|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
RESEARCH ARTICLE |
Department of Pathology, Stanford University School of Medicine,
Stanford, CA 94305, USA
*
Author for correspondence (e-mail:
mcleary{at}stanford.edu
)
Accepted May 18, 2001
| SUMMARY |
|---|
|
|
|---|
Key words: Pseudo-phosphatase, Sbf1, transformation, GEF
| INTRODUCTION |
|---|
|
|
|---|
Several lines of evidence suggest that myotubularin-related proteins
participate in lipid-mediated signaling. A subset contains motifs that have
been implicated in binding phospholipids. For example, MTMr3 and MTMr4 contain
FYVE domains, which are phosphatidylinositol 3-phosphate (PI(3)P)-binding
motifs found in proteins linked to vesicular transport, cytoskeletal
organization and signal transduction. Sbf1 (MTMr5) contains a pleckstrin
homology (PH) domain that is responsive to phosphatidylinositol 3-kinase
(PI3K) in yeast, implying that its PH domain is capable of binding
phosphatidylinositol lipids (Isakoff et al.,
1998
). Furthermore,
myotubularin displays a high affinity and specificity for hydrolysis of PI(3)P
(Taylor et al., 2000
), in
addition to its previously reported ability to hydrolyze phosphoserine and
threonine residues (Cui et al.,
1998
). A phosphatase-defective
C375S myotubularin mutant induces an accumulation of PI(3)P in mammalian cells
when hyper-expressed (Taylor et al.,
2000
), whereas expression of
myotubularin reduces PI(3)P levels in S. pombe (Blondeau et al.,
2000
). Thus, mutations in
myotubularin-related proteins may lead to impaired growth control and
differentiation analogous to the association of PTEN phosphatase
loss-of-function mutations with oncogenesis in various tissues (Ali et al.,
1999
).
Interestingly, a subset of myotubularin-related proteins (the so-called
pseudo-phosphatases) contains conserved germline alterations of their PTP
homology domains that are likely to abrogate phosphatase catalytic activity.
Sbf1 (MTMr5) is the best characterized and has been linked to cellular growth
and oncogenic transformation in vitro. Sbf1 transcripts are upregulated
27-fold in Ras transformed cell lines (Zuber et al.,
2000
). Truncated forms of Sbf1
are oncogenic in NIH 3T3 cells and primary B cell progenitors. The ability of
Sbf1 to function as an oncoprotein is abrogated by restoring phosphatase
activity to its catalytically inactive PTP motif. Experimentally, phosphatases
whose PTP motifs are catalytically inactive have been shown to bind
phosphorylated substrates and prevent their dephosphorylation (Flint et al.,
1997
). Thus,
myotubularin-related pseudo-phosphatases may act as naturally occurring
substrate trapping mutants or regulate PI(3)P levels by opposing the actions
of myotubularin phosphatases.
This study was undertaken to further elucidate the role of Sbf1 in cell growth and onocogenic transformation. Characterization of a complete Sbf1 cDNA demonstrates that the predicted full-length Sbf1 protein contains an N-terminal GEF homology domain that is conserved with Rab3GEF and with several other proteins implicated in signaling and growth control. Consistent with a possible role in signaling, wild-type Sbf1 localizes to the cytoplasmic compartment in vitro and in vivo. Deletion of its N-terminal 44 amino acids converts Sbf1 from an inhibitor of cellular growth to an oncoprotein in NIH 3T3 cells. All transforming mutants of Sbf1 localize at least partially to the nucleus.
| MATERIALS AND METHODS |
|---|
|
|
|---|
gt10 cDNA library (Clontech). Library
clones containing 5' extension products were amplified by PCR using a
5' primer specific to the
gt10 backbone
(GAGCAAGTTCAGCCTGGTTAAGTC) and a 3' primer specific to Sbf1
base pairs 1072-1053 (GGTCCAGGACCATGCTCAGCACACT). A 1 kb
SacI/NaeI fragment containing the 5' extension was
used to reconstitute an Sbf1 cDNA encoding an open reading frame of
5934 base pairs. Sequence analysis and domain analyses were performed using
the BLAST and CLUSTALW analysis programs. Sbf1 N-terminal mutants
lacking the first 44 or 111 amino acids (
N44 and
N111) were
constructed by PCR. Construct Sbf1
CRS was generated by internal
deletion of cDNA sequences encoding amino acids 200-280 using PCR techniques.
