pathway.
|
| DISCUSSION |
|---|
|
|
|---|
Intracellular distribution of QNR-71
QNR-71 was originally identified as a quail gene specifically expressed in
the pigmented layer of the retina and in the epidermis, as well as during
trans-differentiation of quail neuroretina cells after v-Myc transformation
(Turque et al., 1996
).
However, phenotypic pigmentation is not a prerequisite for QNR-71 expression
in the pigmented retina, as the corresponding transcripts are detected at
E3.5, before pigmentation occurs (Turque et al.,
1996
). QNR-71 distributes in
endosomal compartments, from early to late endocytic structures, in
non-pigmented HeLa cells. These results are in good agreement with recent
studies showing that tyrosinase exhibits a similar distribution in HeLa cells
(Calvo et al., 1999
) or MDCK
cells (Simmen et al., 1999
).
While QNR-71 was detected in lysosomes of HeLa cells, the protein was not
detected in mature stage IV melanosomes in pigmented cells under normal
conditions. As shown using ammonium chloride treatment, our results indicate
that QNR-71 partially reaches this compartment where it is possibly rapidly
degraded. A similar situation has been reported for PMEL17 in melan-A cells
(Kobayashi et al., 1994
). It
has been proposed that the cytoplasmic domain of PMEL17 is rapidly processed
upon arrival in melanosomes (t1/2 is approx. 1-2 hours), while the
luminal part of the protein would remain intact. The lysosomal acid
phosphatase has also been shown to be processed on its cytoplasmic domain
after transport to endosomal compartments (Gottschalk et al.,
1989
). We have also tested
this possibility for QNR-71 by expressing the protein containing an epitope
either at the N-terminal or C-terminal part. In both pigmented cells or HeLa
cells, no significant difference was observed in the stability of the
different constructs, suggesting that the entire protein is processed. As the
function of QNR-71, like that of PMEL17, is unknown, it is possible that they
exert a different function than simply being a matrix melanosomal protein. A
possibility is rather that QNR-71 resides in unpigmented stage I and II
melanosomes, as initially proposed for PMEL17 (Kobayashi et al.,
1994
; Lee et al.,
1996
). Interestingly, the gene
product related to QNR-71, PMEL17 distributes in premelanosomes of human
melanocytes and is almost excluded from stade IV melanosomes at the electron
microscopy level (Raposo et al.,
2001
). Therefore, it is
tempting to speculate that QNR-71 may localize into pre-melanosomal
compartments.
Sorting signals in QNR-71 cytoplasmic domain
Our mutational analysis indicates that a di-leucine-based motif present in
the cytoplasmic domain of QNR-71 is sufficient to mediate its intracellular
transport. A similar motif is found in the cytoplasmic domains of
transmembrane proteins highly related to QNR-71, such as the human NMB
(Weterman et al., 1995
) or
PMEL17 (Kwon et al., 1991
; see
Fig. 10). It can be predicted
that these motifs also determine their melanosomal targeting. Such a motif is
not only found in other melanosomal proteins such as tyrosinase (Calvo et al.,
1999
; Kwon et al.,
1987
, Simmen et al.,
1999
) or TRP-1 (Jimenez et
al., 1991
; Vijayasaradhi et
al., 1995
) but also in
lysosomal (LimpII; Ogata and Fukuda,
1994
; Sandoval et al.,
1994
) or vacuolar (Vam3p,
Alkaline phosphatase; Darsow et al.,
1998
) transmembrane proteins.
Mutation of this di-leucine motif results in the misrouting of QNR-71 to the
cell surface. A similar situation is probably found for PMEL17. Interestingly,
sequencing of the si locus from the coat color dilution mutant
silver mice revealed that the mutation results in the lost of the
di-leucine-based sorting motif in the cytoplasmic domain of PMEL17 (Kwon et
al., 1995
; Martinez-Esparza et
al., 1999
). While the function
of PMEL17, as well as that of QNR-71 in melanogenesis remains unknown, the
silver mutation results in the graying of coat hairs by causing a premature
loss of functional melanocytes in hair follicules (Kwon et al.,
1995
). Thus, the silver
mutation is likely to cause toxic effects to melanocytes analogous to those
caused by the phenotipically similar Blt mutation at the
Brown locus (TRP-1; Bennett et al.,
1990
). Although the reason for
this effect is not clear, it is possible that the mutated silver protein could
be recognized as a cell surface antigen by cytotoxic T-lymphocytes. Disorders
such as vitiligo are also thought to result from the unscheduled destruction
of melanocytes by immune mechanisms (Bakker et al.,
1994
; Kawakami et al.,
1994
). Thus, a default in
trafficking rather than a default in the proper function of PMEL17 might
result in melanocyte cell death.
