|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
RESEARCH ARTICLE |
1
Departments of Biological Sciences, Anatomy & Cell Biology, and Pathology,
Colleges of Arts & Sciences and Physicians & Surgeons, Columbia
University, 1212 Amsterdam Avenue, New York, NY 10027-2450, USA
2
Integrated Program in Cell, Molecular & Biophysical Studies, College of
Physicians & Surgeons, Columbia University, 1212 Amsterdam Avenue, New
York, NY 10027-2450, USA
3
Department of Biological Sciences, Graduate School of Science, Tokyo
Metropolitan University, 1-1 Minami-ohsawa, Hachiohji, Tokyo 192-0397,
Japan
*
Author for correspondence
(e-mail:jcb4{at}columbia.edu
)
Accepted May 2, 2001
| SUMMARY |
|---|
|
|
|---|
Key words: Phosphorylation, Microtubule binding, Microtubule dynamics, Stable microtubules, Mitosis
| INTRODUCTION |
|---|
|
|
|---|
Consistent with this hypothesis, MAP4's level of phosphorylation has been
shown to increase at the G2/M transition
(Vandré et al.,
1991
). In vitro, MAP4
interacts directly with cyclin B-cdc2, the major kinase responsible for
mitosis-specific phosphorylation of structural proteins (Ookata et al.,
1995
). In addition, in vivo
phosphorylation of MAP4 by cyclin B-cdc2 has been shown to occur at numerous
sites throughout the molecule (Ookata et al.,
1997
). Phosphorylation of MAP4
by cyclin B-cdc2 kinase renders MTs more dynamic in vitro, apparently by
decreasing the frequency of rescue (Ookata et al.,
1995
). This mechanism is
consistent with the observed in vivo behavior of MTs during mitosis in
mammalian cells.
Mitotic behavior of MAP4 homologs has been studied both in mammalian cells
and in Xenopus. However, the Xenopus MAP4 homolog (XMAP4;
XMAP230) (Cha et al., 1999
;
Andersen et al., 1994
; Shiina
et al., 1992
) shows only
limited sequence identity with mammalian MAP4 (
30% sequence identity
between Xenopus and human MAP4) (Shiina et al.,
1999
; Andersen,
2000
). Other data suggest that
there may also be mechanistic differences between the cellular actions of
these homologs. For example, XMAP4 was reported to dissociate from MTs during
mitotic prophase (Andersen et al.,
1994
), in contrast to mammalian
MAP4, which remains associated with MTs throughout the cell cycle (Bulinski
and Borisy, 1980
; Olson et al.,
1995
). However, it should be
noted that other investigators (Cha et al.,
1999
; Shiina et al.,
1999
) demonstrated continuous
association of XMAP4 with MTs during mitosis. Because human MAP4 is a
MT-stabilizing protein that is continuously localized on MTs throughout the
cell cycle, we and others have hypothesized that mitosis-specific
phosphorylation of MAP4 toggles its MT stabilizing function during portions of
the cell cycle.
Accordingly, we focused on phosphorylation events within MAP4's MT-binding
domain. We previously showed that cyclin B-cdc2 kinase phosphorylates
serine-787 in vivo during mitosis (Ookata et al.,
1997
), and that in vitro
phosphorylation by cyclin B-cdc2 is sufficient to reduce MAP4's capacity to
stimulate in vitro polymerization of MTs (Kitazawa et al.,
2000
). By contrast, we showed
that serine-696 is continually phosphorylated throughout the cell cycle in
proliferating cells (Ookata et al.,
1997
), whereas phosphorylation
at this site is not detectable in quiescent, serum-starved cells (Srsen et
al., 1999
). Because we
predicted that phosphorylation at sites within the MT-binding domain would
manifest effects on MT dynamics, we focused on the function of MAP4
phosphorylation at the serine-696 and -787 sites.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Preparation of stable cell lines overexpressing wild-type and mutant
MAP4
MAP4 cDNA was mutated at amino acids serine-696 and serine-787 and inserted
into pEGFP-C1 vector, modified to be dexamethasoneinducible. Full-length MAP4
cDNA encoding the five-repeat isoform of human MAP4 (isoform IV; Chapin et
al., 1995
) was mutagenized
using the Muta-Gene in vitro Mutagenesis Kit (Biorad, CA) and the following
primers for the S696A/S787A (AA-MAP4) construct:
AACAAGGAGCTCCCACCAGCCCCAGAG and
TGGCTTGGATGGTGCGGCCCGCTT. Corresponding primers for S696K/S787K and
S696E/S787E were substituted, respectively, with AAA/TTT and GAG/CTC at the
positions underlined in the AA-MAP4 primers. All mutant and wild-type MAP4
cDNAs were then cut with SmaI and partially digested with
BglII, which deleted the N-terminal 669 amino acids corresponding to
the projection domain. Each fragment was then cloned into a modified pEGFP-C1
(Clontech, CA), generated by replacing its promoter with MMTV-LTR, a
dexamethasone (dex)-inducible promoter from the pMAMneo vector (Clontech, CA).
