|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
RESEARCH ARTICLE |
1
Zentrum für Molekularbiologie der Pflanzen,
Entwicklungsgenetik, Universität
Tübingen, Auf der Morgenstelle 1, D-72076
Tübingen, Germany
2
Zentrum für Molekularbiologie der Pflanzen,
Mikroskopie, Universität
Tübingen, Auf der Morgenstelle 1, D-72076
Tübingen, Germany
*
Author for correspondence (e-mail:
gerd.juergens{at}uni-tuebingen.de
)
Accepted May 21, 2001
| SUMMARY |
|---|
|
|
|---|
Key words: Arabidopsis, Cytokinesis, Syntaxin, KNOLLE, Expression
| INTRODUCTION |
|---|
|
|
|---|
Mutations in several genes of Arabidopsis, including
KNOLLE and KEULE, result in cytokinesis defects, such as
enlarged cells with incomplete cell walls and more than one nucleus (Lukowitz
et al., 1996
; Assaad et al.,
1996
; Nacry et al.,
2000
). KNOLLE encodes
a cytokinesis-specific syntaxin (Lukowitz et al.,
1996
; Lauber et al.,
1997
). KEULE is a member of
the Sec1 family of syntaxin-binding proteins that interacts with KNOLLE in
vitro and in vivo, and mutations in both genes result in the accumulation of
unfused cytokinetic vesicles (Assaad et al.,
2000
; Lauber et al.,
1997
; Waizenegger et al.,
2000
). Whereas the
KEULE gene appears to be expressed in both proliferating and
non-proliferating cells (Assaad et al.,
2000
), the expression of
KNOLLE is tightly regulated during the cell cycle. KNOLLE
mRNA accumulates transiently in proliferating cells, giving a patchy pattern
that reflects asynchrony of cell division in the embryo (Lukowitz et al.,
1996
). KNOLLE protein
accumulates only during M phase, initially in patches presumed to represent
Golgi stacks, then localises to the forming cell plate during telophase and
disappears at the end of cytokinesis (Lauber et al.,
1997
). The tight regulation of
KNOLLE expression is reminiscent of the synthesis and degradation of mitotic
cyclins (Ito, 2000
). KNOLLE
syntaxin appears to be involved in all sporophytic cell divisions as well as
in endosperm cellularisation (Lauber et al.,
1997
).
Syntaxins are components of SNARE complexes that play an important role in
membrane fusion events (reviewed by Jahn and
Südhof,
1999
). The SNARE core complex
consists of three or four proteins that form a four-helix bundle: a bipartite
t-SNARE on the target membrane, which consists of a syntaxin and a SNAP25
protein or two t-SNARE light-chain proteins, interacts with the v-SNARE
synaptobrevin on the vesicle membrane (Clague and Herrmann,
2000
). There are numerous
members of each SNARE protein family in yeast, animals and plants that have
been implicated in diverse vesicle trafficking pathways between membrane
compartments (for reviews on plant SNAREs, see Blatt et al.,
1999
; Sanderfoot et al.,
2000
). In general, syntaxins
and synaptobrevins involved in a particular pathway appear more closely
related to functional counterparts in different organisms than to family
members involved in a different pathway within the same organism. The original
SNARE hypothesis postulated that specific pairs of cognate syntaxins and
synaptobrevins provide specificity to vesicle trafficking
(Söllner et al.,
1993a
;
Söllner et al.,
1993b
). This idea was
challenged in recent in vitro interaction studies that provided evidence for
promiscuity among interacting SNARE partners (Fasshauer et al.,
1999
). However, thorough
analyses of yeast SNARE interactions in liposome assays have indicated a high
degree of specificity of interaction between syntaxins and synaptobrevins
(Fukuda et al., 2000
; McNew et
al., 2000
; Parlati et al.,
2000
).
KNOLLE is a distant member of the plasma membrane subgroup of the syntaxin
family but has no close counterpart among yeast or animal syntaxins (Lukowitz
et al., 1996
; Sanderfoot et
al., 2000
). However, syntaxins
with analogous roles in membrane fusion during cellularisation or cytokinesis
have been described in animals. The Drosophila syntaxin 1 gene is
required for cellularisation of the blastoderm embryo, as well as for neural
development (Burgess et al.,
1997
). Likewise, the
Caenorhabditis syn-4 gene is involved in embryo cleavage divisions
but also plays a role in nuclear membrane reformation (Jantsch-Plunger and
Glotzer, 1999
). In contrast to
the other two syntaxins, KNOLLE is required only for de novo formation of the
partitioning plasma membrane during cytokinesis, and its expression is tightly
regulated during the cell cycle, suggesting a unique role in cytokinesis.
We have addressed the biological significance of the tight regulation of KNOLLE expression by replacing the endogenous 5' regulatory region with promoters that are active in both proliferating and non-proliferating cells. The transgenic plants were phenotypically normal, although KNOLLE protein accumulated strongly in non-proliferating cells and was mistargeted to the plasma membrane. Conversely, the KNOLLE transgene did not rescue knolle mutant embryos, which correlated with low-level accumulation of mRNA from the KNOLLE transgene in proliferating embryonic tissue, when compared with the activity of the endogenous KNOLLE gene. Our observations suggest that the tight regulation of KNOLLE expression meets two opposing requirements. First, the KNOLLE gene must be strongly expressed to produce sufficient KNOLLE protein during M phase for the efficient execution of cytokinetic vesicle fusion. Second, degradation of KNOLLE mRNA and protein prevents the accumulation of large quantities of useless molecules.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plant transformation and selection of transgenic plants
WS and knolle-X37-2 (Ler/Nd) heterozygous plants were transformed
by a modified transformation protocol (Bechtold and Pelletier,
1998
; Clough and Bent,
1998
), using a combination of
vacuum infiltration and additional dip transformation one week later. One
hundred to 150 plants were transformed with an Agrobacterium GV3101 culture
bearing the desired transgene. Infiltration medium consisted of 0.5x MS
salts, 1x Gamborg B5 vitamins (Ducheva), 5% sucrose, 0.044 µM benzyl
aminopurine (Sigma) pH 5.7 with KOH, and 0.005% SILWET L77 (Osi Specialities).