Sbf1
C1642 consisted of an EcoRI/BamHI fragment of
Sbf1 cloned into the EcoRI/BglII site of MSCV.
N-terminal Flag-tagged Sbf1 and MTM1 constructs were
generated by cloning the respective full-length cDNAs in-frame with the Flag
epitope in the mammalian expression vector pYDF30. Reporter constructs for
response element assays were obtained from commercial sources (Mercury System)
(Clontech).
Chromosomal mapping of the Sbf1 gene
BAC clones containing the human Sbf1 gene were isolated using a
human Sbf1 cDNA fragment as probe (Genome Systems). BAC clones were
confirmed to encode Sbf1 by Southern blot hybridization or sequence
analysis. Chromosomal localization of Sbf1 was determined by
fluorescence in situ hybridization (FISH) using BAC clone F728 that was
labeled with digoxigenin-dUTP by nick translation (Genome Systems). A total of
80 metaphase spreads were analyzed with 74 showing specific labeling.
Cell culture and transfections
NIH 3T3 cells were maintained in Dulbecco's modified Eagle medium (DMEM)
supplemented with 10% bovine calf serum. The Phoenix retroviral packaging cell
line (kind gift of Garry Nolan) was maintained in DMEM supplemented with 10%
fetal bovine serum. Retroviral infection of NIH 3T3 cells was performed as
previously described (Pear et al.,
1993
). Transduced cells were
selected in G418 (1 mg/ml) starting at 48 hours post-infection for a period of
2-4 weeks. Stable transductants were pooled and continuous cell lines were
maintained in growth medium supplemented with G418 (200 µg/ml).
Soft agar and focus forming assays
Anchorage-independent growth was analyzed in 60 mm tissue culture plates
containing 5 ml of base agar (0.7%) and 3 ml of top agar (0.33%) in DMEM
containing 10% calf serum. NIH 3T3 cells from sub-confluent cultures were
combined with the top agar and plated in triplicate at a concentration of
2x104 cells per plate. Cultures were refed with fresh growth
medium every 2-3 days and colonies were scored at 21 days. For focus-forming
assays, sub-confluent NIH3T3 cell lines were plated at 80% confluency on 60 mm
diameter plates. Cultures were re-fed every 2-3 days and foci were scored at
21 days.
Protein analysis and subcellular fractionation
Whole cell extracts for protein expression analysis were prepared from
either NIH 3T3 or 293T cells by lysis at 95°C for 5 minutes in SDS lysis
buffer containing 50 mM Tris-HCl (pH 6.8), 2%SDS and 10% glycerol. The heated
lysate was passed three times through a 21 gauge syringe needle. Nuclear and
cytoplasmic fractions were prepared from Raji cells as previously described
(Jacobs et al., 1993
). Lysates
were subjected to SDS-PAGE and western blotting using standard methods.
Immunocytochemistry and fluorescence microscopy
The subcellular localization of Sbf1 and MTM1 was determined by indirect
immunofluorescence microscopy. NIH 3T3 cells that had been transfected 48
hours previously were fixed in phosphate-buffered saline (PBS)/4%
paraformaldehyde for 15 minutes. For detection of Sbf1, the cells were treated
with PBS/1% sodium dodecylsulphate (SDS) at 50°C for 30 minutes for
antigen retrieval purposes. Preparations were washed extensively in PBS,
blocked in PBS containing 5% normal goat serum for 30 minutes followed by
incubation with either the primary anti-FLAG mAb (M5; Sigma) at a dilution of
1:500 or anti-Sbf1 mAb (De Vivo et al.,
1998
) at a dilution of 1:100.
Immune complexes containing the target protein were visualized with a
fluorescein isothiocyanate-conjugated goat anti-mouse secondary antibody.
Cells were counterstained with DAPI (4',6-diamidino-2-phenylindole;
Boehringer Mannheim), mounted onto slides and visualized by indirect
fluorescence microscopy. Immunohistochemical detection of Sbf1 was performed
on formalin-fixed, paraffin-embedded tissues after antigen retrieval
consisting of microwave treatment for 15 minutes in a 0.5 M Tris pH 10
solution. The primary antibody consisted of a mouse monoclonal (mAb 68)
specific for Sbf1. Immune complexes were detected using biotinylated
anti-mouse serum and avidin horseradish peroxidase complexes.