Transfection of wild-type and mutant MAP4 into mouse fibroblast
Ltk- cells (ATCC, MD) and selection of stably transfected cell
lines were performed according to protocols described previously (Nguyen et
al., 1997
). Cell lines were
induced to express WT or mutant forms of MAP4 by adding 1 µM dex for 36
hours prior to analysis.
Quantification of MT polymer
Following induction with dex, confluent cell monolayers containing equal
numbers of cells in 60 mm dishes were washed once with Earle's buffered salt
solution (EBSS) at 37°C and extracted with and without saponin (200
µg/ml) in PEM buffer (100 mM PIPES, pH 6.9, 5 mM MgCl2, 1 mM
EGTA) for 2 minutes at 37°C. Cells were scraped off the plates in SDS-gel
sample buffer and boiled for 5 minutes. Identical volumes of sample buffer
were added to pellets containing total cell protein (extracted in PEM alone)
and MT polymer (extracted in PEM with saponin). Western blots of 20 µg
extract protein (Chapin and Bulinski,
1991
), stained with
anti-ß-tubulin antibody (3F3, courtesy of James Lessard, University of
Cincinnati, OH), were scanned with an HP ScanJet 6200C scanner and intensities
of each immunostained band determined with MetaMorph software (Universal
Imaging Corp., West Chester, PA). The percentage of tubulin in polymer was
defined as the ratio (tubulin in MT polymer sample):(tubulin in total protein
extract).
Analysis of cell growth and phenotype
Cells in 100 mm tissue culture plates, induced with dex, were released from
the substratum with Viokase solution, and counted in a haemocytometer before
and after an additional 36 hours of growth. Cell cycle stages of each cell
line were determined following 36 hours of dex-induction on coverslips. The
coverslips were fixed in ice-cold methanol for 15 minutes, mounted in the
presence of 1 µg/ml DAPI, and cell cycle stages were determined by scoring
GFP-MAP4-labeled spindles and DAPI-labeled condensed chromosomes.
Fluorescence-activated cell sorting (FACS) was performed as previously
described (Nguyen et al.,
1999
).
Assay of MT stability
Following dex induction, cells on coverslips were incubated in medium
containing the MT-depolymerizing drug nocodazole (10 µM) for 0-30 minutes
at 37°C, washed once with Hanks' Balanced Salt Solution (HBSS) containing
10 µM nocodazole, and immediately fixed in ice-cold methanol for 15
minutes. GFP-expressing cells were scored for the presence of a MT array at
each time of nocodazole treatment. Since all expressing cells showed an
extensive MT array initially (T=0) and no MTs at T=30, the proportion of
expressing lines with a MT array at the 10-minute time point (t=10), when a
disparity was noted, was quantified.
Affinity of mutant and wild-type GFP-MAP4 forms for MTs
Suspension cultures of each stably transfected cell line, induced with 1
µM dex for 20-28 hours, were used to prepare Taxol-stabilized MTs, as
described previously (Chapin et al.,
1991
). After washing MT pellets
four times in buffer containing 0.1 M PIPES, pH 6.9, 1 mM dithiothreitol, 1 mM
EGTA and 1 mM MgCl2 (PDEM), the MTs were resuspended in fresh PDEM
plus the applicable concentration of NaCl (0-0.6 M), incubated for 10 minutes
at 37°C, and centrifuged (40,000 g, 15 minutes).