T1 seeds were bulk-harvested (each seed representing a single transformation
event; Bechtold et al., 2000
;
Desfeux et al., 2000
; Ye et
al., 1999
), sown on soil and
selected for transformants by spraying BASTA® (183 g/l Glufosinate,
AgrEvoTM; Düsseldorf, Germany; 1:1000)
twice. BASTA®-resistant plants were genotyped for KNOLLE by PCR
with the primers X37-2C and X37-2D (Lukowitz et al.,
1996
), which amplify a 0.7 kb
fragment from X37-2 and a 1.7 kb fragment from wild type. Seeds
containing knolle mutant embryos are shrunken and darker than
wild-type seeds. For confirmation of the genotype, mutant seeds were
germinated on 0.5x MS salts, 1% Select Agar plates, and seedlings were
examined for the knolle mutant phenotype.
Plants heterozygous for kn-X37-2 were transformed with the
KNRescue construct (see Fig.
1). Selfing of the T0 plants gave three distinguishable genotypes
of BASTA®-resistant T1 progeny bearing the KN transgene: (1)
KN/KN, (2) kn/KN and (3) kn/kn. PCR with
KNOLLE-specific primers amplified the kn-X37-2 fragment from the
genotypes (2) and (3) (Lukowitz et al.,
1996
). Selfing of T1 plants
with genotype (2) or (3) produced 6.25% or 25% knolle mutant T2
seeds, respectively. Reduction of phenotypically mutant seeds from 25% to
6.25% for genotype (2) indicated complementation. One-third of the
Basta-resistant T2 plants derived from genotype (3) were homozygous for the
transgene and produced only phenotypically normal seeds, although the embryos
were homozygous for the kn-X37-2 mutant allele (T3 generation).
|
Molecular biology
Constructs for plant transformation were introduced into pBar vectors.
pBarA (AJ251013) was used for AP3::KN misexpression and for the
rescue of the knolle mutant phenotype by a KNOLLE SacI-SnaI
genomic fragment. pBar-35S (AJ251014) was used for 35S::KN
misexpression. pBar vectors were a gift from G. Cardon (MPI, Cologne,
Germany). PCR was carried out according to standard procedures using TaqPlus
PrecisionTM (Stratagene, La Jolla, CA), Expand High FidelityTM
(Roche Mannheim, Germany) and Taq DNA PolymeraseTM (Roche). The
AP3 promoter fragment was amplified by PCR using pD1075:AP3
(-650Æ -1, a gift from T. Jack) with the forward primer AP3-98a
(5'AATTCTAGACAAGGATCTTTAGTTAAGGC 3) introducing a
XbaI 5' restriction site and with the reverse primers AP3-46a
(5' ATACTGCAGATTTGGTGGAGAGGACAAG 3') and
AP3-47: (5'
ATACTGCAGGAAGAGATTTGGTGGAGAGGACAAG 3')
introducing a consensus transcription start (Joshi,
1987
) and a 3'
Pst1 restriction site. The KNOLLE fragments KN1 (-217 to
+1500) and KN2 (-4 to +1500) were PCR amplified with either forward primer
KNstart1 (5'TTTCTGCAGCTTTCTCTCATCTCACA AATC
3') or KNstart2 (5'
ATACTGCAGAAGATGAACGACTTGATGACG 3'),
introducing a PstI restriction site at the 5' end, and reverse
primer KNstop (5' ATAGAATTCATGACCTTGTTCCAGAGATTG
3'), introducing an EcoRI cloning site at the 3' end.
AP3::KN1 (KNOLLE coding sequence with intron; see
Fig. 1) and AP3::KN2
(coding sequence without intron) were used for KNOLLE misexpression, which
gave essentially the same results (data not shown).
XbaI-AP3::KN-EcoRI was cloned into pBarA. p35S::KN
constructs were obtained by restriction digest of Bluescript SK::KN2 with
XhoI, introducing 40 nucleotides non-coding sequence 5' to the
KNOLLE translational start. The 3' end of the KN2 fragment was
a XbaI restriction site within the Bluescript SK vector, introducing
another 30 nucleotides. This fragment was cloned into pBar-35S SmaI +
XbaI. A genomic SnaI and SacI 4.75 kb fragment
containing KNOLLE was directly subcloned into pBarA SacI,
SmaI. The constructs were confirmed by sequencing and transformed
into Agrobacterium tumefaciens strain GV3101 (GV3101 + pM90: gift
from G. Cardon, MPI Cologne, Germany). The p35S::KN transgene was
re-amplified from transgenic plants by using the forward primer 35SPromoter2
(5' ACGCACAATCCCACTATCCTT 3') and the reverse primer
35STerminator2 (5' AAGAACCCTAATTCCCTTATCTGG 3') close to the
multiple cloning site of pBar-35S, and sequenced. The 35S::GUS
reporter construct from the pBIC20 cosmid vector (Meyer et al.,
1994
) was used to monitor
35S promoter activity in embryos and seedlings. Molecular work was
carried out according to standard protocols (Sambrook et al.,
1989
). Restriction enzymes
were purchased from NEB (New England Biolabs, Hitchin, UK); synthetic
oligonucleotides were from ARK Scientific (Sigma, Germany).
In situ hybridisation
Sample preparation and in situ hybridisation of KNOLLE antisense
riboprobes transcribed in vitro were carried out according to Mayer et al.
(Mayer et al., 1998
), using a
300 bp KNOLLE fragment from the 5' end of the coding region
(Lukowitz et al., 1996
).
Paraffin-embedded material was cut into 8 µm sections for embryos and
12.5-17.5 µm for seedlings. Digoxigenin-labelled probes were detected with
Boehringer anti-Dig FAB (Roche) coupled to alkaline phosphatase. Western
Blue® alkaline phosphatase (Promega, Madison, USA) colour reaction was
carried out for 1-4 days. Samples were mounted in 50% glycerol. Images were
taken with a Zeiss Axiophot (Carl Zeiss Inc., Thornwood, NY), using a Nikon
Coolpix 990 digital camera with 3.34 Mio pixels.
