|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
RESEARCH ARTICLE |

Department of Cell Biology and Cancer Center, University of Massachusetts Medical School, Worcester, MA 01655-0106, USA
* Present address: Department of Biochemistry, School of Medicine, Kyungpook National University, 101 Dong-In Jung-Gu, Daegu 700-422, Korea
Author for correspondence (e-mail: gary.stein{at}umassmed.edu)
Accepted May 21, 2001
| SUMMARY |
|---|
|
|
|---|
Key words: Osteoblasts, Transcriptional control, Nuclear matrix, Osteocalcin, Nuclear localization
| INTRODUCTION |
|---|
|
|
|---|
Localizing regulatory proteins to specialized sites within the nucleus involves nuclear import, in situ interactions with chromatin and transcriptional co-regulators, and subnuclear targeting. Mechanisms controlling nuclear import and interactions of transcription factors with DNA and co-regulators are well defined (Gorlich and Kutay, 1999; Gorlich and Mattaj, 1996; Lemon and Tjian, 2000). However, molecular determinants that target regulatory factors to specific subnuclear domains involved in transcription remain to be identified.
Modifications in multiple parameters of nuclear architecture occur during progression of osteoblast differentiation, as reflected by subnuclear compartmentalization of gene regulatory proteins (Bidwell et al., 1993; Dworetzky et al., 1990) and alterations in chromatin structure of the bone-specific osteocalcin gene (Montecino et al., 1994; Montecino et al., 1996b; Montecino et al., 1996a; Montecino et al., 1999b; Montecino et al., 1999a). Bone-restricted expression of the osteocalcin gene provides a paradigm for defining the mechanisms underlying tissue-specific transcription in the context of nuclear and chromatin architecture. Two osteocalcin gene regulatory factors, nuclear matrix protein 1 (NMP1) and NMP2, have been identified as YY1 and Runx2/Cbfa1, respectively (Guo et al., 1995; Merriman et al., 1995). Both factors are intimately associated with control of steroid-hormone-responsive and tissue-specific transcription (Guo et al., 1997; Javed et al., 1999), suggesting functional coupling between cell signaling and nuclear architecture.
The Runx/Cbfa proteins (e.g. Runx1/AML-1, Runx2/Cbfa1) play vital roles in cellular differentiation and development. Gene ablation studies have revealed that Runx1 is required for definitive hematopoiesis whereas Runx2 is essential for bone formation (Komori et al., 1997; Otto et al., 1997; Wang et al., 1996). Runx proteins interact with the core DNA sequence (RACCRCW) through the highly conserved runt homology domain (Meyers et al., 1993; Ogawa et al., 1993). These proteins exert their effects in part by modifying chromatin organization of tissue-specific gene promoters (Gutierrez et al., 2000; Javed et al., 1999; Montecino et al., 1996b). In addition, the activities of Runx factors are modulated by interactions with coregulatory proteins (e.g. Groucho/TLE, Yes-associated protein (YAP), Smad) that contribute to the integration of cell-signaling pathways in response to physiological cues (Aronson et al., 1997; Hanai et al., 1999; Javed et al., 2000; Levanon et al., 1998; McLarren et al., 2000; Yagi et al., 1999; Zhang et al., 2000a). Runx proteins reside in discrete subnuclear foci and colocalize with transcriptional regulators which activate or repress Runx-dependent genes (Javed et al., 2000; Prince et al., 2001; Zeng et al., 1997; Zeng et al., 1998).