Supernatant fractions containing unbound MAP were assayed by western blotting
with guinea pig antibodies prepared against the MT-binding domain of human
MAP4 (MTB antibody; Nguyen et al.,
1997
) or to the bacterially
expressed prolinerich domain of murine MAP4 (MuPro antibody; used at 1:1000
dilution). MAP4 released at each salt concentration was quantified and
normalized to that eluted with 0.6 M NaCl, which was set at 100%.
| RESULTS |
|---|
|
|
|---|
|
|
Phosphorylation mutants of MAP4 colocalize with apparently normal MT
arrays in vivo
Human MAP4 with serines at positions 696 and 787 (WT) or with residues 696
and 787 mutated to alanines (AA, imparting a neutral charge), lysines (KK,
introducing two constitutive positive charges) or glutamates (EE, adding two
constitutive negative charges, mimicking phosphorylation) were cloned into
pEGFP-C1. Since MAP4 is believed to bind to MTs through ionic interactions
(Vallee, 1982
; Ookata et al.,
1995
), we hypothesized that
substitution of amino acids of different charges within the MAP4 MT-binding
domain might change MAP4's binding to and stabilization of MTs. To simplify
interpretation of phenotypes caused by altered phosphorylation, in each mutant
and wild-type construct we also deleted the N-terminal 669 amino acids (i.e.
most of the projection domain of MAP4), which is known to contain additional
phosphorylation sites (Ookata et al.,
1997
).
We were unable to isolate Ltk- stable transfectants that constitutively expressed any of the GFP-MAP4 forms. Transfectants appeared to exhibit a growth disadvantage, and were consequently overgrown quickly by non-expressing cells (data not shown). For this reason, we cloned a dexamethasone (dex)-inducible promoter sequence from pMAMneo into pEGFP-C1 along with the MAP4 wild-type and mutant constructs. Stably transfecting this construct into Ltk- cells yielded Ltk- cells whose expression of MAP4 forms was inducible. Interestingly, cells expressing any of the dex-inducible mutant MAP4 forms decreased expression by at least twofold after three days of induction in dex. By contrast, there was no detectable decrease in GFP-MAP4 expression observed after dex-induction of WT-MAP4 for an identical period (data not shown). This was the first suggestive evidence that expression of the MAP4 mutants was more deleterious to cell growth than expression of WT-MAP4. Because of these observations, we induced cells expressing each construct with dex for 24-36 hours in all experiments.
We localized both WT and mutant MAP4 forms in vivo by imaging the fluorescence of the GFP attached to each. All transfected MAP4 species localized to MTs, and the pattern of those MTs was unremarkable when compared with MTs in untransfected cells, visualized via tubulin immunofluorescence (Fig. 3A). The morphology of the transfectants was also indistinguishable from that of untransfected cells. In mitotic cells, both wild-type and mutant MAP4 forms were localized to spindle MTs throughout cell division; spindles appeared to be normal in morphology. Note that in the images in Fig. 3A, since the GFP-EE-MAP4 fluorescence is weak to start with and weaker after the fixation, which is necessary for performing immunofluorescence, regions with dense or bundled MTs are accentuated. By contrast, from live cell imaging, in which single MTs are better visualized, it was clear that the MT array in EE-MAP4 cells is indistinguishable from that of naive or WT-MAP4 cells (data not shown).
|
|
We determined that the tubulin content of each transfectant line was
indistinguishable from the other transfectants or from naive Ltk-
cells (determined as a proportion of total soluble protein, shown in
Fig. 3B). These data are
consistent with results of a previous study of four cell lines induced to
express varying levels of wild-type MAP4 (full- or partial-length); only the
line whose MAP4 expression level was eightfold higher than the level
endogenous to HeLa cells showed any increase in tubulin level (Nguyen et al.,
1997
). In cells expressing
MAP4 mutant forms, the proportion of tubulin that was polymeric was similar in
all of the transfected cell lines (Table
1), again consistent with previous results on MAP4 transfected
cells. Thus, expression of modest levels of mutant MAP4 forms in
Ltk- cells did not significantly alter cell morphology, content of
tubulin, or appearance of the MT array, nor did it affect the distribution of
the MAP4 itself, during the cell cycle.
Expression of MAP4 mutants alters cell cycle progression
Next, we measured the growth rate of each transfectant line to determine if
expression of mutant MAP4 species changed cell growth properties. Cell
doubling times of 28-30 hours were measured for all lines, regardless of the
mutant or its expression level (Table
2). Because growth rate data could be skewed by the growth of
non-expressing cells within the population, we analyzed the cell cycle
further, using FACS. As shown in Table
2, cells expressing a medium-level of EE-MAP4 exhibited a higher
proportion of cells in G1 phase and a lower proportion in
G2/M phase, suggesting that EE-MAP4 mutant cells either transit
G1 phase more slowly or pass through G2/M phase more
quickly, or both, as compared with cells expressing WT-MAP4 or other mutant
MAP4 species.