Immunoblotting and whole-mount immunofluorescence microscopy
Immunoblotting and immunolocalisation were as previously described (Lauber
et al., 1997
; Steinmann et
al., 1999
). For separation of
proteins, 12 to 15% polyacrylamide SDS (Sigma) gels were used. Protein
extraction was achieved by grinding plant material with sand and boiling in
1x Laemmli buffer, except for cell fractionation experiments. Western
analysis with rabbit anti-KNOLLE antiserum was performed as previously
described (Lauber et al.,
1997
). Protein concentrations
were estimated by Coomassie Blue staining. Cell fractionation was done as
previously described (Lauber et al.,
1997
). S10 was the supernatant
of a 10,000 g precentrifugation, S100 and P100 were the
supernatant and the pellet of a 100,000 g centrifugation for
12 hours. Integral membrane proteins were solubilised with Triton X-100
(Sigma; Lauber et al.,
1997
).
Protein concentration was measured using a Bradford assay, and equal amounts of protein were loaded onto the gel. Immunolocalisation was carried out with rabbit anti-KNOLLE antiserum diluted 1:2,000 or with mouse monoclonal anti-plasma membrane H+-ATPase antibody diluted 1:500. Root tissue was fixed with 4% paraformaldehyde (Sigma) in MTSB (pH 7.0) for 0.5 hours. Goat anti-rabbit secondary antibody was coupled to Cy3TM (Dianova, Hamburg, Germany) or Alexa-m488 (Molecular Probes, Eugene OR, USA), goat anti-mouse secondary antibody was coupled to Cy3 (Dianova). Instead of MTSB, PBS (pH 7.2) was used in all steps after fixation of the plant material. The primary antibody was incubated for 3 hours at 37°C after blocking for 1 hour with 1% BSA in PBS, the secondary antibody was incubated for 3 hours at 37°C. Nuclei were stained with 1 mg/ml DAPI. After mounting in Citifluor (Agar, Amersham), specimens were analysed with a Zeiss Axiophot epifluorescence microscope equipped with a Nikon Digital camera (3.34 Mio pixels) or with a Leica confocal laser scanning microscope (CLSM) with Leica TCS-NT software. The CLSM standard objective was 63x (water immersion), scanning was carried out with electronic magnification.
Histochemical GUS staining
GUS staining was as previously described (Sundaresan et al.,
1995
). Plant tissue was
incubated in the detection solution (500 mM NaPO4 buffer pH 7.0,
500 mM EDTA pH 8.0, 150 mM potassium ferrocyanide
(K4Fe(CN)6 3H2O), 5% Triton X100, 40 mM
X-Gluc in dimethylformamide) in the dark at 37°C for several hours until
the blue colour became apparent. After transfer to water, the stained tissue
was examined by bright-field light microscopy.
Staining of root hair membranes with fluorescent dyes FM4-64 and
FM1-43
Wild-type and transgenic seedlings grown on agar plates were stained with
the lipophilic steryl-dyes FM4-64 and FM1-43 (1 mg/mL; Molecular Probes,
Eugene OR, USA). Both dyes show a Stoke shift when integrated into membranes,
depending on the membrane composition. Whole seedlings were stained alive or
after fixation with 4% paraformaldehyde (in MTSB) for 5 minutes and then
destained for 15 minutes in water. For confocal laser scanning microscopy,
FM4-64 and FM1-43 were excited by the laser at 568 nm and 488 nm,
respectively, and emitted light at >600 nm and 500-530 nm plus 580-630 nm.
In live root hair cells, FM4-64 stains predominantly endomembranes and also
the plasma membrane, whereas the less hydrophobic dye FM1-43 preferentially
stains the plasma membrane. FM4-64 endomembrane labelling correlated with the
number and size of vacuolar structures in root hairs grown on 0.5x MS
medium by varying sucrose content: increasing sucrose concentration (0% to 3%)
resulted in enlarged but fewer vacuoles.
Immunolocalisation on cryosections and EM analysis
Roots of 5-day-old plants grown on 0.5x MS salts, 1% sucrose and 1%
Select Agar were fixed with 4% formaldehyde in MTSB (pH 7.0) for 60 minutes
and embedded in 1% agarose. After infiltration with 20% (w/v)
polyvinylpyrrolidone (MW 10,000, PVP-10; Sigma) in 1.8 M sucrose (Tokuyasu,
1989
) and freezing in liquid
nitrogen, cells were sectioned at -85°C (400 nm, semithin) or at
-100°C (100 nm, ultrathin) with a Leica Ultracut S/FCS. Cryosections were
transferred to poly-L-lysine-coated (Sigma) coverslips for immunofluorescence
or collected on electron microscopy copper grids. After blocking (1% skim
milk/0.5% BSA in PBS, pH 7.2), labelling with rabbit anti-KNOLLE antiserum
(1:1000) was performed for 60 minutes followed by incubation with
Cy3-conjugated goat anti-rabbit secondary antibody (Dianova) or protein A-15
nm gold for 60 minutes (Slot and Geuze,
1985
). For immunofluorescence,
sections were stained with DAPI and embedded in Mowiol 4.88 (Hoechst,
Frankfurt/Main, Germany; Rodriguez and Deinhardt,
1960
) containing DABCO (25
mg/ml; Sigma; Langanger et al.,
1983
). For electron
microscopy, grids were stained with uranyl acetate and embedded in methyl
cellulose (Sigma) according to Griffiths (Griffiths,
1993
). Cy3-labeled
cryosections were viewed with a Zeiss Axioplan, gold-labelled cryosections
with a Philips 201 electron microscope at 60 kV accelerating voltage. For
ultrastructural analysis, 5-day-old roots were cryofixed in liquid propane,
freeze-substituted in acetone containing 0.5% glutaraldehyde and 0.5% osmium
tetroxide and embedded in Spurr. Ultrathin sections were stained with uranyl
acetate and lead citrate.