|
Like QNR-71, several melanosomal proteins contain a tyrosine-based motif
located upstream or downstream of the di-leucine-based motif
(Fig. 10). As shown here for
QNR-71, this determinant is not required for their endosomal targeting. One
exception is TRP-2, which lacks the consensus ExxPLL but contains a GYT/APLM
sequence. A tyrosine-based signal preceded by a glycine residue has been shown
to mediate the lysosomal targeting of LampI (Guarnieri et al.,
1993
; Harter and Mellman,
1992
; Williams and Fukuda,
1990
). Thus, TRP-2 and LampI
could potentially share common sorting mechanisms, probably by interacting
with AP-3 whose µ subunit interacts with tyrosine-based sorting signals
(Ohno et al., 1998
).
AP-3-dependent transport of QNR-71
Our study suggests that QNR-71 is transported to endosomal compartments by
an AP-3-dependent mechanism. At the microscopic level, overexpression of
QNR-71 appears to promote the recruitment of AP-3 onto both perinuclear
membranes and EEA1-positive early endosomal compartments. However, no
detectable increase of bound AP-3 could be measured by western blotting on
purified membranes of cells expressing QNR-71 (data not shown). First, this
may be due to the presence of little amounts of AP-3 associated with membranes
at steady state or the partial dissociation of AP-3 from membranes during
sample preparations. Another possibility is that QNR-71 may only affect the
steady-state distribution of AP-3 that now relocalizes onto QNR-71-positive
structures that are better detected at the microscopic level. In any case, the
rerouting of endogenous LampI to the cell surface upon QNR-71 expression
indicates that QNR-71 and LampI compete for the same AP-3-dependent machinery.
Furthermore, the inhibition of AP-3 synthesis combined with the expression of
QNR-71 further increases the misrouting of both proteins via the cell
surface.
The recruitment/relocalization of AP-3 depends on an intact
di-leucine-based motif present in the ExxPLL sequence. No effect was observed
for the related AP-1 adaptor complex. Our results from this in vivo study
agree well with in vitro binding experiments showing that the cytoplasmic
domain of tyrosinase is able to interact with AP-3 using a di-leucine based
motif (Höning et al.,
1998
). They are also in good
agreement with the requirement for the ExxxLL sequence present in the
cytoplasmic domain of the alkaline phosphatase and in Vam3p for the
AP-3-dependent vacuolar protein sorting in yeast (Darsow et al.,
1998
). As AP-3 is also involved
in the intracellular transport of lysosomal glycoproteins (Dell'Angelica et
al., 1999
; Le Borgne et al.,
1998
), this adaptor complex
may function in the biogenesis of both lysosomes and melanosomes. Indeed,
although the major phenotypically visible effects of mutations in the
different subunits of AP-3 are pigmentation defects in the eye and other
tissues of Drosophila (Kretzschmar et al.,
2000
; Mullins et al.,
1999
; Ooi et al.,
1997
; Simpson et al.,
1997
), coat color dilution in
mice (Feng et al., 1999
;
Kantheti et al., 1998
; Zhen et
al., 1999
), or oculocutaneous
albinism (Hermandsky-Pudlak syndrome 2; Dell'Angelica et al.,
1999
), lysosomes and
platelet-dense granules are also abnormal (Spritz,
1999
; Swank et al.,
1998
).