|
FACS analysis is only amenable to the quantification of progression through three broadly defined categories of cell cycle events, that is, G1, G2/M, and S phases. To delineate cell cycle progression of individual cells more precisely, we used the localization pattern of their GFP fluorescence to assay each MAP4-expressing transfectant morphologically. We scored the proportion of log phase MAP4-expressing cells that contained mitotic spindles, separated centrosomes with an intact interphase MT array and condensed chromatin, and midbodies connecting daughter cells. These three morphologically-defined categories corresponded to cells in M phase, in late G2 or the G2/M transition, and in early G1 phase, respectively. As shown in Fig. 4, KK-MAP4 cells possessed more than twice the proportion of cells in the late G2 stage compared with any other cell line, suggesting that KK-MAP4 cells transit the G2/M transition half as quickly as cells expressing the other MAP4 mutants. By contrast, neither the duration of transit through M-phase itself, nor through early G1 differed significantly among the cell lines. Note that the morphological scoring of the low-expressing EE-MAP4 clone showed a higher proportion of cells in all three stages. Because these are very faintly expressing cells, we believe that this measurement is an artifact caused by the difficulty of scoring dimly fluorescent cells. In these cells, EE-GFP-MAP4 fluorescence may have been more readily detectable when it was concentrated into discrete structures such as separated centrosomes, spindles and midbodies.
|
Phosphorylation-site mutations alter MAP4's binding to MTs
A possible explanation for the increased abundance of late G2
stage cells in KK-MAP4 cell lines is that the KK-MAP4 mutant is a more potent
stabilizer of MTs than other MAP4 forms. KK-MAP4 would be expected to
stabilize MTs more effectively than other forms if it bound to MTs more
tightly. If this were the case, the interphase MT array containing these
stable MTs might break down more slowly, and this could result in a delayed
progression through late G2 and into M phase, as we observed for
KK-MAP4-expressing cells. Accordingly, we tested the MT-binding properties of
the MAP4 mutant forms, exploiting the capacity of MAP4, which binds ionically
to MTs, to be eluted from Taxol-stabilized MTs with moderate salt
concentrations (Vallee, 1982
).
By quantifying the efficacy of various concentrations of salt in eluting MAP4
from crude MTs, we assessed how tightly each MAP4 mutant form bound to MTs.
Unlike a conventional affinity measurement, this assay, which relied upon MTs
assembled in cell extracts, did not require the availability of pure
proteins.
Results of the salt-elution assay (Fig. 5C) showed that KK-MAP4 bound to MTs more tightly than any other MAP4 form, mutant or WT (P<0.05 at salt concentrations <0.3 M). AA-MAP4 bound less tightly than KK-MAP4, but significantly more tightly than WT-MAP4 or EE-MAP4 (e.g. P<0.05 at salt concentrations <0.25 M). MT binding of the latter two forms was indistinguishable from one another, or from the endogenous (murine) MAP4 in Ltk- cells (Fig. 5B).
|
Stability of MT polymer is altered by expression of MAP4 mutants
Inducing expression of transfected MAP4, either mutant or wild-type forms,
did not significantly alter either the total amount of tubulin in the cells
(Fig. 3) or the proportion of
tubulin that existed in the polymeric state
(Table 1). However, from
MT-binding data described above, in which KK-MAP4 and AA-MAP4 exhibited
tighter in vitro binding to MTs than either WT- or EE-MAP4, one might predict
that these mutants would show corresponding differences in MT stabilization in
vivo, that is, in the stability or longevity of their MTs. To test for
differences in MT stabilization, we measured the capacity of MAP4 mutant forms
to protect MTs from in vivo depolymerization by the MT-depolymerizing drug,
nocodazole.
We assayed the nocodazole sensitivity of MTs to determine whether any of the cell lines expressing MAP4 mutants possessed MTs that differed in their sensitivity to nocodazole. This assay entailed exposing cells, all of which initially contained the same quantity of MT polymer, to nocodazole in cell culture medium for a limited time (10 µM, 10 minutes), and then scoring individual cells for the presence or absence of a nocodazole-resistant array of MTs. Table 3 shows that, of the four MAP4 forms, cells expressing AA-MAP4 were least sensitive to nocodazole, followed by those expressing KK-MAP4. MTs in either WT or EE-MAP4 cells were equivalent to each other in their nocodazole-sensitivity, and they were significantly more nocodazole-sensitive than MTs in cells expressing AA- or KK-MAP4 (P<0.05 for each line). These results are consistent with MT binding data for the two mutants and suggest that MT stability can be varied by altering the charge of residues within the MAP's MT-binding domain.