Growth analysis and cell cycle kinetics
Growth and cell cycle analyses were performed on NIH 3T3 cells that were
stably transduced with the appropriate retroviral constructs. For growth
assays, cells were seeded at a density of 1.5x105 cells per
100 mm diameter dish. Every 3 days the cells were trypsinized, total cell
numbers determined by hematocytometer, and then replated at the initial
density of 1.5x105 cells per 100 mm dish. The effect of Sbf1
on cell cycle progression was measured by pulse labeling the cells with 50 mM
BrdU for 3 hours. BrdU incorporation was determined using an anti-BrdU
antibody as recommended by the supplier (Sigma).
| RESULTS |
|---|
|
|
|---|
The full-length Sbf1 cDNA encodes a 1930 amino acid protein with a
predicted molecular mass of 215 kDa (Fig.
1A). Sequences conforming to a Kozak consensus were identified at
the first ATG ((A/G)cc ATG G; Kozak,
1989
) and the ORF matched that
predicted by translation of exonic sequences (as identified by GENSCAN). No
alternative upstream ATG codons were identified. Western blot analysis of 293T
cells transfected with an expression construct containing the full-length cDNA
revealed the presence of an immunoreactive protein that co-migrated with
endogenous Sbf1 and displayed an apparent molecular weight of approximately
220 kDa, consistent with the predicted size
(Fig. 1C).
|
A motif search of the Sbf1 amino acid sequence revealed a heptad leucine
repeat (HLR) (amino acids 240-261) and pleckstrin homology (PH) domain
(Fig. 1A), in addition to the
previously reported similarity with myotubularin (Cui et al.,
1998
). Furthermore, database
searches revealed that sequences within the N-terminal region of Sbf1 (amino
acids 207-292) spanning the HLR shared significant similarity with several
putative signaling proteins and unknown ORFs. Proteins containing this novel
leucine/proline-rich domain included calmodulin response activated gene (CRAG)
(Xu et al., 1998
), Rab6bp
(Janoueix-Lerosey et al.,
1995
), Rab3GEF (Wada et al.,
1997
) and ST5 (Majidi et al.,
1998
). Hereafter, we refer to
this conserved motif as the CRS domain
(Fig. 1B).
The N-terminus of Sbf1 negatively regulates its latent transforming
potential
Previous studies have shown that forced expression of various forms of Sbf1
induced anchorage-independent growth of NIH 3T3 cells and immortalization of
murine pre-B cells in vitro (Cui et al.,
1998
; De Vivo et al.,
1998
). To determine whether
full-length Sbf1 displayed similar transforming properties, the growth of NIH
3T3 cells was evaluated in soft agar after their retroviral transduction with
constructs encoding Sbf1 (full length) or a mutant Sbf1 that lacks the
N-terminal 750 amino acids (
N750) and has previously been shown to be
oncogenic (Cui et al., 1998
).
Equivalent expression of each construct was confirmed by western blots of the
retroviral packaging cell lines as well as the transduced NIH 3T3 cells
(Fig. 2C). These studies showed
that full-length Sbf1 was incapable of inducing anchorage-independent growth
of NIH 3T3 cells, in contrast to
N750, which induced the growth of
numerous colonies in soft agar when expressed under comparable conditions
(Fig. 2A,B).
|
The potential role of N-terminal sequences in the negative regulation of
Sbf1 transforming activity was further investigated using a series of mutants
harboring N-terminal deletions (Fig.
3A). Possible roles for the CRS and PH domains were also
investigated using mutants lacking either of these motifs (
CRS and
C1642, respectively; Fig.