The AP-3 pathway is evolutionary conserved from the yeast Saccharomyces
cerevisisiae (Cowles et al.,
1997
; Stepp et al.,
1997
; Vowels and Payne,
1998
) to high eukaryotic cells
(Dell'Angelica et al., 1999
;
Feng et al., 1999
; Kantheti et
al., 1998
; Le Borgne et al.,
1998
; Zhen et al.,
1999
). A basal level of
expression of the different AP-3 subunits is likely to be sufficient for
lysosomal targeting. However, melanogenesis requires the expression and
targeting of additional sets of enzymes involved in this process, including
tyrosinase, TRP-1 and TRP-2, and also several transporters such as tyrosine
and zinc transporters, leading to the accumulation of melanin inside newly
formed melanosomes. Thus, it is possible that AP-3 could be upregulated during
the process of melanogenesis. We have compared the expression levels of the
µ3- and
3a,b subunits of AP-3, in non-pigmented or pigmented quail
neuroretina cells at different stages of pigmentation. We did not observe any
significant differences in the level of expression of these two AP-3 subunits
(not shown). As the formation of pigments in melanoblasts requires around 14
days in culture, it would appear that, at least in this cell system the
transport machinery is expressed before the appearance of fully mature
melanosomes. Furthermore, some lysosomal and melanosomal glycoproteins follow
an AP-3-dependent pathway for their intracellular delivery in endocytic
structures. It could be envisaged that this part of the transport machinery is
common to both pathways. This would explain why there is no need to increase
the production of AP-3 complexes during melanogenesis. Later in the endocytic
pathway, the two classes of glycoproteins would be diverted away by different
means to allow the formation of two distinct organelles. Maybe only this
second step, for example, a maturation process that can be AP-3 independent,
would be melanocyte specific. A candidate gene for such a process in mice is
cappucino because defects in this gene cause a Hermanolsky-Pudlak
syndrome in which AP-3 is not involved (Gwynn et al.,
2000
). Other genes that could
function downstream of AP-3 such as lyst, pallid (a gene coding a syntaxin
13-interacting protein; Huang et al.,
1999
), or gunmetal, a gene
coding for a Rab geranyl-geranyl transferase, could also participate in
melanosome targeting (Selaturi, 2000; Swank et al., 2000).
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Alconada, A., Bauer, U. and Hoflack, B. (1996). A tyrosine-based motif and a casein kinase II phosphorylation site regulate the intracellular trafficking of the varicella-zoster virus glycoprotein I, a protein localized in the trans-Golgi network. EMBO J. 15,6096 -6110.
Bakker, A. B., Schreurs, M. W., de Boer, A. J., Kawakami, Y., Rosenberg, S. A., Adema, G. J. and Figdor, C. G. (1994). Melanocyte lineage-specific antigen gp100 is recognized by melanoma- derived tumor-infiltrating lymphocytes. J. Exp. Med. 179,1005 -1009.
Bennett, D. C., Huszar, D., Laipis, P. J., Jaenisch, R. and Jackson, I. J. (1990). Phenotypic rescue of mutant brown melanocytes by a retrovirus carrying a wild-type tyrosinase-related protein gene. Development 110,471 -475.
Calvo, P. A., Frank, D. W., Bieler, B. M., Berson, J. F. and Marks, M. S. (1999). A cytoplasmic sequence in human tyrosinase defines a second class of di- leucine-based sorting signals for late endosomal and lysosomal delivery. J. Biol. Chem. 274,12780 -12789.
Cowles, C. R., Odorizzi, G., Payne, G. S. and Emr, S. D. (1997). The AP-3 adaptor complex is essential for cargo-selective transport to the yeast vacuole. Cell 91,109 -118.
Darsow, T., Burd, C. G. and Emr, S. D. (1998). Acidic di-leucine motif essential for AP-3-dependent sorting and restriction of the functional specificity of the Vam3p vacuolar t-SNARE. J. Cell Biol. 142,913 -922.
Dell'Angelica, E. C., Shotelersuk, V., Aguilar, R. C., Gahl, W. A. and Bonifacino, J. S. (1999). Altered trafficking of lysosomal proteins in Hermansky-Pudlak syndrome due to mutations in the beta 3A subunit of the AP-3 adaptor. Mol. Cell 3, 11-21.
Dittie, A. S., Thomas, L., Thomas, G. and Tooze, S. A. (1997). Interaction of furin in immature secretory granules from neuroendocrine cells with the AP-1 adaptor complex is modulated by casein kinase II phosphorylation. EMBO J. 16,4859 -4870.