|
| DISCUSSION |
|---|
|
|
|---|
In contrast to single-cell assays, neither measurements of population doubling times nor FACS analysis detected any differences in cell cycle progression among cells expressing the MAP4 mutants. This is not surprising since these methods are not sufficiently sensitive to detect differences of only 15-30 minutes, within a 28-30 hour cell cycle time. All transfectants showed heterogeneous expression levels of MAP4 mutant forms, no matter whether the cells had been cloned, drug-selected, or pre-sorted by FACS. Diversity in expression would tend to obscure differences in average growth rate of the population. Similarly, bulk analyses by FACS, which demarcates only three cell cycle stages, would not be expected to discriminate as finely among defined cell cycle stages as would morphological analysis of individual cells.
Expression of MAP4 mutants with differently charged residues also allowed
us to test the hypothesis that the phosphorylation state of MAP4's MT-binding
domain modulates its strength of MT binding and ultimately, its ability to
stimulate MT polymerization. Specifically, we predicted that mutation of
ser-696 and ser-787 to positively charged lysines (KK-MAP4) would increase the
affinity of positively charged MAP4 for negatively charged tubulin within the
MT. Conversely, we proposed that adding negatively charged glutamic acid
residues to mimic the phosphorylated state of wild-type MAP4 (EE-MAP4) might
decrease the affinity of MAP4 for MTs. Our results showed that, among the MAP4
mutants, KK-MAP4 indeed displayed the tightest binding to MTs, followed by
neutrally charged AA-MAP4. EE-MAP4 bound the least tightly, which was also as
expected. However, EE-MAP4's binding profile was indistinguishable from that
of WT-MAP4. The similarity in behavior of EE- and WT-MAP4 was consistent with
previous findings that ser-696 in wild-type MAP4 is continuously
phosphorylated throughout interphase (Ookata et al.,
1997
). This result also
implies that the phosphorylation state of ser-696 impacts more on binding
strength of MAP4 than does the phosphorylation state at ser-787.
Both KK-MAP4 and AA-MAP4 bound more tightly to MTs than did WT-MAP4 in the salt elution assay, and both KK- and AA-MAP4 showed greater in vivo MT stabilizing activity than WT-MAP4 in the nocodazole depolymerization assay. However, KK-MAP4 bound to MTs more tightly than AA-MAP4, whereas AA-MAP4 showed greater in vivo MT stabilization than KK-MAP4. We are uncertain why the binding and stabilization activities of KK-MAP4 and AA-MAP4 were not better correlated. One possibility is that the extra positively charged residues in KK-MAP4 resulted in higher MT affinity but also brought about conformational changes that led to less optimal MT stabilization.
MAP4 homologs exist in many species, including humans, cow, chicken, mouse
and, more recently discovered, Xenopus. The Xenopus MAP4
homolog, XMAP230 (XMAP4), shows only 30% sequence identity with mammalian
MAP4, possibly explaining behavioral differences between it and mammalian
MAP4. For example, injecting XMAP4 function-blocking antibodies into
Xenopus blastomeres disrupted assembly of mitotic spindles (Cha et
al., 1999
), whereas removal of
human MAP4 from MTs by function-blocking antibodies, its depletion by
antisense, or its overexpression in mammalian cells did not detectably affect
spindle formation (Wang et al.,
1996
; Nguyen et al.,
1997
; Yoshida et al.,
1996
; Olsen et al., 1995;
Nguyen et al., 1999
). Finally,
XMAP4 and mammalian MAP4 also differ in the effects each manifests on the
parameters of MT dynamics: XMAP4 was found to increase MT growth rate,
decrease the rate of MT shrinkage, and suppress catastrophes in vitro
(Andersen et al., 1994
),
whereas human MAP4 was shown to increase the frequency of rescue events in
vitro under steady-state conditions (Ookata et al.,
1995
).
Shiina et al. used Xenopus cultured cells to test the effects of
mutating ten XMAP4 consensus sites for cyclin B-cdc2 or MAP kinase, including
sites homologous in position and sequence to human ser-696 and ser-787 (Shiina
et al., 1999
). Mutating a
minimum of six cyclin B-cdc2 consensus sites within the projection domain
(i.e. not including the sites homologous to human ser-696 and ser-787)
affected chromosome separation during mitotic anaphase A. In particular,
Shiina et al. observed that chromosome segregation towards spindle poles was
pre-empted by spindle elongation in about 20% of mitotic cells; they also
observed a phenomenon they termed `back-and-forth peristaltic movement',
whereby multiple cleavage furrows prematurely formed prior to spindle
elongation and appeared to push the spindle from one side to another (Shiina
et al., 1999
). These
experiments show that the projection domain of Xenopus MAP4 and/or
its appropriate phosphorylation is required for some aspect of anaphase
chromosome separation.