The identification of Runx2/Cbfa1 as a nuclear-matrix-associated tissue-specific transcription factor (Banerjee et al., 1997; Bidwell et al., 1993; Ducy et al., 1997; Merriman et al., 1995) provided the initial insight into the linkage between subnuclear compartmentalization and osteoblast differentiation. Therefore, one important question is how Runx2 is directed to specific subnuclear domains and whether intranuclear localization contributes to regulation of bone-specific genes. In the present study, we have defined a 38 amino acid segment in the C-terminus of Runx2 that is responsible for subnuclear targeting of the transcription factor. Moreover, this nuclear-matrix-targeting signal (NMTS) is sufficient to direct a heterologous protein to the nuclear-matrix-associated foci containing Runx2. Furthermore, subnuclear targeting of Runx2 contributes to transcriptional regulation of the bone-specific osteocalcin gene.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmid constructs
An epitope tag version of pcDNA 3.1 (pHA) was generated by inserting the HA-tag in the HindIII-KpnI sites to replace the His-Xpress tag of pcDNA 3.1 (Invitrogen, Carlsbad, CA). HA-tag Runx2 was constructed by cloning a cDNA encoding Runx2 in the BamHI-XbaI sites of pHA to generate pHA-Runx2 (1-528). pHA-Runx2 (1-516) was generated by digesting pHA-Runx2 (1-528) with EcoRI and XbaI followed by fill-in reaction with DNA polymerase I Klenow fragment and blunt end ligation. pHA-Runx2 (1-376) was generated by the addition of a stop codon by PCR-based site-directed mutagenesis. The Runx2 mutant
397-434 was constructed by PCR-based nest-deletion mutagenesis. Internal deletions of Runx2, that is,
400-467 and
433-467, were generated by digesting pHA-Runx2 with SmaI and BspmI-SmaI, respectively. To generate Gal4 DNA-binding domain (DBD) (1-147) fused with Runx2 (397-434), the aforementioned fragments of Runx2 were amplified with EcoRV-PstI sites incorporated into the primers and the digested PCR products were inserted in frame downstream of the Gal4 DBD. The reading frames of deletion mutants were confirmed by sequencing.
Nuclear extracts and electrophoretic mobility shift assay
Preparation of nuclear extracts from cells expressing proteins of interest and the protocol for electrophoretic mobility shift assays have been described (Javed et al., 1999). The wild-type Runx consensus 5' CGAGTATTGTGGTTAATACG 3' (Meyers et al., 1993) was synthesized using a Beckman synthesizer 2000. The Runx binding site is indicated in bold.
In situ immunofluorescence microscopy
ROS 17/2.8 or HeLa cells grown on gelatin-coated coverslips were transfected with 0.5 µg cytomegalovirus (CMV)-driven wild-type Runx2, its deletion mutants or with expression constructs for Gal4 DBD fused to the NMTS of Runx2. Cells were extracted for in situ nuclear matrix preparations and were analyzed by digital microscopy essentially as described (Javed et al., 2000). HA-tag full-length or deletion mutants of Runx2 were detected by a mouse monoclonal antibody against HA-tag at a dilution of 1:3000 (Zeng et al., 1997). Expression of the Gal4 DBD fusion constructs was detected by a mouse monoclonal antibody against Gal4 DBD (Santa Cruz Biotechnology Inc., Santa Cruz, CA) at a dilution of 1:1000. We used either Alexa 488 anti-rabbit or Alexa 568 anti-mouse secondary antibodies (Molecular Probes, Eugene, OR). To detect endogenous Runx2 in ROS 17/2.8 cells, the rabbit polyclonal antibody (Javed et al., 2001) was used at a dilution of 1:200. Mouse monoclonal antibodies were used to detect SC35, RNA processing speckles (1:500) (Spector et al., 1991), promyelocytic leukemia (PML) bodies (1:1000; Santa Cruz Biotechnology Inc.), coilin (1:100 (Smith et al., 1995)) and nucleolin (1:300; provided by P.-K. Chan, Baylor College of Medicine, TX).