Feng, L., Seymour, A. B., Jiang, S., To, A., Peden, A. A., Novak, E. K., Zhen, L., Rusiniak, M. E., Eicher, E. M., Robinson, M. S. et al. (1999). The beta3A subunit gene (Ap3b1) of the AP-3 adaptor complex is altered in the mouse hypopigmentation mutant pearl, a model for Hermansky-Pudlak syndrome and night blindness. Hum. Mol. Genet. 8,323 -330.
Gottschalk, S., Waheed, A., Schmidt, B., Laidler, P. and von Figura, K. (1989). Sequential processing of lysosomal acid phosphatase by a cytoplasmic thiol proteinase and a lysosomal aspartyl proteinase. EMBO J. 8,3215 -3219.
Guarnieri, F. G., Arterburn, L. M., Penno, M. B., Cha, Y. and August, J. T. (1993). The motif Tyr-X-X-hydrophobic residue mediates lysosomal membrane targeting of lysosome-associated membrane protein 1. J. Biol. Chem. 268,1941 -1946.
Gwynn, B., Ciciotte, S.L., Hunter, S.J., Washburn, L.L., Smith, R.S., Andersen, S.G., Swank, R.T., Dell'Angelica, E.C., Bonifacino, J.S., Eicher, E.M. and Peters, L.L. (2000) Defects in the cappuccino (cno) gene on mouse chromosome 5 and human 4p cause hermansky-pudlak syndrome by an AP-3-independent mechanism. Blood 96,4227 -4235.
Harter, C. and Mellman, I. (1992). Transport of the lysosomal membrane glycoprotein lgp120 (lgp-A) to lysosomes does not require appearance on the plasma membrane. J. Cell Biol. 117,311 -325.
Hearing, V. J. (1999). Biochemical control of melanogenesis and melanosomal organization. J. Invest. Dermatol. Symp. Proc. 4,24 -28.
Höning, S., Sandoval, I. V. and von Figura, K. (1998). A di-leucine-based motif in the cytoplasmic tail of LIMP-II and tyrosinase mediates selective binding of AP-3. EMBO J. 17,1304 -1314.
Huang, L., Kuo, Y.M. and Gitschier, J. (1999) The pallid gene encodes a novel, syntaxin 13-interacting protein involved in platelet storage pool deficiency. Nat. Genet. 23,329 -332.
Jackson, I. J. (1997). Homologous pigmentation mutations in human, mouse and other model organisms. Hum. Mol. Genet. 6,1613 -1624.
Jimbow, K., Park, J.S., Kato, F., Hirosaki, K., Toyofuku, K., Hua, C. and Yamashita, T. (2000). Assembly, target-signaling and intracellular transport of tyrosinase gene family proteins in the initial stage of melanosome biogenesis. Pigment Cell Res. 13, 222-9.
Jimenez, M., Tsukamoto, K. and Hearing, V. J. (1991). Tyrosinases from two different loci are expressed by normal and by transformed melanocytes. J. Biol. Chem. 266,1147 -1156.
Kantheti, P., Qiao, X., Diaz, M. E., Peden, A. A., Meyer, G. E., Carskadon, S. L., Kapfhamer, D., Sufalko, D., Robinson, M. S., Noebels, J. L. et al. (1998). Mutation in AP-3 delta in the mocha mouse links endosomal transport to storage deficiency in platelets, melanosomes, and synaptic vesicles. Neuron 21,111 -122.
Kawakami, Y., Eliyahu, S., Delgado, C. H., Robbins, P. F., Sakaguchi, K., Appella, E., Yannelli, J. R., Adema, G. J., Miki, T. and Rosenberg, S. A. (1994). Identification of a human melanoma antigen recognized by tumor- infiltrating lymphocytes associated with in vivo tumor rejection. Proc. Natl. Acad. Sci. USA 91,6458 -6462.
King, R. A., Hearing, V. J., Creel, D. J. and Oetting, W. S. (1995) Albinism. In The Metabolic and Molecular Bases of Inherited Diseases. Vol. 3 (ed. C. R. Scriver, A. L. Baudet, W. S. Sly and D. Valle), pp.4353 -4392. McGraw-Hill: New York.
Kirchhausen, T., Bonifacino, J. S. and Riezman, H. (1997). Linking cargo to vesicle formation: receptor tail interactions with coat proteins. Curr. Opin. Cell Biol. 9,488 -495.