It is appropriate to compare our results with those Shiina et al. obtained
when they mutated the two MT-binding region sites in XMAP that are homologous
to human ser-696 and ser-787, as well as six of the projection domain
phosphorylation sites of XMAP discussed above (Shiina et al.,
1999
). Mutants of all eight
sites phenotypically resembled mutants of the six projection domain sites
alone, suggesting that the phenotype(s) of MT-binding site mutations were
obscured by the striking phenotypic defects that arose from mutations in the
projection domain sites. Therefore, we tested the role(s) of phosphorylation
of MT-binding domain sites directly, focusing specifically on ser-696 and
ser-787. As expected, mutating these two residues in each of three possible
ways yielded more subtle, yet mechanistically more understandable effects than
those Shiina et al. observed for their XMAP projection domain mutants (Shiina
et al., 1999
). We can only
speculate on whether expression of XMAP4 MT-binding domain mutants would yield
the same phenotypes we observed for human MAP4 MT-binding domain mutants,
since no one has yet dissected the role(s) of the MT-binding domain sites of
XMAP4. Since the MT-binding domain functions not only in binding to, but also
in stabilizing MTs, cells may use subtle modulation of MT-binding activity in
concert with other changes in MAPs or MTs to fully effect the MT transitions
needed for error-free mitosis.
Others have studied phosphorylation of MAP4 by other kinases, such as
protein kinase C (Mori et al.,
1991
), MAP kinase (Shiina et
al., 1992
; Hoshi et al.,
1992
), and MARK (Ebneth et al,
1999
; Illenberger et al.,
1996
). These data, as well as
the large number of spots detected in 2D phosphopeptide mapping of MAP4
(Shiina et al., 1992
; Ookata
et al., 1997
; Andersen et al.,
1994
; Mori et al.,
1991
; Illenberger et al.,
1996
) show that MAP4 undergoes
multiple phosphorylation events involving several kinases, in addition to
phosphorylation of ser-696 and ser-787 sites. Indeed, Ookata et al. showed
that, in human MAP4, at least six additional sites, some within the MT-binding
domain and some not, are phosphorylated in vivo during M-phase (Ookata et al.,
1997
). These phosphorylation
events may be carried out by cyclin B-cdc2, by other kinases studied in vitro,
or by kinases not yet identified. Determining the effects of each
phosphorylation event on mitosis or MT function is a complicated and daunting
task.
Because expression of mutants showed that phosphorylation at each site
affected MT stability and MAP binding, it may be informative to perform
time-lapse studies to observe how each affects MT dynamics. MAP4 was
previously shown in vitro to affect MT dynamics by increasing the frequency of
rescue, that is, the transition between MT depolymerization and pausing or
polymerization (Ookata et al.,
1995
). By contrast, XMAP4 was
shown to decrease the frequency of catastrophe, the transition between MT
polymerization or pausing and depolymerization (Andersen et al.,
1994
). Studies of in vivo MT
dynamics may provide a clearer picture of how MAP4 controls the dynamics of
individual MTs and whether mutant MAP4 forms with different MT-binding
capabilities exert different effects on MT dynamics.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Aizawa, H., Emori, Y., Murofushi, H., Kawasaki, H., Sakai, H.
and Suzuki, K. (1990). Molecular cloning of a ubiquitously
distributed microtubule-associated protein with Mr 190,000.
J. Biol. Chem. 265,13849
-13855.
Andersen, S. S. L., Buendia, B., Dominguez, J. E., Sawyer, A.
and Karsenti, E. (1994). Effect on microtubule dynamics of
XMAP230, a microtubule-associated protein present in Xenopus laevis
eggs and dividing cells. J. Cell Biol.
127,1289
-1299.
Andersen, S. S. L. (2000). Spindle assembly and the art of regulating microtubule dynamics by MAPs and Stathmin/Op18. Trends Cell Biol. 10,261 -267.[Medline]
Belmont, L. D. and Mitchison, T. J. (1996). Identification of a protein that interacts with tubulin dimers and increases the catastrophe rate of microtubules. Cell 84,623 -631.[Medline]
Bulinski, J. C. and Borisy, G. G. (1979).
Self-assembly of HeLa tubulin and the identification of HeLa
microtubule-associated proteins. Proc. Natl. Acad. Sci.