Biochemical fractionation and western blotting
Cells were biochemically fractionated using a protocol previously described (Merriman et al., 1995), with several modifications. HeLa cells grown on 100 mm plates were transfected with 10 µg of full-length Runx2 or deletion constructs and subcellular fractions were prepared 24 hours after transfection. For whole-cell lysate, cells were harvested in 300 µl direct lysis buffer (2% SDS, 2 M urea, 10% glycerol, 10 mM Tris-HCl (pH 6.8), 0.002% bromophenol blue, 10 mM DTT and 1x CompleteTM protease inhibitors (Roche, Indianapolis, IN)). Samples were immediately boiled for 5 minutes and stored at -70°C until used. For subcellular fractionation, cells were collected in ice-cold 1x PBS containing 1x CompleteTM protease inhibitors. Cell pellets were resuspended in 300 µl CSK buffer (100 mM NaCl, 0.3 M sucrose, 10 mM Pipes, 3 mM MgCl2, 1 mM EGTA, 0.5% Triton X-100, pH 6.8) for 10 minutes on ice. Extracted cells were then subjected to centrifugation to collect nuclei. The supernatant containing cytosolic proteins was frozen in liquid nitrogen and stored in aliquots at -70°C. Nuclei were extracted with 300 µl digestion buffer (50 mM NaCl, 0.3 M sucrose, 10 mM Pipes, 3 mM MgCl2, 1 mM EGTA, 0.5% Triton X-100, pH 6.8) containing 400 U DNaseI (Roche) for 30 minutes at room temperature. DNaseI activity was stopped by adding 2 M ammonium sulfate to a final concentration of 250 mM for 5 minutes at room temperature. Extracted nuclei were centrifuged to separate soluble nuclear proteins (chromatin fraction) and insoluble nuclear-matrix-intermediate filament fraction (NM-IF). The NM-IF fraction was then boiled in 300 µl of direct lysis buffer for 5 minutes. The same volume percentage of each fraction was analyzed by 10% SDS-PAGE. Separated proteins were transferred to a PVDF membrane (Millipore) and processed for western blotting as described elsewhere (Ausubel et al., 1997). Antibodies were purchased from Santa Cruz and used in the following dilutions: monoclonal antibody against HA tag (SC-7392; 1:3000), goat polyclonal antibody against lamin B (SC-6217; 1:1000), and the corresponding horse-radish peroxidase (HRP)-conjugated secondary antibodies (SC-2042; 1:2000). Immunoreactivity was assessed using an ECL chemiluminescence kit (Amersham-Pharmacia, Piscataway, NJ).
Reporter gene activity assays
Rat osteosarcoma (ROS 17/2.8) or HeLa cells grown on six-well plates were transfected with 0.1 µg of expression vector for Runx2 or its deletion mutants along with 1 µg of -208 osteocalcin-CAT (OC-CAT), spanning one Runx-binding site (site C) (Banerjee et al., 1996; Javed et al., 1999) of the rat osteocalcin promoter. Rous sarcoma virus-luciferase (RSV-Luc) was included as an internal control for transfection efficiency. Cells were harvested 24 hours after transfection and were processed for CAT (chloramphenicol acetyl transferase) assays as described (Javed et al., 1999). All quantitation was done on the Storm PhosphorImager using ImageQuant software (ABI/Molecular Dynamics, Sunnyvale, CA). The luciferase activity was assessed with Luciferase Assay Kit (Promega, Madison, WI) from the same cell lysate. CAT values were normalized with respect to the luciferase values. The graphs are representative of three independent experiments (n=6 in each experiment) with different DNA preparations.
| RESULTS |
|---|
|
|
|---|
|
|
|
|
400-467) with subnuclear foci in the nuclear matrix (Fig. 5A). Deletion of amino acids 397-434 eliminates NM association of Runx2 (
397-434) (Fig. 5B), whereas removal of amino acids 433-467 does not affect association of the protein with the NM-IF scaffold (Fig. 5C). Thus, our results establish that a 38 amino acid segment of Runx2 is required for in situ subnuclear targeting. We also monitored the biochemical partitioning of Runx2 protein among cytoplasmic, chromatin and nuclear matrix compartments by western blot analysis of subcellular fractions from cells transiently expressing Runx2 deletion mutants (Fig. 6). Mutant proteins containing amino acids 397-434 are detected in the NM-IF compartment, but mutants lacking this region [i.e. Runx2 (1-376), Runx2 (
400-467), Runx2 (
397-434)] are observed only in the cytoplasmic (CSK) and/or chromatin fractions. For comparison, lamin B, a component of the lamina pore complex, is exclusively detected in the NM-IF indicating that principal parameters of nuclear architecture have been preserved (data not shown). We conclude that deletion of the NMTS dramatically alters the subnuclear compartmentalization of Runx2 mutant proteins. The NMTS region is phylogenetically conserved in diverse vertebrate species (Fig. 7), which is consistent with the importance of the NMTS in intranuclear targeting.
|
|
|
|
We assessed whether subnuclear targeting of the Gal4 DBD is functionally linked to transcriptional control of a Gal4-responsive promoter. We transfected the Gal4 DBD or the Gal4-NMTS into HeLa cells containing a genomically integrated luciferase gene driven by Gal4 binding sites. As shown in Fig. 8C, the Gal4-NMTS protein mediates 2.5-fold activation relative to Gal4 DBD alone. Thus, our data indicate that the NMTS supports transcriptional activation of a Gal4-responsive promoter.