3A). Equivalent expression of Sbf1 proteins was confirmed by
western blots of stably transduced NIH 3T3 cells
(Fig. 3B). Growth properties of
the latter were evaluated in focus-forming assays at 21 days. Under these
conditions, full-length Sbf1 was incapable of inducing foci consistent with
its inability to induce anchorage-independent growth of NIH 3T3 cells
(Fig. 4A,B). By contrast, cells
expressing N-terminal deletion constructs lacking the first 44, 111 or 337
amino acids displayed robust focus-forming activity
(Fig. 4A,B). Deletion
constructs lacking the CRS domain alone (
CRS) or the PH domain
(
C1642) lacked focus-forming ability
(Fig. 4B). These results
indicate that the first 44 amino acids of Sbf1 are necessary for negatively
regulating its latent oncogenic potential. Conversely, the conserved CRS and
PH domains are not required for suppression or induction of Sbf1 oncogenic
activity, consistent with previous observations that forced expression of the
SID alone was sufficient for transformation (Cui et al.,
1998
; De Vivo et al.,
1998
).
|
|
Wild-type Sbf1 displays growth inhibitory properties in NIH 3T3
cells
Although wild-type Sbf1 was incapable of morphologically transforming NIH
3T3 cells, it did induce alterations in their growth properties. NIH 3T3 cells
expressing exogenous Sbf1 grew at a significantly slower rate when compared
with control cells or those expressing mutated forms of Sbf1
(Fig. 5A). Pulse-labeling of
cells with BrdU, revealed an approximate threefold reduction in the number of
Sbf1-expressing cells entering S phase
(Fig. 5B) compared with control
cells containing vector alone. In addition, NIH 3T3 fibroblasts stably
transduced with Sbf1 exhibited an altered cellular morphology. They appeared
less flattened and refractile, and exhibited a spindle-shaped appearance
(Fig. 5C). The
antiproliferative and morphology altering effects of Sbf1 were abolished by
N-terminal deletions (
N44 and
N337), deletions that removed the
CRS or PH domains (
CRS and
C1642), or site-directed point
mutations (Cui et al., 1998
)
that restored phosphatase activity to the PTP motif (Sbf1HCS;
Fig. 5B). These observations
indicated that forced expression of wild-type Sbf1 has an anti-proliferative
effect. Its ability to alter the cytoskeletal structure and growth rate of NIH
3T3 cells is not mediated by a single domain, but is dependent upon the
integrity of several motifs in the full-length protein.
|
Sbf1 is a cytoplasmic protein but N-terminal deletion induces partial
nuclear localization
Sbf1 was originally isolated in a yeast two-hybrid screen as a result of
its interaction with SET domain proteins, which are nuclear factors implicated
in gene regulation. Therefore, we evaluated whether wild-type Sbf1 may also be
a nuclear protein. Subcellular fractions of nuclei and cytosol were prepared
from Raji cell extracts. Western blot analysis showed that Sbf1 was
predominantly present in the cytoplasmic fraction
(Fig. 6A). Furthermore,
immunohistochemistry using an Sbf1 monoclonal antibody on various mouse
tissues showed that in the brain (Fig.
6B) and testis (R.F. and M.L.C., unpublished), two tissues that
express high levels of Sbf1, the protein was exclusively localized in the
cytoplasm. Thus, endogenous Sbf1 appears to be a cytoplasmic protein.
|
The subcellular localization of Sbf1 as well as that of MTM1 was also evaluated by immunocytochemistry. Immunolocalization of exogenously expressed FLAG-tagged Sbf1 and MTM1 revealed that both were exclusively cytoplasmic under conditions of hyper-expression (Fig. 6C).
Localization of wild-type Sbf1 in the cytoplasm would appear to be
inconsistent with previous observations that oncogenic forms of Sbf1 modulate
the activities of nuclear SET domain proteins (Cui et al.,
1998
; Firestein et al.,
2000
). One possible
explanation for this apparent discrepancy may be that the localization of
oncogenic Sbf1 proteins differs from wild-type Sbf1 and their altered
subcellular localization might correlate with oncogenic activity. This was
tested by determining the subcellular localization of Sbf1 mutant proteins in
stably transfected NIH 3T3 cells. Transforming mutants (
N44,
N111,
N337 and
N750) localized to both the nuclear and
cytoplasmic compartments. By contrast, non-transforming mutants
CRS and
C1642 localized exclusively to the cytoplasm
(Fig. 7). The correlation
between transformation and nuclear localization is consistent with the
possibility that Sbf1 acts in the nucleus to transform cells.
|
| DISCUSSION |
|---|
|
|
|---|
|
We have previously shown that truncated forms of Sbf1 interact with and
modulate the function of SET domain proteins such as M11 (Hrx) and SUV39H1 in
vitro (Cui et al., 1998
;
Firestein et al., 2000
). Our
current study, however, suggests that interaction with these proteins is
unlikely to constitute a normal physiological role for wild-type Sbf1, as the
endogenous protein does not localize to the nucleus. The recent finding that
SET domain proteins can localize to non-nuclear structures such as gap
junctions underscores the possibility that wild-type Sbf1 may interact and
mediate its signals through cytoplasmic targets (Nakamura et al.,
2000
).