Kobayashi, T., Urabe, K., Orlow, S. J., Higashi, K., Imokawa, G., Kwon, B. S., Potterf, B. and Hearing, V. J. (1994). The Pmel 17/silver locus protein. Characterization and investigation of its melanogenic function. J. Biol. Chem. 269,29198 -29205.
Kretzschmar, D., Poeck, B., Roth, H., Ernst, R., Keller, A., Porsch, M., Strauss, R. and Pflugfelder, G.O. (2000) Defective pigment granule biogenesis and aberrant behavior caused by mutations in the Drosophila AP-3beta adaptin gene ruby. Genetics 155,213 -223.
Kwon, B. S., Chintamaneni, C., Kozak, C. A., Copeland, N. G., Gilbert, D. J., Jenkins, N., Barton, D., Francke, U., Kobayashi, Y. and Kim, K. K. (1991). A melanocyte-specific gene, Pmel 17, maps near the silver coat color locus on mouse chromosome 10 and is in a syntenic region on human chromosome 12. Proc. Natl. Acad. Sci. USA 88,9228 -9232.
Kwon, B. S., Halaban, R., Ponnazhagan, S., Kim, K., Chintamaneni, C., Bennett, D. and Pickard, R. T. (1995). Mouse silver mutation is caused by a single base insertion in the putative cytoplasmic domain of Pmel 17. Nucleic Acids Res. 23,154 -158.
Kwon, B. S., Haq, A. K., Pomerantz, S. H. and Halaban, R. (1987). Isolation and sequence of a cDNA clone for human tyrosinase that maps at the mouse c-albino locus. Proc. Natl. Acad. Sci. USA 84,7473 -7477.
Le Borgne, R. and Hoflack, B. (1998a). Mechanisms of protein sorting and coat assembly: insights from the clathrin-coated vesicle pathway. Curr. Opin. Cell Biol. 10,499 -503.
Le Borgne, R. and Hoflack, B. (1998b). Protein transport from the secretory to the endocytic pathway in mammalian cells. Biochim. Biophys. Acta 1404,195 -209.
Le Borgne, R., Schmidt, A., Mauxion, F., Griffiths, G. and Hoflack, B. (1993). Binding of AP-1 Golgi adaptors to membranes requires phosphorylated cytoplasmic domains of the mannose 6-phosphate/insulin-like growth factor II receptor. J. Biol. Chem. 268,22552 -22556.
Le Borgne, R., Alconada, A., Bauer, U. and Hoflack, B. (1998). The mammalian AP-3 adaptor-like complex mediates the intracellular transport of lysosomal membrane glycoproteins. J. Biol. Chem. 273,29451 -29461.
Lee, Z. H., Hou, L., Moellmann, G., Kuklinska, E., Antol, K., Fraser, M., Halaban, R. and Kwon, B. S. (1996) Characterization and subcellular localization of human Pmel 17/silver, a 110-kDa (pre)melanosomal membrane protein associated with 5,6,-dihydroxyindole-2-carboxylic acid (DHICA) converting activity. J. Invest. Dermatol. 106,605 -610.
Lloyd, V., Ramaswami, M. and Kramer, H. (1998). Not just pretty eyes: Drosophila eye-colour mutations and lysosomal delivery. Trends Cell Biol. 8,257 -259.
Martin, P., Carriere, C., Dozier, C., Quatannens, B., Mirabel, M. A., Vandenbunder, B., Stehelin, D. and Saule, S. (1992). Characterization of a paired box- and homeobox-containing quail gene (Pax-QNR) expressed in the neuroretina. Oncogene 7,1721 -1728.
Martinez-Esparza M., Jimenez-Cervantes C., Bennett D., Lozano J., Solano F., Garcia-Borron JC. (1999) The mouse silver locus encodes a single transcript truncated by the silver mutation. Mamm. Genome 10,1168 -1171.
Mellman, I. (1996). Endocytosis and molecular sorting. Annu. Rev. Cell Dev. Biol. 12,575 -625.
Méresse, S. and Hoflack, B. (1993). Phosphorylation of the cation-independent mannose 6-phosphate receptor is closely associated with its exit from the trans-Golgi network. J. Cell Biol. 120, 67-75.