The NMTS of Runx2 contributes to activation of the bone-specific osteocalcin gene
We addressed the biological consequences of NMTS-mediated intranuclear targeting of Runx2 on osteoblast-specific gene expression. We compared the transcriptional activities of wild-type Runx2 and mutants lacking the NMTS by monitoring their ability to enhance promoter activity of the rat osteocalcin gene (Fig. 9). Wild-type Runx2 (1-528) activates osteocalcin gene transcription 7-8 fold. This response is reduced to 1.5-2 fold for the Runx2 (1-376) mutant, which lacks the entire C-terminus spanning the NMTS. This result demonstrates that the entire C-terminus of Runx2 is required for optimal physiological activity of the protein. Runx2 mutants missing only the NMTS (
397-434) or 68 amino acids including the NMTS (
400-467) exhibit dramatically reduced transactivation potential similar to the Runx2 mutant (1-376) compared to wild-type Runx2 (1-528). Runx2 mutants in which other segments of the C-terminus were deleted (i.e. Runx2 (
433-467) or Runx2 (1-516)) show only moderately reduced transactivation potential (i.e. from 7-8 fold to 4-5 fold). Interestingly, all three mutants displaying severely reduced transcriptional activity are expressed at comparable levels, are imported into the nucleus (Figs 4, 5) and have normal DNA binding activity (Fig. 3), yet exhibit compromised subnuclear targeting (Figs 4-6). These data strongly suggest that subnuclear targeting of Runx2 is obligatory for optimal transcriptional activity of the protein.
|
| DISCUSSION |
|---|
|
|
|---|
Components of nuclear architecture may influence the spatial organization of nucleic acids and regulatory proteins. Two types of interactions have been reported: stable interactions through nuclear-matrix-associated sequences designated MARs (Bode et al., 2000) and dynamic interactions involving transcription factors and tissue-specific nuclear matrix proteins (Bidwell et al., 1993; Dworetzky et al., 1992; van Wijnen et al., 1993). Distinct transcription factors exhibit characteristic subnuclear distributions. These regulatory proteins interact with DNA in a sequence-specific manner and associate with the components of nuclear architecture at distinct subnuclear sites. Such specific intranuclear domains can provide an environment that increases the probability of achieving a threshold for protein-DNA and protein-protein interactions to organize the regulatory machinery required for tissue-specific transcription.
The Runx family of transcription factors provides a paradigm to understand the link between transcriptional regulation and nuclear architecture. Gene ablation studies suggest that Runx2 is a principal regulator of bone formation in vivo (Komori et al., 1997; Otto et al., 1997). Recently, a nonsense mutation has been reported in exon 7, which results in expression of Runx2 lacking the NMTS (Zhang et al., 2000b). This natural mutation causes the autosomal dominant human disease the cleidocranial dysplasia (CCD), which is characterized by severe craniofacial abnormalities. The C-terminus of Runx1 containing the NMTS is a frequent target of chromosomal translocations in leukemia (Lutterbach et al., 2000; Rowley, 1998), which is consistent with physiological implications for intranuclear trafficking. Loss of the NMTS and aberrant subnuclear targeting of Runx1 has been implicated in the pathology of leukemia. Compromised subnuclear targeting of Runx2 may also contribute to the development of the CCD phenotype. Additional characterization of mechanisms that control localization of Runx proteins at subnuclear sites should contribute to understanding further the development of hematopoietic and skeletal disorders.