USA. 76,293
-297.
Bulinski, J. C. and Borisy, G. G. (1980).
Microtubule-associated proteins from cultured HeLa cells: analysis of
molecular properties and effects on microtubule polymerization. J.
Biol. Chem. 255,11570
-11576.
Cha, B. J., Cassimeris, L., Gard, D. L. (1999). XMAP230 is required for normal spindle assembly in vivo and in vitro. J. Cell Sci. 112,4337 -4346.[Abstract]
Chapin, S. J. and Bulinski J. C. (1991). Preparation and functional assay of pure populations of tyrosinated and detyrosinated tubulin. Methods Enzymol. 196,254 -264.[Medline]
Chapin, S. J., Lue, C. M., Yu, M. T. and Bulinski, J. C. (1995). Differential expression of alternatively spliced forms of MAP4: a repertoire of structurally different microtubule-binding domains. Biochemistry 34,2289 -2301.[Medline]
Desai, A. and Mitchison, T. J. (1997) Microtubule polymerization dynamics. Annu. Rev. Cell Biol. 13,83 -117.[Medline]
Ebneth, A., Drewes, G., Mandelkow, E. M. and Mandelkow, E. (1999). Phosphorylation of MAP2c and MAP4 by MARK kinases leads to the destabilization of microtubules in cells. Cell Motil. Cytoskel. 44,209 -224.[Medline]
Hamaguchi, Y., Toriyama, M., Sakai, H. and Hiramoto, Y.
(1985). Distribution of fluorescently labeled tubulin injected
into sand dollar eggs from fertilization through cleavage. J. Cell
Biol. 100,1262
-1272.
Hoshi, M., Ohta, K., Gotoh, Y., Mori A., Murofushi, H., Sakai, H. and Nishida, E. (1992). Mitogen-activated-protein-kinase-catalyzed phosphorylation of microtubule-associated proteins, microtubule-associated protein 2 and microtubule-associated protein 4, induces an alteration in their function. Eur. J. Biochem. 203,43 -52.[Medline]
Illenberger, S., Drewes. G., Trinczek, B., Biernat, J., Meyer,
H. E., Olmsted, J. B., Mandelkow, E. M. and Mandelkow, E.
(1996). Phosphorylation of microtubule-associated proteins MAP2
and MAP4 by the protein kinase p110mark. J. Biol.
Chem. 271,10834
-10843.
Kitazawa, H., Iida, J., Uchida, A., Haino-Fukushima, K., Itoh, T. J., Hotani, H., Ookata, K., Murofushi, H., Bulinski, J. C., Kishimoto, T. et al. (2000). Ser787 in the proline-rich region of human MAP4 is a critical phosphorylation site that reduces its activity to promote tubulin polymerization. Cell Struct. Funct. 25, 33-39.[Medline]
Larsson, N., Segerman, B., Howell, B., Fridell, K., Cassimeris,
L. and Gullberg, M. (1999). Op18/stathmin mediates multiple
region-specific tubulin and microtubule-regulating activities. J.
Cell Biol. 146,1289
-1302.
Mandelkow, E. and Mandelkow, E. M. (1995). Microtubules and microtubule-associated proteins. Curr. Opin. Cell Biol. 7,72 -81.[Medline]
Mori, A., Aizawa, H., Saido, T. C., Kawasaki, H., Mizuno, K., Murofushi, H., Suzuki, K. and Sakai, H. (1991). Site-specific phosphorylation by protein kinase C inhibits assembly-promoting activity of microtubule-associated protein 4. Biochemistry 30,9341 -9345.[Medline]
Nguyen, H. L., Chari, S., Gruber, D., Lue, C. M., Chapin, S. J. and Bulinski, J. C. (1997). Overexpression of full- or partial-length MAP4 stabilizes microtubules and alters cell growth. J. Cell Sci. 110,281 -294.[Abstract]
Nguyen, H. L., Gruber, D. and Bulinski, J. C. (1999). Microtubule-associated protein 4 (MAP4) regulates assembly, protomer-polymer partitioning and synthesis of tubulin in cultured cells. J. Cell Sci. 112,1813 -1824.[Abstract]
Olson, K. R., McIntosh, J. R. and Olmsted, J. B.
(1995). Analysis of MAP4 function in living cells using green
fluorescent protein (GFP) chimeras. J. Cell Biol.
130,639
-650.