Processing of digital pictures
All images shown were processed with Photoshop 5.0 and Illustrator 8.0
(Adobe Mountain View, CA).
| RESULTS |
|---|
|
|
|---|
|
Mistargeting of KNOLLE protein in 35S::KN transgenic
seedling roots
To determine the fate of misexpressed KNOLLE protein, 35S::KN
transgenic embryos and seedlings were analysed by whole-mount
immunolocalisation. Whereas no distinct pattern of abnormal localisation was
detected in embryos (data not shown), deviation from the wild-type pattern was
observed in roots of transgenic seedlings carrying two copies of the
35S::KN transgene outside the meristematic region of the root tip
(Fig. 3). A clear difference
between 35S::KN and wild-type roots was noted in the cells of the
adjacent elongation zone and in the more mature part of the root, but not in
the root tip, where cell divisions take place. The expanding cells of the
central cylinder and the tip-growing root hairs strongly accumulated KNOLLE
protein in transgenic, but not in wild-type seedlings (compare
Fig. 3D,G with
Fig. 3F,H). The activity of the
35S promoter was independently monitored by the expression of a GUS
reporter gene (Fig. 3I-L). GUS
staining was observed in root hairs, the central part of the root and the root
tip, as described previously for the tobacco seedling root (Benfey et al.,
1989
). Although the
35S promoter was active in the proliferating cells of the root tip,
KNOLLE protein failed to accumulate to high levels, presumably owing to cell
cycle-dependent degradation. In summary, KNOLLE protein expressed from the
transgene accumulated in root cells that were no longer dividing.
|
The subcellular localisation of misexpressed KNOLLE protein was analysed in
detail in readily accessible root hair cells by confocal laser scanning
microscopy (Fig. 4). These
non-proliferating epidermal cells form a local outgrowth, the root hair, which
undergoes tip growth by targeting membrane vesicles from the
trans-Golgi to the apical plasma membrane (for a review, see Yang,
1999
; see also
Fig. 5J,K). In a sense, this
preferential vesicle targeting to the growing tip of the root hair resembles
the vesicle targeting to the cell division plane during cytokinesis. Growing
and mature root hairs were immunostained with anti-KNOLLE antiserum and with a
monoclonal antibody directed against the plasma membrane H+-ATPase
(PM-ATPase; Lauber et al.,
1997
). KNOLLE protein
accumulated strongly in growing and mature root hairs of transgenic seedlings,
in contrast to the wild-type control (Fig.
4B-D,E-G; compare with Fig.
4N). In young root hairs, KNOLLE was concentrated at the tip
(Fig. 4B,E,H), whereas older
root hairs also accumulated KNOLLE away from the tip
(Fig. 4C-D,F,G,K). For
comparison, we used the lipophilic fluorescent dye, FM4-64, which labels
predominantly the membrane of the vacuole in yeast (Vida and Emr,
1995
). In root hairs, FM4-64
labelled predominantly endomembranes and to some extent the plasma membrane
(Fig. 4O). Most of the FM4-64
label was located below the KNOLLE-positive apical region in young root hairs
(compare Fig. 4P with 4E). In
older root hairs, however, the FM4-64 label resembled KNOLLE-positive
aggregates (Fig. 4P,Q; compare
with Fig. 4F,G). To determine
the fate of misexpressed KNOLLE protein more precisely, root hairs of
35S::KN seedlings were simultaneously immunostained for PM-ATPase
(Fig. 4H-M). In young root
hairs, both proteins co-localised to the apical tip region, not only at the
surface but also internally (Fig.
4E-G; additional optical sections not shown). Away from the tip
region, both proteins were strictly localised to the surface, resembling the
plasma membrane staining with the lipophilic fluorescent dye, FM1-43 (data not
shown; see Materials and Methods). Older root hairs also displayed almost
perfect co-localisation of KNOLLE and PM-ATPase
(Fig. 4K-M). Thus, KNOLLE
protein was targeted like a protein destined to the apical plasma membrane of
the growing root hair.
|
|
To reveal the ultrastructural localisation of KNOLLE protein in
non-proliferating cells of 35S::KN transgenic seedlings, root
cryosections were prepared for immunogold-labelling electron microscopy
(Fig. 5; see Materials and
Methods). In the central cylinder of the root, expanding cells displayed
cytoplasmic patches of KNOLLE immunofluorescence that resembled those in
dividing cells (Fig. 5D,F;
compare with Fig. 5A). However,
KNOLLE was also located at the plasma membrane, whereas dividing cells
accumulated KNOLLE in the forming cell plate
(Fig. 5F, arrowhead; compare
with Fig. 5B,C). By immunogold
labelling, KNOLLE was detected in Golgi stacks, the trans-Golgi
network and at the plasma membrane of expanding root cells
(Fig. 5G-I). We also analysed
tip-growing young root hairs, which accumulate vesicles underneath the apical
plasma membrane (Fig. 5J,K;
Galway et al., 1997
).
Anti-KNOLLE immunogold label was concentrated at the tip of the root hair,
with vesicles giving the strongest signal
(Fig. 5L). In summary, these
data support the light microscopy observation that KNOLLE protein is
mistargeted to the plasma membrane in non-proliferating cells of
35S::KN transgenic plants. In addition, this is the first time that
KNOLLE protein has been localised in cells at the ultrastructural level.
No rescue of knolle mutant embryos by 35S::KN
transgene expression
Expression of the 35S::KN transgene lacked any detectable
biological effect in the wild-type genetic background. We therefore examined
whether the transgene could functionally replace the endogenous
KNOLLE gene. We transformed plants heterozygous for the
kn-X37-2 mutation (Lukowitz et al.,
1996
) with the
35S::KN transgene and analysed their progeny for the occurrence of
mutant seeds. As a control, we transformed kn-X37-2/KN heterozygous
plants with a genomic DNA fragment that differed from the 35S::KN
transgene in the 5' region, whereas their 3' regions were nearly
identical (see Fig. 1). The
control construct gave 22 kn-X37-2/KN heterozygous and 13
kn-X37-2/knX37-2 homozygous independent transformants, all of which
produced viable and fertile kn-X37-2/knX37-2 homozygous plants (for
details, see Materials and Methods). By contrast, none of the 18
kn-X37-2/KN heterozygous independent transformants bearing the
35S::KN transgene gave rise to kn-X37-2/knX37-2 homozygous
plants. Thus, the 35S::KN transgene did not rescue kn-X37-2
mutant embryos. The transgene also did not promote growth of kn-X37-2
mutant seedlings on callus-inducing medium (data not shown, see Materials and
Methods). Sequencing of the transgene after re-isolation from the transgenic
plants did not show any deviation from the wild-type sequence (see Materials
and Methods). We therefore checked kn-X37-2 mutant seedlings carrying
the 35S::KN transgene for KNOLLE protein accumulation by whole-mount
immunolocalisation (Fig. 6).