Mochii, M., Agata, K. and Eguchi, G. (1991). Complete sequence and expression of a cDNA encoding a chicken 115-kDa melanosomal matrix protein. Pigment Cell Res. 4, 41-47.
Mu, F. T., Callaghan, J. M., Steele-Mortimer, O., Stenmark, H., Parton, R. G., Campbell, P. L., McCluskey, J., Yeo, J. P., Tock, E. P. and Toh, B. H. (1995). EEA1, an early endosome-associated protein. EEA1 is a conserved alpha- helical peripheral membrane protein flanked by cysteine `fingers' and contains a calmodulin-binding IQ motif. J. Biol. Chem. 270,13503 -13511.
Mullins, C., Hartnell, L. M., Wassarman, D. A. and Bonifacino, J. S. (1999). Defective expression of the mu3 subunit of the AP-3 adaptor complex in the Drosophila pigmentation mutant carmine. Mol. Gen. Genet. 262,401 -412.
Odorizzi, G., Cowles, C. R. and Emr, S. D. (1998). The AP-3 complex: a coat of many colours. Trends Cell Biol. 8,282 -288.
Ogata, S. and Fukuda, M. (1994). Lysosomal targeting of Limp II membrane glycoprotein requires a novel Leu-Ile motif at a particular position in its cytoplasmic tail. J. Biol. Chem. 269,5210 -5217.
Ohno, H., Aguilar, R. C., Yeh, D., Taura, D., Saito, T. and Bonifacino, J.S. (1998) The medium subunits of adaptor complexes recognize distinct but overlapping sets of tyrosine-based sorting signals. J. Biol. Chem. 273:25915 -26021.
Ooi, C. E., Moreira, J. E., Dell'Angelica, E. C., Poy, G., Wassarman, D. A. and Bonifacino, J. S. (1997). Altered expression of a novel adaptin leads to defective pigment granule biogenesis in the Drosophila eye color mutant garnet. EMBO J. 16,4508 -4518.
Orlow, S. J., Boissy, R. E., Moran, D. J. and Pifko-Hirst, S. (1993). Subcellular distribution of tyrosinase and tyrosinase-related protein- 1: implications for melanosomal biogenesis. J. Invest. Dermatol. 100, 55-64.
Raposo, G., Tenza, D., Murphy, D. M., Berson, J. F. and Marks, M. S. (2001). Distinct Protein sorting and localization to premelanosomes, melanosomes, and lysosomes in pigmented melanocytic cells. J. Cell Biol. 152,809 -824.
Salamero, J., Le Borgne, R., Saudrais, C., Goud, B. and Hoflack, B. (1996). Expression of major histocompatibility complex class II molecules in HeLa cells promotes the recruitment of AP-1 Golgi-specific assembly proteins on Golgi membranes. J. Biol. Chem. 271,30318 -30321.
Sandoval, I. V., Arredondo, J. J., Alcalde, J., Gonzalez Noriega, A., Vandekerckhove, J., Jimenez, M. A. and Rico, M. (1994). The residues Leu(Ile)475-Ile(Leu, Val, Ala)476, contained in the extended carboxyl cytoplasmic tail, are critical for targeting of the resident lysosomal membrane protein LIMP II to lysosomes. J. Biol. Chem. 269,6622 -6631.
Sandoval, I. V. a. B., O. (1994). Targeting of membrane proteins to endosomes and lysosomes. Trends Cell Biol. 4,292 -297.
Seiji, M., Fitzpatrick, T. M., Simpson, R. T. and Birbeck, M. S. C. (1963) Chemical composition and terminology of specialized organelles (melanosomes and melanin granules) in mammalian melanocytes. Nature 197,1082 -1084.
Setaluri, V. (2000) Sorting and targeting of melanosomal membrane proteins: signals, pathways, and mechanisms. Pigment Cell Res. 13,128 -34.
Simmen T., Schmidt A., Hunziker W., Beermann F. (1999) The tyrosinase tail mediates sorting to the lysosomal compartment in MDCK cells via a dileucine and a tyrosine-based signal. J. Cell Sci. 112:45 -53.
Simpson, F., Peden, A. A., Christopoulou, L. and Robinson, M. S. (1997). Characterization of the adaptor-related protein complex, AP-3. J. Cell Biol. 137,835 -845.