Our data suggest that optimal transactivation of the bone-restricted osteocalcin gene by Runx2 is dependent on subnuclear localization and/or intranuclear targeting of the protein. Interestingly, the NMTS of Runx2 we have identified in this study is contained within a larger region that has a transactivation function (Kanno et al., 1998; Thirunavukkarasu et al., 1998). Moreover, this region is responsible for the interaction of Runx2 with several proteins and integrates regulatory cues related to transforming growth factor ß (TGF-ß)/bone morphogenetic protein 2 (BMP2) and Yes/Crk/Src signaling pathways (Hanai et al., 1999; Yagi et al., 1999; Zhang et al., 2000a). We propose that extracellular signaling and protein-protein interactions involving the C-terminus of Runx2 and bone-specific transcriptional control may converge at subnuclear foci to optimize physiological responses.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Aronson, B. D., Fisher, A. L., Blechman, K., Caudy, M. and Gergen, J. P. (1997). Groucho-dependent and -independent repression activities of Runt domain proteins. Mol. Cell. Biol. 17, 5581-5587.
Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A. and Struhl, K. (1997). Current Protocols in Molecular Biology. New York: John Wiley & Sons.
Banerjee, C., Hiebert, S. W., Stein, J. L., Lian, J. B. and Stein, G. S. (1996). An AML-1 consensus sequence binds an osteoblast-specific complex and transcriptionally activates the osteocalcin gene. Proc. Natl. Acad. Sci. USA 93, 4968-4973.
Banerjee, C., McCabe, L. R., Choi, J.-Y., Hiebert, S. W., Stein, J. L., Stein, G. S. and Lian, J. B. (1997). Runt homology domain proteins in osteoblast differentiation: AML-3/CBFA1 is a major component of a bone specific complex. J. Cell. Biochem. 66, 1-8.[Medline]
Bidwell, J. P., van Wijnen, A. J., Fey, E. G., Dworetzky, S., Penman, S., Stein, J. L., Lian, J. B. and Stein, G. S. (1993). Osteocalcin gene promoter-binding factors are tissue-specific nuclear matrix components. Proc. Natl. Acad. Sci. USA 90, 3162-3166.
Bidwell, J. P., Alvarez, M., Feister, H., Onyia, J. and Hock, J. (1998). Nuclear matrix proteins and osteoblast gene expression. J. Bone Miner. Res. 13, 155-167.[Medline]
Bode, J., Benham, C., Knopp, A. and Mielke, C. (2000). Transcriptional augmentation: modulation of gene expression by scaffold/matrix-attached regions (S/MAR elements). Crit. Rev. Eukaryotic Gene Expr. 10, 73-90.[Medline]
Chang, K. S., Fan, Y. H., Andreeff, M., Liu, J. and Mu, Z. M. (1995). The PML gene encodes a phosphoprotein associated with the nuclear matrix. Blood 85, 3646-3653.
Chen, G. and Courey, A. J. (2000). Groucho/TLE family proteins and transcriptional repression. Gene 249, 1-16.[Medline]
Davie, J. R. (1997). Nuclear matrix, dynamic histone acetylation and transcriptionally active chromatin. Mol. Biol. Rep. 24, 197-207.[Medline]
Davie, J. R. (1998). Covalent modifications of histones: expression from chromatin templates. Curr. Opin. Genet. Dev. 8, 173-178.[Medline]
Davie, J. R. and Chadee, D. N. (1998). Regulation and regulatory parameters of histone modifications. J. Cell. Biochem. (Suppl.) 30-31, 203-213.
DeFranco, D. B. and Guerrero, J. (2000). Nuclear matrix targeting of steroid receptors: specific signal sequences and acceptor proteins. Crit. Rev. Eukaryotic Gene Expr. 10, 39-44.[Medline]
Dickinson, L. A., Joh, T., Kohwi, Y. and Kohwi-Shigematsu, T. (1992). A tissue-specific MAR/SAR DNA-binding protein with unusual binding site recognition. Cell 70, 631-645.[Medline]
Ducy, P., Zhang, R., Geoffroy, V., Ridall, A. L. and Karsenty, G. (1997). Osf2/Cbfa1: a transcriptional activator of osteoblast differentiation. Cell 89, 747-754.[Medline]
Dworetzky, S. I., Fey, E. G., Penman, S., Lian, J. B., Stein, J. L. and Stein, G. S. (1990). Progressive changes in the protein composition of the nuclear matrix during rat osteoblast differentiation. Proc. Natl. Acad. Sci. USA 87, 4605-4609.