KNOLLE protein was detected in root hair cells of those knolle mutant
seedlings. Thus, the 35S::KN transgene produced KNOLLE protein in
knolle mutants, but failed to rescue cytokinesis-defective
kn-X37-2 mutant embryos and seedlings.
|
Low-level accumulation of KNOLLE mRNA transcribed from the
35S promoter in the embryo
To determine why 35S::KN did not rescue the knolle mutant
phenotype, although transgenic plants expressed high levels of KNOLLE protein
(see Fig. 2B,C), we analysed
the transcript accumulation by in situ hybridisation of a KNOLLE
antisense riboprobe to sections of 35S::KN transgenic embryos that
carried two functional copies of the endogenous KNOLLE gene
(Fig. 7). Up to the torpedo
stage of embryogenesis, KN mRNA accumulated in a patchy pattern that
was indistinguishable from the wild-type control
(Fig. 7A,B; Lukowitz et al.,
1996
). At the bent-cotyledon
stage, transgenic embryos showed diffuse expression predominantly in the
cotyledonary primordia, whereas only a few cells in the wild-type control
embryos were labelled (compare Fig.
7D,E,G with Fig.
7C). The intensity of diffuse staining was stronger in embryos
with two copies of the transgene than in those with only one, indicating that
the staining was due to transgene expression (compare
Fig. 7E,G with
Fig. 7D). Transgene expression
was strongest in presumptive vascular cells of the cotyledons
(Fig. 7E,F) and in adjacent
internal cell layers (Fig.
7G,H). Within these stained tissues, individual cells gave
stronger signals that resembled in intensity the stained cells in the
hypocotyl, and probably reflect the expression of the endogenous
KNOLLE gene (Fig. 7H,
arrowheads). In summary, mRNA transcribed from the 35S::KN transgene
accumulated detectably only at advanced stages of embryogenesis, at which its
level of accumulation was lower than that of the endogenous KNOLLE
mRNA. This result was consistent with the observation that developing
35S::GUS embryos showed comparable temporal and spatial distribution
and intensity of GUS expression (data not shown), and that KNOLLE protein
immunolocalisation did not reveal any difference between 35S::KN
transgenic and wild-type embryos.
|
35S::KN transgene expression in the seedling root
To compare KNOLLE mRNA accumulation from 35S::KN
transgene expression with the immunolocalisation of misexpressed KNOLLE
protein, we examined seedling roots by in situ hybridisation. Unlike the
situation in the embryo, most cells of the seedling are mitotically inactive.
Exceptions are the meristems of the shoot and the root as well as the
primordia of leaves and lateral roots. The mature root of wild-type seedlings
showed little or no distinct staining (Fig.
7I). By contrast, the root of transgenic seedlings gave strong
signals in the expanding central cells
(Fig. 7J) and also in
tip-growing root hairs (Fig.
7K). These observations were consistent with the
immunolocalisation of KNOLLE protein in transgenic roots and with the
35S::GUS expression pattern (see
Fig. 3). In addition, strong
expression of the 35S::KN transgene was observed in lateral root
primordia (Fig. 7K), with
patches of dark staining above a lighter background, resembling the situation
in embryogenesis. Thus, the activity of the 35S::KN transgene yielded
high levels of KNOLLE mRNA mainly in non-proliferating cells that did
not express the endogenous KNOLLE gene.
| DISCUSSION |
|---|
|
|
|---|
KNOLLE protein targeting depends on the cell cycle
By expressing KNOLLE in non-proliferating cells, we created an abnormal
situation in which vesicles budding from the trans-Golgi could
deliver KNOLLE to several potential target membranes. However, KNOLLE
co-localised with the plasma membrane H+-ATPase in tip-growing root
hairs, thus behaving like an integral plasma membrane protein. This result was
confirmed by ultrastructural immunolocalisation of KNOLLE protein not only in
root hairs but also in expanding cells of the central cylinder of the root.
Thus, the plasma membrane appears to be the destination of KNOLLE protein in
non-proliferating cells.
Mistargeting of KNOLLE to the plasma membrane did not interfere with
essential cellular processes that are required for normal plant development.
Tip-growing root hairs were morphologically indistinguishable between
35S::KN transgenic and wild-type plants, although only the former
accumulated large amounts of KNOLLE protein in the apical growth zone. This
observation suggests that KNOLLE did not obviously interfere with the
interaction of SNARE complex partners involved in apical membrane fusion,
which would be consistent with recent findings of yeast SNARE pairing
specificity (McNew et al.,
2000
). Although we cannot rule
out the fact that KNOLLE interacts with non-cognate SNARE partners without
obvious deleterious effects, it is also conceivable that in non-proliferating
cells, KNOLLE might be a biologically inactive passenger protein on vesicles
destined to the plasma membrane.
Why does KNOLLE traffic to the plasma membrane in non-proliferating cells?
As eukaryotic cells express several syntaxins, each of which resides in a
distinct membrane compartment, there must be a sorting mechanism to ensure
that each syntaxin is delivered to its proper destination. For example, the
Arabidopsis syntaxin AtPEP12 is targeted to the vacuolar pathway (da
Silva Conceicao et al., 1997
).
Although the mechanism of syntaxin sorting is unknown in plants, recent
observations suggest that sorting occurs during vesicle budding from the
trans-Golgi donor membrane in yeast. An acidic dileucine motif of the
vacuolar t-SNARE Vamp3p appears essential for sorting mediated by the adaptor
protein complex AP-3 (Darsow et al.,
1998
), whereas
Golgi-associated coat proteins with homology to gamma adaptin appear to
interact with a different sorting motif of Pep12p for its targeting to late
endosomes (Black and Pelham,
2000
). By contrast, no
AP3-dependent sorting motif has been identified in the plasma membrane
syntaxins, Sso1 and Sso2 (Tang and Hong,
1999
), and KNOLLE lacks the
consensus acidic di-leucine motif. If post-Golgi trafficking to the plasma
membrane were a default pathway in the absence of specific targeting cues,
mistargeting of KNOLLE protein might reflect the lack of such a sorting
signal. This does not exclude the possibility that normal targeting of KNOLLE
to the plane of cell division may involve a hypothetical sorting-signal
receptor that is not present in non-proliferating cells. The existence of an
active sorting mechanism for proteins destined to the cell plate has been
hypothesised based on the behaviour of GFP-KOR, a GFP fusion to the
Arabidopsis endo-1,4-ß-D-glucanase KORRIGAN (Nicol et al.,
1998
), in a heterologous
expression system (Zuo et al.,
2000
). KORRIGAN and KNOLLE
share a YVDL sequence that may act an AP-dependent sorting motif, although its
physiological significance and specificity remain to be determined (for a
review, see Bonifacino and Dell'Angelica,
1999
).