Ookata, K., Hisanaga, S., Bulinski, J. C., Murofushi, H.,
Aizawa, H., Itoh, T. J., Hotani, H., Okumura, E., Tachibana, K. and Kishimoto,
T. (1995). Cyclin B interaction with microtubule-associated
protein 4 (MAP4) targets p34cdc2 kinase to microtubules and is a potential
regulator of M-phase microtubule dynamics. J. Cell
Biol. 128,849
-886.
Ookata, K., Hisanaga, S., Sugita, M., Minoru, S., Okuyama, A., Murofushi, H., Kitazawa, H., Chari, S., Bulinski, J. C. and Kishimoto, T. (1997). MAP4 is the in vivo substrate for cdc2 kinase in HeLa cells: identification of an M-phase specific and a cell cycle-independent phosphorylation site in MAP4. Biochemistry 36,15873 -15883.[Medline]
Saxton, W. M., Stemple, D. L., Leslie, R. J., Salmon, E. D.,
Zavortink, M. and McIntosh, R. J. (1984). Tubulin dynamics in
cultured mammalian cells. J. Cell Biol.
99,2175
-2186.
Shiina, N., Moriguchi, T., Hota, K., Gotoh, Y. and Nishida, E. (1992). Regulation of a major microtubule-associated protein by MPF and MAP kinase. EMBO J. 11,3977 -3984.[Medline]
Shiina, N. and Tsukita, S. (1999). Mutations at
phosphorylation sites of Xenopus microtubule-associated protein 5
affect its microtubule-binding ability and chromosome movement during mitosis.
Mol. Biol. Cell. 10,597
-608.
Srsen, V., Kitazawa, H., Sugita, M., Murofushi, H., Bulinski, J. C., Kishimoto, T. and Hisanaga, S. (1999). Serum-dependent phosphorylation of human MAP4 at Ser696 in cultured mammalian cells. Cell Struct. Funct. 24,321 -327.[Medline]
Vallee, R. B. (1982). A taxol-dependent
procedure for the isolation of microtubules and microtubule-associated
proteins (MAPs). J. Cell Biol.
92,435
-442.
Vandré, D. D., Centonze, V. E.,
Peloquin, J., Tombes, R. M. and Borisy, G. G. (1991).
Proteins of the mammalian mitotic spindle: phosphorylation/dephosphorylation
of MAP-4 during mitosis. J. Cell Sc.
98,577
-588.
Verde, F., Labbe, J. C., Doree, M. and Karsenti, E. (1990). Regulation of microtubule dynamics by cdc2 protein kinase in cell-free extracts of Xenopus eggs. Nature. 343,233 -238.[Medline]
Wang, X. M., Peloquin, J. G., Zhai, Y., Bulinski, J. C. and
Borisy, G. G. (1996). Removal of MAP4 from microtubules in
vivo produces no observable phenotype at the cellular level. J.
Cell Biol. 132,345
-357.
West, R. R., Tenbarge, K. M. and Olmsted, J. B.
(1991). A model for microtubule-associated protein 4 structure.
J. Biol. Chem. 266,21886
-21896.
Yoshida, T., Imanaka-Yoshida, K., Murofushi, H., Tanaka, J., Ito, H. and Inagaki, M. (1996). Microinjection of intact MAP-4 and fragments induces changes of the cytoskeleton in Ptk2 cells. Cell Motil. Cytoskel. 33,252 -262.[Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
L. Qiang, W. Yu, A. Andreadis, M. Luo, and P. W. Baas Tau protects microtubules in the axon from severing by katanin. J. Neurosci., March 22, 2006; 26(12): 3120 - 3129. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Takahashi, H. Shiraishi, Y. Ishibashi, K. L. Blade, P. J. McDermott, D. R. Menick, D. Kuppuswamy, and G. Cooper IV Phenotypic consequences of {beta}1-tubulin expression and MAP4 decoration of microtubules in adult cardiocytes Am J Physiol Heart Circ Physiol, November 1, 2003; 285(5): H2072 - H2083. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Holmfeldt, G. Brattsand, and M. Gullberg Interphase and monoastral-mitotic phenotypes of overexpressed MAP4 are modulated by free tubulin concentrations J. Cell Sci., September 15, 2003; 116(18): 3701 - 3711. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. A. Martello, P. Verdier-Pinard, H.-J. Shen, L. He, K. Torres, G. A. Orr, and S. B. Horwitz Elevated Levels of Microtubule Destabilizing Factors in a Taxol-resistant/dependent A549 Cell Line with an {alpha}-Tubulin Mutation Cancer Res., March 15, 2003; 63(6): 1207 - 1213. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||