Dworetzky, S. I., Wright, K. L., Fey, E. G., Penman, S., Lian, J. B., Stein, J. L. and Stein, G. S. (1992). Sequence-specific DNA-binding proteins are components of a nuclear matrix-attachment site. Proc. Natl. Acad. Sci. USA 89, 4178-4182.
Getzenberg, R. H. and Coffey, D. S. (1990). Tissue specificity of the hormonal response in sex accessory tissues is associated with nuclear matrix protein patterns. Mol. Endocrinol. 4, 1336-1342.
Getzenberg, R. H., Pienta, K. J., Ward, W. S. and Coffey, D. S. (1991). Nuclear structure and the three-dimensional organization of DNA. J. Cell. Biochem. 47, 289-299.[Medline]
Gorlich, D. and Mattaj, I. W. (1996). Nucleocytoplasmic transport. Science 271, 1513-1518.[Abstract]
Gorlich, D. and Kutay, U. (1999). Transport between the cell nucleus and the cytoplasm. Annu. Rev. Cell Dev. Biol. 15, 607-660.[Medline]
Guo, B., Odgren, P. R., van Wijnen, A. J., Last, T. J., Nickerson, J., Penman, S., Lian, J. B., Stein, J. L. and Stein, G. S. (1995). The nuclear matrix protein NMP-1 is the transcription factor YY1. Proc. Natl. Acad. Sci. USA 92, 10526-10530.
Guo, B., Aslam, F., van Wijnen, A. J., Roberts, S. G. E., Frenkel, B., Green, M., DeLuca, H., Lian, J. B., Stein, G. S. and Stein, J. L. (1997). YY1 regulates VDR/RXR mediated transactivation of the vitamin D responsive osteocalcin gene. Proc. Natl. Acad. Sci. USA 94, 121-126.
Gutierrez, J., Sierra, J., Medina, R., Puchi, M., Imschenetzky, M., Hiebert, S., van Wijnen, A., Lian, J. B., Stein, G., Stein, J. et al. (2000). Interaction of CBF
/AML/PEBP2
transcription factors with nucleosomal sequences requires flexibility in the translational positioning of the histone octamer and exposure of the Cbf
site. Biochemistry 39, 13565-13574.[Medline]
Hanai, J., Chen, L. F., Kanno, T., Ohtani-Fujita, N., Kim, W. Y., Guo, W.-H., Imamura, T., Ishidou, Y., Fukuchi, M., Shi, M. J. et al. (1999). Interaction and functional cooperation of PEBP2/CBF with smads. Synergistic induction of the immmunoglobulin germline c
promoter. J. Biol. Chem. 274, 31577-31582.
Javed, A., Gutierrez, S., Montecino, M., van Wijnen, A. J., Stein, J. L., Stein, G. S. and Lian, J. B. (1999). Multiple Cbfa/AML sites in the rat osteocalcin promoter are required for basal and vitamin D responsive transcription and contribute to chromatin organization. Mol. Cell. Biol. 19, 7491-7500.
Javed, A., Guo, B., Hiebert, S., Choi, J.-Y., Green, J., Zhao, S.-C., Osborne, M. A., Stifani, S., Stein, J. L., Lian, J. B. et al. (2000). Groucho/TLE/R-Esp proteins associate with the nuclear matrix and repress RUNX (CBF
/AML/PEBP2
) dependent activation of tissue-specific gene transcription. J. Cell Sci. 113, 2221-2231.[Abstract]
Javed, A., Barnes, G. L., Jassanya, B. O., Stein, J. L., Gerstenfeld, L., Lian, J. B. and Stein, G. S. (2001). runt homology domain transcription factors (Runx, Cbfa, and AML) mediate repression of the bone sialoprotein promoter: evidence for promoter context-dependent activity of Cbfa proteins. Mol. Cell. Biol. 21, 2891-2905.