Independently of specific sorting signals, a general redirection of
membrane flow may be involved in plant cytokinesis. Supporting evidence comes
from two recent observations. The Arabidopsis putative auxin efflux
carrier PIN1, an integral membrane protein, which is normally located in the
basal plasma membrane of non-proliferating vascular cells, also accumulates at
the forming cell plate (Steinmann et al.,
1999
). Furthermore, a secreted
enzyme, cell wall-associated endoxyloglucan transferase, has been reported to
traffic to the plasma membrane during interphase and to the cell plate during
cytokinesis via the endoplasmic reticulum-Golgi pathway in tobacco BY-2 cells
(Yokoyama and Nishitani,
2001
). These observations
suggest that the vast majority of vesicles budding from the trans-Golgi during
M phase traffic to the plane of cell division. These vesicles may incorporate
any membrane or soluble cargo protein that passes through the Golgi stacks at
that time and lacks a retention signal. Accordingly, KNOLLE protein would not
need a sorting motif. Whatever the underlying mechanism, only KNOLLE protein
that is synthesised during M phase can be targeted to the plane of cell
division. Consequently, the level of KNOLLE expression during M phase may be a
crucial parameter for cytokinetic vesicle fusion.
Cytokinesis requires strong KNOLLE expression
The 35S::KN transgene yielded approximately hundred-fold
accumulation of KNOLLE protein in seedlings, when compared with the wild-type
control. This result is consistent with the common use of the 35S promoter for
transgene overexpression in plants (Holtorf et al.,
1996
; Lermontova and Grimm,
2000
; Sentoku et al.,
2000
). However, the
35S::KN transgene did not complement knolle mutant embryos.
One difference between developing embryos and seedlings is that embryo cells
are proliferating, whereas most cells in the seedling are not. As shown by in
situ hybridisation and immunostaining in seedling roots, 35S::KN
transgene expression resulted in the stable accumulation of KNOLLE mRNA and
protein in non-proliferating cells. Comparative in situ hybridisation and
immunostaining of 35S::KN transgenic and wild-type embryos revealed
the relative strength of the 35S promoter in proliferating cells.
Expression of the 35S::KN transgene, if at all detectable,
supplemented the wild-type patchy pattern of KNOLLE mRNA accumulation
by low-level accumulation of KNOLLE mRNA in the primordia of the
cotyledons. The 35S promoter activity was independently assessed in
35S::GUS embryos, which gave a similar developmental expression
pattern and level of expression as 35S::KN (data not shown). Our
results are consistent with previous results demonstrating 35S
promoter activity only from the heart stage on in 35S::GUS transgenic
tobacco embryos (Odell et al.,
1994
). Furthermore, no
additional KNOLLE protein accumulation was detected in 35S::KN
transgenic embryos, when compared with wild-type embryos. Taken together,
these observations suggest that the expression level of the 35S::KN
transgene in proliferating cells was insufficient to rescue knolle
mutant embryos.
The difference between the 35S::KN and the KNOLLE rescue
(KNRescue) constructs was confined to the 5' region, whereas both
constructs contained the same genomic 3' sequence. Thus, any difference
in expression pattern and intensity between the two constructs can be
attributed to different 5' sequences, the KNOLLE cis-regulatory
region as opposed to the 35S promoter. The KNOLLE 5'
sequence appears to integrate signals that link KNOLLE expression to
the cell cycle as indicated by the patchy pattern of mRNA accumulation.
Promoter elements conferring M phase-specific transcription have been
identified in mitotic cyclin genes (Ito et al.,
1998
). The KNOLLE
5' UTR should also contain a sequence that enables translation of the
mRNA during M phase, when most protein expression is shut down (for a review,
see Sachs, 2000
). However,
KNOLLE expression is not strictly linked to karyokinesis, as KNOLLE protein
accumulates between non-mitotic nuclei during endosperm cellularisation
(Lauber et al., 1997
; Otegui
and Staehelin, 2000
).
In contrast to the KNOLLE promoter, the 35S promoter
appears to be active in a cell cycle-independent manner. KNOLLE mRNA
accumulated stably in non-proliferating cells of 35S::KN transgenic
seedlings but only transiently in proliferating cells. Instability of
short-lived mRNAs has been attributed to specific sequences in the 3'
UTR (Gutierrez et al., 1999
;
Sachs, 2000
). In the case of
KNOLLE mRNA, an as yet undefined degradation signal appears to be
linked to the M phase and/or cytokinesis. The lack of strong accumulation of
KNOLLE mRNA in proliferating cells of 35S::KN transgenic
embryos and seedlings suggests that the activity of the 35S promoter
is too low in proliferating cells or does not counteract efficiently the cell
cycle-dependent mRNA degradation. By contrast, the endogenous KNOLLE
promoter is strong enough to yield high levels of mRNA and protein
accumulation in proliferating cells, although it is only active during a brief
period of the cell cycle. Thus, during its period of activity, the endogenous
KNOLLE promoter is clearly stronger than the 35S promoter,
and this difference appears to be crucial for the execution of
cytokinesis.
In summary, there is no obvious need for the observed tight regulation of KNOLLE expression, provided enough KNOLLE protein is available during M phase to ensure efficient vesicle fusion during cell-plate formation. This demand is met by the strong KNOLLE promoter, which is highly active during the period preceding cytokinesis. If there were no cell cycle-dependent degradation of KNOLLE mRNA and protein, both would stably accumulate. Although mistargeting of KNOLLE protein to the plasma membrane appears not to be harmful, it is also not useful. Perhaps proliferating cells gain some selective advantage from linking the degradation of KNOLLE mRNA and protein, as well as the promoter activity, to the cell cycle.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Assaad, F. F., Mayer, U., Wanner, G. and Jürgens, G. (1996). The KEULE gene is involved in cytokinesis in Arabidopsis. Mol. Gen. Genet. 253,267 -277.[Medline]
Assaad, F. F., Huet, Y, Mayer, U. and
Jürgens, G. (2000). The
cytokinesis gene KEULE encodes a Sec1 protein which binds the
syntaxin KNOLLE. J. Cell Biol.