The first 44 amino acids of Sbf1, which suppress its latent transforming
activity, display similarity with a Rab6-binding protein and a GEF of the Rab3
family of small GTP-binding proteins. This similarity raises the possibility
that Sbf1 may function in vesicular transport or secretory pathways controlled
by the Rab family of GTPases (Martinez and Goud,
1998
). Although Rab3GEF has
not been reported to display oncogenic activity, other GEFs undergo oncogenic
activation when truncated in their N-terminal regions. For example, the
protooncoprotein Vav and several other Dbl family proteins such as Dbl, Ost
and Tiam1 are oncogenically activated by N-terminal mutations (Cerione and
Zheng, 1996
). No sequence
similarity is shared between these proteins to suggest that a specific domain
is involved. However, it has been shown for Vav that deletion of its N
terminus leads to an increase in its membrane soluble fraction (Abe et al.,
1999
), suggesting that altered
subcellular localization may play a role in transformation. Altered
subcellular localization may also activate the oncogenic potential of ST5, a
CRS-containing protein whose transforming activity is induced by C-terminal
deletions that reposition a putative membrane targeting motif (Majidi et al.,
2000
). Our data show that
N-terminal deletions of Sbf1 lead to its partial nuclear localization, raising
the possibility that the N terminus regulates Sbf1 by sequestering it to a
specific subcellular address. It remains to be determined whether nuclear
localization is required for oncogenic activity of Sbf1 or simply an indicator
that its normal subcellular distribution is altered by N-terminal
deletion.
The ability of myotubularin to dephosphorylate PI(3)P (Taylor et al.,
2000
) and the presence of
PI(3)P-binding FYVE domains in several members of this family (Laporte et al.,
1998
) imply that myotubularin
proteins regulate growth control via lipid second messengers. Lipid
phosphatase activity appears to be crucial for myotubularin function, as
mutations in the PTP motif that abrogate its ability to dephosphorylate PI(3)P
result in XLMTM (Taylor et al.,
2000
). Furthermore, a
phosphatase defective C375S myotubularin mutant causes an accumulation of
PI(3)P in mammalian cells when hyperexpressed (Taylor et al.,
2000
). Interestingly,
mutations in the PTP motif of Sbf1 also alter its growth regulatory
properties. Restoration of catalytic activity to the PTP motif of either
wild-type or truncated Sbf1 abrogates growth inhibition and oncogenic
transformation, respectively. One possibility is that the catalytically
inactive PTP motif in Sbf1 may function as a phosphatidylinositol-binding
motif analogous to FYVE domains. The latter have been shown to function as
docking motifs that bind PI(3)P and function in vesicular transport,
cytoskeletal organization and signal transduction (Driscoll and Vuidepot,
1999
). The docking ability of
the Sbf1 PTP domain may be abrogated by mutations that restore catalytic
activity, thereby disrupting its role in signaling processes. The combination
of RabGEF homology, PH and phosphatidyl-binding domains strongly imply a role
for Sbf1 in lipidmediated signaling events. Although we interrogated several
signaling pathways, our results did not reveal any significant differences in
wild-type or oncogenic Sbf1 (data not shown). It remains to be determined
which signaling pathways lie downstream of Sbf1 and how activating N-terminal
mutations may alter its function and contribute to transformation.