Kanno, T., Kanno, Y., Chen, L. F., Ogawa, E., Kim, W. Y. and Ito, Y. (1998). Intrinsic transcriptional activation-inhibition domains of the polyomavirus enhancer binding protein 2/core binding factor alpha subunit revealed in the presence of the beta subunit. Mol. Cell. Biol. 18, 2444-2454.
Komori, T., Yagi, H., Nomura, S., Yamaguchi, A., Sasaki, K., Deguchi, K., Shimizu, Y., Bronson, R. T., Gao, Y.-H., Inada, M. et al. (1997). Targeted disruption of Cbfa1 results in a complete lack of bone formation owing to maturational arrest of osteoblasts. Cell 89, 755-764.[Medline]
Lawrence, J. B., Singer, R. H. and Marselle, L. M. (1989). Highly localized tracks of specific transcripts within interphase nuclei visualized by in situ hybridization. Cell 57, 493-502.[Medline]
Lemon, B. and Tjian, R. (2000). Orchestrated response: a symphony of transcription factors for gene control. Genes Dev. 14, 2551-2569.
Levanon, D., Goldstein, R. E., Bernstein, Y., Tang, H., Goldenberg, D., Stifani, S., Paroush, Z. and Groner, Y. (1998). Transcriptional repression by AML1 and LEF-1 is mediated by the TLE/Groucho corepressors. Proc. Natl. Acad. Sci. USA 95, 11590-11595.
Lutterbach, B., Westendorf, J. J., Linggi, B., Isaac, S., Seto, E. and Hiebert, S. W. (2000). A mechanism of repression by acute myeloid leukemia-1, the target of multiple chromosomal translocations in acute leukemia. J. Biol. Chem. 275, 651-656.
Mancini, M. G., Liu, B., Sharp, Z. D. and Mancini, M. A. (1999). Subnuclear partitioning and functional regulation of the Pit-1 transcription factor. J. Cell. Biochem. 72, 322-338.[Medline]
McLarren, K. W., Lo, R., Grbavec, D., Thirunavukkarasu, K., Karsenty, G. and Stifani, S. (2000). The mammalian basic helix loop helix protein HES-1 binds to and modulates the transactivating function of the runt-related factor cbfa1. J. Biol. Chem. 275, 530-538.
McNeil, S., Guo, B., Stein, J. L., Lian, J. B., Bushmeyer, S., Seto, E., Atchison, M. L., Penman, S., van Wijnen, A. J. and Stein, G. S. (1998). Targeting of the YY1 transcription factor to the nucleolus and the nuclear matrix in situ: the C-terminus is a principal determinant for nuclear trafficking. J. Cell. Biochem. 68, 500-510.[Medline]
Merriman, H. L., van Wijnen, A. J., Hiebert, S., Bidwell, J. P., Fey, E., Lian, J., Stein, J. and Stein, G. S. (1995). The tissue-specific nuclear matrix protein, NMP-2, is a member of the AML/CBF/PEBP2/runt domain transcription factor family: interactions with the osteocalcin gene promoter. Biochemistry 34, 13125-13132.[Medline]
Meyers, S., Downing, J. R. and Hiebert, S. W. (1993). Identification of AML-1 and the t(8;21) translocation protein (AML-1/ETO) as sequence-specific DNA-binding proteins; the runt homology domain is required for DNA binding and protein-protein interactions. Mol. Cell. Biol. 13, 6336-6345.