152,531
-543.
Bechtold, N. and Pelletier, G. (1998). In planta Agrobacterium-mediated transformation of adult Arabidopsis thaliana plants by vacuum infiltration. Methods Mol. Biol. 82,259 -266.[Medline]
Bechtold, N., Jaudeau, B., Jolivet, S., Maba, B., Vezon, D.,
Voisin, R. and Pelletier, G. (2000). The maternal chromosome
set is the target of the T-DNA in the in planta transformation of
Arabidopsis thaliana. Genetics
155,1875
-1887.
Benfey, P. N., Ren, L. and Chua, N. H. (1989). The CaMV 35S enhancer contains at least two domains which can confer different developmental and tissue-specific expression patterns. EMBO J. 8,2195 -2202.[Medline]
Black, M. W. and Pelham, H. R. (2000). A
selective transport route from golgi to late endosomes that requires the yeast
GGA proteins. J. Cell Biol.
151,587
-600.
Blatt M. R., Leyman B. and Geelen D. (1999). Molecular events of vesicle trafficking and control by SNARE proteins in plants. New Phytol. 144,389 -418.
Bonifacino, J. S. and Dell'Angelica, E. C.
(1999). Molecular bases for the recognition of tyrosine-based
sorting signals. J. Cell Biol.
145,923
-926.
Burgess, R. W., Deitcher, D. L. and Schwarz, T. L.
(1997). The synaptic protein syntaxin1 is required for
cellularization of Drosophila embryos. J. Cell
Biol. 138,861
-875.
Clague, M. J. and Herrmann, A. (2000). Deciphering fusion. Curr. Biol. 10,R750 -R752.[Medline]
Clough, S. J. and Bent, A. F. (1998). Floral dip: a simplified method for Agrobacterium-mediated transformation Arabidopsis thaliana. Plant J. 16,735 -743.[Medline]
Darsow, T., Burd, C. G. and Emr, S. D. (1998).
Acidic di-leucine motif essential for AP-3-dependent sorting and restriction
of the functional specificity of the Vam3p vacuolar t-SNARE. J.
Cell Biol. 142,:913
-922.
da Silva Conceicao, A., Marty-Mazars, D., Bassham, D. C., Sanderfoot, A. A., Marty, F. and Raikhel, N. V. (1997). The syntaxin homolog AtPEP12p resides on a late post-Golgi compartment in plants. Plant Cell 9,571 -582.[Abstract]
Desfeux, C., Clough, S. J. and Bent, A. F.
(2000). Female reproductive tissues are the primary target of
Agrobacterium-mediated transformation by the Arabidopsis
floral-dip method. Plant Physiol.
123,895
-904.
Fasshauer, D., Antonin, W., Margittai, M., Pabst, S. and Jahn,
R. (1999). Mixed and non-cognate SNARE complexes.
Characterization of assembly and biophysical properties. J. Biol.
Chem. 274,15440
-15446.
Fuerst, R. A., Soni, R., Murray, J. A. and Lindsey, K. (1996) Modulation of cyclin transcript levels in cultured cells of Arabidopsis thaliana. Plant Physiol. 112,1023 -1033.[Abstract]
Fukuda, R., McNew, J. A., Weber, T., Parlati, F., Engel, T. Nickel, W., Rothman, J. E. and Söllner, T. H. (2000). Functional architecture of an intracellular membrane t-SNARE. Nature 407,198 -202.[Medline]
Galway, M. E., Heckman, J. W., Jr. and Schiefelbein, J. W. (1997). Growth and ultrastructure of Arabidopsis root hairs: the rhd3 mutation alters vacuole enlargement and tip growth. Planta 201,209 -218.[Medline]
Griffiths, G. (1993). In Fine Structure Immunocytochemistry (ed. G. Griffiths), pp.174 -177. Heidelberg: Springer Verlag.
Gutierrez, R. A., MacIntosh, G. C. and Green, P. J. (1999). Current perspectives on mRNA stability in plants: multiple levels and mechanisms of control. Trends Plant Sci. 4,429 -438.[Medline]
Heese, M., Mayer, U. and Jürgens, G. (1998). Cytokinesis in flowering plants: cellular process and developmental integration. Curr. Opin. Plant Biol. 1, 486-491.[Medline]
Holtorf, S., Apel, K. and Bohlmann, H. (1996). Comparison of different constitutive and inducible promoters for the overexpression of transgenes in Arabidopsis thaliana. Plant Mol. Biol. 29,637 -646.
Ito, M., Iwase, M., Kodama, H., Lavisse, P., Komamine, A.,
Nishihama, R., Machida, Y. and Watanabe, A. (1998). A novel
cis-acting element in promoters of plant B-type cyclin genes activates M
phase-specific transcription. Plant Cell
10,331
-341.
Ito, M. (2000). Factors controlling cyclin B expression. In The Plant Cell Cycle (ed. D. Inzé). Plant Mol. Biol. 43,677 -690.[Medline]
Jack, T., Brockman, L. L. and Meyerowitz, E. M. (1992). The homeotic gene APETALA3 of Arabidopsis thaliana encodes a MADS box and is expressed in petals and stamens. Cell 68,683 -697.[Medline]
Jack, T., Fox, G. L. and Meyerowitz, E. M. (1994). Arabidopsis homeotic gene APETALA3 ectopic expression: transcriptional and posttranscriptional regulation determine floral organ identity. Cell 76,703 -716.[Medline]
Jahn, R. and Südhof, T. C. (1999). Membrane fusion and exocytosis. Annu. Rev. Biochem. 68,863 -911.[Medline]
Jantsch-Plunger, V. and Glotzer, M. (1999). Depletion of syntaxins in the early Caenorhabditis elegans embryo reveals a role for membrane fusion events in cytokinesis. Curr. Biol. 9,738 -745.[Medline]
Joshi, C. P. (1987). An inspection of the
domain between putative TATA box and translation start site in 79 plant genes.