Spritz, R. A. (1999). Multi-organellar disorders of pigmentation: intracellular traffic jams in mammals, flies and yeast. Trends Genet. 15,337 -340.
Stepp, J. D., Huang, K. and Lemmon, S. K. (1997). The yeast adaptor protein complex, AP-3, is essential for the efficient delivery of alkaline phosphatase by the alternate pathway to the vacuole. J. Cell Biol. 139,1761 -1774.
Swank, R. T., Novak, E. K., McGarry, M. P., Rusiniak, M. E. and Feng, L. (1998). Mouse models of Hermansky Pudlak syndrome: a review. Pigment Cell Res. 11, 60-80.
Teuchert, M., Schafer, W., Berghofer, S., Hoflack, B., Klenk, H. D. and Garten, W. (1999). Sorting of furin at the trans-Golgi network. Interaction of the cytoplasmic tail sorting signals with AP-1 Golgi-specific assembly proteins. J. Biol. Chem. 274,8199 -8207.
Turque, N., Denhez, F., Martin, P., Planque, N., Bailly, M., Begue, A., Stehelin, D. and Saule, S. (1996). Characterization of a new melanocytespecific gene (QNR-71) expressed in v-myc-transformed quail neuroretina. EMBO J. 15,3338 -3350.
Vijayasaradhi, S., Xu, Y., Bouchard, B. and Houghton, A. N. (1995). Intracellular sorting and targeting of melanosomal membrane proteins: identification of signals for sorting of the human brown locus protein, gp75. J. Cell Biol. 130,807 -820.
Vowels, J. J. and Payne, G. S. (1998). A dileucine-like sorting signal directs transport into an AP-3- dependent, clathrin-independent pathway to the yeast vacuole. EMBO J. 17,2482 -2493.
Weterman, M. A., Ajubi, N., van Dinter, I. M., Degen, W. G., van Muijen, G. N., Ruitter, D. J. and Bloemers, H. P. (1995). nmb, a novel gene, is expressed in low-metastatic human melanoma cell lines and xenografts. Int. J. Cancer 60, 73-81.
Williams, M. A. and Fukuda, M. (1990). Accumulation of membrane glycoproteins in lysosomes requires a tyrosine residue at a particular position in the cytoplasmic tail. J. Cell Biol. 111,955 -966.
Zhen, L., Jiang, S., Feng, L., Bright, N. A., Peden, A. A., Seymour, A. B., Novak, E. K., Elliott, R., Gorin, M. B., Robinson, M. S. et al. (1999). Abnormal expression and subcellular distribution of subunit proteins of the AP-3 adaptor complex lead to platelet storage pool deficiency in the pearl mouse. Blood 94,146 -155.
This article has been cited by other articles:
![]() |
S. R. G. Setty, D. Tenza, S. T. Truschel, E. Chou, E. V. Sviderskaya, A. C. Theos, M. L. Lamoreux, S. M. Di Pietro, M. Starcevic, D. C. Bennett, et al. BLOC-1 Is Required for Cargo-specific Sorting from Vacuolar Early Endosomes toward Lysosome-related Organelles Mol. Biol. Cell, March 1, 2007; 18(3): 768 - 780. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hoashi, J. Muller, W. D. Vieira, F. Rouzaud, K. Kikuchi, K. Tamaki, and V. J. Hearing The Repeat Domain of the Melanosomal Matrix Protein PMEL17/GP100 Is Required for the Formation of Organellar Fibers J. Biol. Chem., July 28, 2006; 281(30): 21198 - 21208. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Lepage and R. Lapointe Melanosomal Targeting Sequences from gp100 Are Essential for MHC Class II-Restricted Endogenous Epitope Presentation and Mobilization to Endosomal Compartments Cancer Res., February 15, 2006; 66(4): 2423 - 2432. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. F. Tse, M. Jeffers, V. A. Pollack, D. A. McCabe, M. L. Shadish, N. V. Khramtsov, C. S. Hackett, S. G. Shenoy, B. Kuang, F. L. Boldog, et al. CR011, a Fully Human Monoclonal Antibody-Auristatin E Conjugate, for the Treatment of Melanoma Clin. Cancer Res., February 15, 2006; 12(4): 1373 - 1382. [Abstract] [Full Text] [PDF] |