The ability of wild-type Sbf1 to inhibit growth and alter the morphology of NIH 3T3 fibroblasts is dependent on the integrity of several domains. Deletion of the CRS domain, the PH domain, or the first 44 amino acids, as well as restoration of catalytic activity in its PTP motif, all abrogate the ability of Sbf1 to inhibit growth. These data imply that growth inhibition is an intrinsic property of wild-type Sbf1 and not a dominant-negative effect resulting from its overexpression. It is of interest that PTEN, a lipid phosphatase in the PIP pathway, is a tumor suppressor protein whose loss of function is associated with several human cancers. Although mutant Sbf1 is a potent transforming protein in different cell types, an oncogenic role in human cancer has not been reported. The chromosomal localization of Sbf1 to 22q13.33 should aid in discovery of malignancies that may carry mutations in the Sbf1 gene.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Abe, K., Whitehead, I. P., O'Bryan, J. P. and Der, C. J.
(1999). Involvement of NH(2)-terminal sequences in the negative
regulation of Vav signaling and transforming activity. J. Biol.
Chem. 274,30410
-30418.
Ali, I. U., Schriml, L. M. and Dean, M. (1999).
Mutational spectra of PTEN/MMAC1 gene: a tumor suppressor with lipid
phosphatase activity. J. Natl. Cancer Inst.
91,1922
-1932.
Blondeau, F., Laporte, J., Bodin, S., Superti-Furga, G.,
Payrastre, B. and Mandel, J. L. (2000). Myotubularin, a
phosphatase deficient in myotubular myopathy, acts on phosphatidylinositol
3-kinase and phosphatidylinositol 3-phosphate pathway Hum. Mol.
Genet. 9,2223
-2229.
Bolino, A., Muglia, M., Conforti, F. L., LeGuern, E., Salih, M. A., Georgiou, D. M., Christodoulou, K., Hausmanowa-Petrusewicz, I., Mandich, P., Schenone, A. et al. (2000). Charcot-Marie-Tooth type 4B is caused by mutations in the gene encoding myotubularin-related protein-2. Nat. Genet. 25,17 -19.[Medline]
Cerione, R. A. and Zheng, Y. (1996). The Dbl family of oncogenes. Curr. Opin. Cell Biol. 8, 216-222.[Medline]
Cui, X., De Vivo, I., Slany, R., Miyamoto, A., Firestein, R. and Cleary, M. L. (1998). Association of SET domain and myotubularin-related proteins modulates growth control. Nat. Genet. 18,331 -337.[Medline]
De Vivo, I., Cui, X., Domen, J. and Cleary, M. L.
(1998). Growth stimulation of primary B cell precursors by the
anti-phosphatase Sbf1. Proc. Natl. Acad. Sci. USA
95,9471
-9476.
Driscoll, P. C and Vuidepot, A. L. (1999). Peripheral membrane proteins: FYVE sticky fingers. Cur. Biol. 9,857 -860.
Dunham, I., Shimizu, N., Roe, B. A., Chissoe, S., Hunt, A. R., Collins, J. E., Bruskiewich, R., Beare, D. M., Clamp, M., Smink, L. J. et al. (1999). The DNA sequence of human chromosome 22. Nature 402,489 -495.[Medline]
Firestein, R., Cui, X., Huie, P. and Cleary, M. L.
(2000). SET domain-dependent regulation of transcriptional
silencing and growth control by SUV39H1, a mammalian ortholog of Drosophila
Su(var)3-9. Mol. Cell. Biol.
20,4900
-4909.
Flint, A. J., Tiganis, T., Barford, D. and Tonks, N. K.
(1997). Development of "substrate-trapping" mutants
to identify physiological substrates of protein tyrosine phosphatases.
Proc. Natl. Acad. Sci. USA
94,1680
-1685.
Isakoff, S.J., Cardozo, T., Andreev, J., Li, Z., Ferguson, K. M., Abagyan, R., Lemmon, M. A., Aronheim, A. and Skolnik, E. Y. (1998). Identification and analysis of PH domain-containing targets of phosphatidylinositol 3-kinase using a novel in vivo assay in yeast. EMBO J. 17,5374 -5387.[Medline]
Jacobs, Y., Vierra, C. and Nelson, C. (1993).
E2A expression, nuclear localization, and in vivo formation of DNA- and
non-DNA-binding species during B-cell development. Mol. Cell.
Biol. 13,7321
-7333.
Janoueix-Lerosey, I., Jollivet, F., Camonis, J., Marche, P. N.
and Goud, B. (1995). Two-hybrid system screen with the small
GTP-binding protein Rab6. Identification of a novel mouse GDP dissociation
inhibitor isoform and two other potential partners of Rab6. J.