Nuclei Acids Res. 15,6643
-6653.
Langanger, G., de Mey, J. and Adam, H. (1983). 1,4-Diazobizyklo-[2.2.2]-Octan verzögert das Ausbleichen von Immunfluoreszenzpräparaten. Mikroskopie (Wien) 40,237 -241.
Lauber, M. H., Waizenegger, I., Steinmann, T., Schwarz, H.,
Mayer, U., Hwang, I., Lukowitz, W. and Jürgens,
G. (1997). The Arabidopsis KNOLLE protein is a
cytokinesis-specific syntaxin. J. Cell Biol.
139,1485
-1493.
Lermontova, I. and Grimm, B. (2000).
Overexpression of plastidic protoporphyrinogen IX oxidase leads to resistance
to the diphenyl-ether herbicide acifluorfen. Plant
Physiol. 122,75
-84.
Lukowitz, W., Mayer, U. and Jürgens, G. (1996). Cytokinesis in the Arabidopsis embryo involves the syntaxin-related KNOLLE gene product. Cell 84, 61-71.[Medline]
Mayer U., Torres-Ruiz R. A., Berleth T., Miséra S. and Jürgens G. (1991). Mutations affecting body organization in the Arabidosis embryo. Nature 353,402 -407
Mayer, K. F. X., Schoof, H., Haecker, A., Lenhard, M., Jürgens, G. and Laux, T. (1998). Role of WUSCHEL in regulating stem cell fate in the Arabidopsis shoot meristem. Cell 95,805 -815.[Medline]
McNew, J. A., Parlati, F., Fukuda, R., Miller, R., Söllner, T. H. and Rothman, J. E. (2000). Compartmental specificity of cellular membrane fusion encoded in SNARE proteins. Nature 407,153 -159.[Medline]
Meyer, K., Leube, M. P. and Grill, E. (1994). A
protein phosphatase 2C involved in ABA signal transduction in Arabidopsis
thaliana. Science 264,1452
-1455.
Nacry, P., Mayer, U. and Jürgens, G. (2000). Genetic dissection of cytokinesis. In The Plant Cell Cycle (ed. D. Inzé). Plant Mol. Biol. 43,719 -733.[Medline]
Nicol, F., His, I., Jauneau, A., Vernhettes, S., Canut, H. and Höfte, H. (1998). A plasma membrane-bound putative endo-1,4-b-D-glucanase is required for normal wall assembly and cell elongation in Arabidopsis. EMBO J. 17,5563 -5576.[Medline]
Odell, J. T., Hoopes, J. L. and Vermerris, W. (1994). Seed-specific gene activation mediated by the Cre/lox site-specific recombination system. Plant Physiol. 106,447 -458.[Abstract]
Otegui, M. and Staehelin, L. A. (2000).
Syncytial-type cell plates: a novel kind of cell plate involved in endosperm
cellularization of Arabidopsis. Plant Cell
12,933
-947.
Parlati, F., McNew, J. A., Fukuda, R., Miller, R., Söllner, T. H. and Rothman, J. E. (2000). Topological restriction of SNARE-dependent membrane fusion. Nature 407,194 -198.[Medline]
Robinson, D. N. and Spudich, J. A. (2000). Towards a molecular understanding of cytokinesis. Trends Cell Biol. 10,228 -237.[Medline]
Rodriguez, J. and Deinhardt, F. (1960). Preparation of semipermanent mounting medium for fluorescent antibody studies. Virology 12,316 -317.
Sachs, A. B. (2000). Cell cycle-dependent translation initiation: IRES elements prevail. Cell 101, 243-5.[Medline]
Sambrook, J., Fritsch, E. F. and Maniatis, T. (1989). Molecular Cloning: A Laboratory Manual, 2nd ed. Cold Spring Harbor, NY: Cold Spring Habor Laboratory Press.
Samuels, A. L., Giddings, T. H., Jr and Staehelin, L. A.
(1995). Cytokinesis in tobacco BY-2 and root tip cells: a new
model of cell plate formation in higher plants. J. Cell
Biol. 130,1345
-1357.
Sanderfoot, A. A., Assaad F. F and Raikhel N. V.
(2000). The Arabidopsis Genome. An abundance of soluble
N-Ethylmaleimide-sensitive factor adaptor protein receptors. Plant
Physiol. 124,1558
-1569.
Sentoku, N., Sato, Y. and Matsuoka, M. (2000). Overexpression of rice OSH genes induces ectopic shoots on leaf sheaths of transgenic rice plants. Dev. Biol. 220,358 -364.[Medline]
Slot, J. W. and Geuze, H. J. (1985). A new method for preparing gold probes for multiple-labeling microscopy. Eur. J. Cell Biol. 38,87 -93.[Medline]
Söllner, T., Bennett, M. K., Whiteheart, S. W., Scheller, R. H. and Rothman, J. E. (1993a). A protein assembly-disassembly pathway in vitro that may correspond to sequential steps of synaptic vesicle docking, activation, and fusion. Cell 75,409 -418.[Medline]
Söllner, T., Whiteheart, S. W., Brunner, M., Erdjument-Bromage, H., Geromanos, S., Tempst, P. and Rothman, J. E. (1993b). SNAP receptors implicated in vesicle targeting and fusion. Nature 362,318 -324.[Medline]
Soni, R., Carmichael, J. P., Shah, Z. H. and Murray J. A. H. (1995). A family of cyclin D homologs from plant differentially controlled by growth regulators and containing the conserved retioblastoma protein interaction motiv. Plant Cell 7, 85-103.[Abstract]
Staehelin L. A. and Hepler P. K. (1996). Cytokinesis in higher plants. Cell 84,821 -824.[Medline]
Steinmann, T., Geldner, N., Grebe, M., Mangold, S., Jackson, C.
L., Paris, S., Galweiler, L., Palme, K. and
Jürgens, G. (1999). Coordinated
polar localization of auxin efflux carrier PIN1 by GNOM ARF GEF.
Science 286,316
-318.
Straight, A. F. and Field, C. M. (2000). Microtubules, membranes and cytokinesis. Curr. Biol. 10,R760 -R770.