Biol. Chem. 270,14801
-14808.
Kozak, M. (1989). Context effects and
inefficient initiation at non-AUG codons in eucaryotic cell-free translation
systems. Mol. Cell. Biol.
9,5073
-5080.
Laporte, J., Hu, L. J., Kretz, C., Mandel, J. L., Kioschis, P., Coy, J. F., Klauck, S. M., Poustka, A. and Dahl, N. (1996). A gene mutated in X-linked myotubular myopathy defines a new putative tyrosine phosphatase family conserved in yeast. Nat. Genet. 13,175 -182.[Medline]
Laporte, J., Blondeau, F., Buj-Bello, A., Tentler, D., Kretz,
C., Dahl, N. and Mandel, J. L. (1998). Characterization of
the myotubularin dual specificity phosphatase gene family from yeast to human.
Hum. Mol. Genet. 7,1703
-1712.
Majidi, M., Hubbs, A. E. and Lichy, J. H.
(1998). Activation of extracellular signal-regulated kinase 2 by
a novel Abl-binding protein. ST5. J. Biol. Chem.
273,16608
-16614.
Majidi, M., Gutkind, J. S. and Lichy, J. H.
(2000). Deletion of the COOH terminus converts the ST5 p70
protein from an inhibitor of RAS signaling to an activator with transforming
activity in NIH-3T3 cells. J. Biol. Chem.
275,6560
-6565.
Martinez, O. and Goud, B. (1998). Rab proteins. Biochim. Biophys. Acta 1404,101 -112.[Medline]
Nakamura, T. T., Blechman, J., Tada, S., Rozouskai, T., Itoyama,
T., Bullrich, F., Mazo, A., Croce, C.M., Geiger, B., Canaani, E.
(2000). huASH1 protein, a putative transcription factor encoded
by a human homologue of the Drosophila ash1 gene, localizes to both nuclei and
cell-cell tight junctions. Proc. Natl. Acad. Sci. USA
97,7284
-7287.
Pear, W.S., Nolan, G. P., Scott, M. L. and Baltimore, D.
(1993). Production of high-titer helper-free retroviruses by
transient transfection. Proc. Natl. Acad. Sci. USA
90,8392
-8396.
Taylor, G., Maehama, T. and Dixon, J. E.
(2000). Myotubularin, a protein tyrosine phosphatase mutated in
myotubular myopathy, dephosphorylates the lipid second messenger,
phosphatidylinositol 3-phosphate. Proc. Natl. Acad. Sci.
USA 97,8910
-8915.
Wada, M., Nakanishi, H., Satoh, A., Hirano, H., Obaishi, H.,
Matsuura, Y. and Takai, Y. (1997). Isolation and
characterization of a GDP/GTP exchange protein specific for the Rab3 subfamily
small G proteins. J. Biol. Chem.
272,3875
-3878.
Xu, X. Z., Wes, P. D., Chen, H., Li, H. S., Yu, M., Morgan, S.,
Liu, Y. and Montell, C. (1998). Retinal targets for
calmodulin include proteins implicated in synaptic transmission. J.
Biol. Chem. 273,31297
-31307.
Zuber, J., Tchernitsa, O.I., Hinzmann, B., Schmitz, A. C., Grips, M., Hellriegel, M., Sers, C., Rosenthal, A. and Schafer, R. (2000). A genomewide survey of RAS transformation targets. Nat. Genet. 24,144 -152.[Medline]
This article has been cited by other articles:
![]() |
S.-A Kim, P. O. Vacratsis, R. Firestein, M. L. Cleary, and J. E. Dixon Regulation of myotubularin-related (MTMR)2 phosphatidylinositol phosphatase by MTMR5, a catalytically inactive phosphatase PNAS, April 15, 2003; 100(8): 4492 - 4497. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Laporte, F. Blondeau, A. Gansmuller, Y. Lutz, J.-L. Vonesch, and J.-L. Mandel The PtdIns3P phosphatase myotubularin is a cytoplasmic protein that also localizes to Rac1-inducible plasma membrane ruffles J. Cell Sci., January 8, 2002; 115(15): 3105 - 3117. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||