Montecino, M., Pockwinse, S., Lian, J., Stein, G. and Stein, J. (1994). DNase I hypersensitive sites in promoter elements associated with basal and vitamin D dependent transcription of the bone-specific osteocalcin gene. Biochemistry 33, 348-353.[Medline]
Montecino, M., Frenkel, B., Lian, J., Stein, J. and Stein, G. (1996a). Requirement of distal and proximal promoter sequences for chromatin organization of the osteocalcin gene in bone-derived cells. J. Cell. Biochem. 63, 221-228.[Medline]
Montecino, M., Lian, J., Stein, G. and Stein, J. (1996b). Changes in chromatin structure support constitutive and developmentally regulated transcription of the bone-specific osteocalcin gene in osteoblastic cells. Biochemistry 35, 5093-5102.[Medline]
Montecino, M., Frenkel, B., van Wijnen, A. J., Lian, J. B., Stein, G. S. and Stein, J. L. (1999a). Chromatin hyperacetylation abrogates vitamin D-mediated transcriptional upregulation of the tissue-specific osteocalcin gene in vivo. Biochemistry 38, 1338-1345.[Medline]
Montecino, M., van Wijnen, A. J., Lian, J. B., Stein, J. L. and Stein, G. S. (1999b). Phosphorylation-mediated control of chromatin organization and transcriptional activity of the tissue-specific osteocalcin gene. J. Cell. Biochem. 72, 586-594.[Medline]
Nickerson, J. A., Blencowe, B. J. and Penman, S. (1995). The architectural organization of nuclear metabolism. In Structural and Functional Organization of the Nuclear Matrix (eds R. Berezney and K. W. Jeon.), pp. 67-123. New York: Academic Press.
Ogawa, E., Maruyama, M., Kagoshima, H., Inuzuka, M., Lu, J., Satake, M., Shigesada, K. and Ito, Y. (1993). PEBP2/PEA2 represents a family of transcription factors homologous to the products of the Drosophila runt gene and the human AML1 gene. Proc. Natl. Acad. Sci. USA 90, 6859-6863.
Otto, F., Thornell, A. P., Crompton, T., Denzel, A., Gilmour, K. C., Rosewell, I. R., Stamp, G. W. H., Beddington, R. S. P., Mundlos, S., Olsen, B. R. et al. (1997). Cbfa1, a candidate gene for cleidocranial dysplasia syndrome, is essential for osteoblast differentiation and bone development. Cell 89, 765-771.[Medline]
Prince, M., Banerjee, C., Javed, A., Green, J., Lian, J. B., Stein, G. S., Bodine, P. V. and Komm, B. S. (2001). Expression and regulation of Runx2/Cbfa1 and osteoblast phenotypic markers during the growth and differentiation of human osteoblasts. J. Cell. Biochem. 80, 424-440.[Medline]
Puvion-Dutilleul, F., Besse, S., Chan, E. K., Tan, E. M. and Puvion, E. (1995). p80-coilin: a component of coiled bodies and interchromatin granule- associated zones. J. Cell Sci. 108, 1143-1153.[Abstract]
Reyes, J.-C., Muchardt, C. and Yaniv, M. (1997). Components of the human SWI/SNF complex are enriched in active chromatin and are associated with the nuclear matrix. J. Cell Biol. 137, 263-274.
Rowley, J. D. (1998). The critical role of chromosome translocations in human leukemias. Annu. Rev. Genet. 32, 495-519.[Medline]
Shopland, L. S. and Lawrence, J. B. (2000). Seeking common ground in nuclear complexity. J. Cell Biol. 150, F1-F4.[Medline]
Smith, K. P., Carter, K. C., Johnson, C. V. and Lawrence, J. B. (1995). U2 and U1 snRNA gene loci associate with coiled bodies. J. Cell. Biochem. 59, 473-485.[Medline]
Spector, D. L., Fu, X. D. and Maniatis, T. (1991). Associations between distinct pre-mRNA splicing components and the cell nucleus. EMBO J. 10, 3467-3481.[Medline]
Stein, G. S., van Wijnen, A. J., Stein, J. L., Lian, J. B., Montecino, M., Choi, J.-Y., Zaidi, K. and Javed, A. (2000). Intranuclear trafficking of transcription factors: implications for biological control. J. Cell Sci. 113, 2527-2533.[Abstract]
Stenoien, D. L., Patel, K., Mancini, M. G., Dutertre, M., Smith, C. L., OMalley, B. W. and Mancini, M. A. (2001). FRAP reveals that mobility of oestrogen receptor-
is ligand- and proteasome-dependent. Nat. Cell Biol. 3, 15-23.[Medline]
Thirunavukkarasu, K., Mahajan, M., McLarren, K. W., Stifani, S. and Karsenty, G. (1998). Two domains unique to osteoblast-specific transcription factor Osf2/Cbfa1 contribute to its transactivation function and its inability to heterodimerize with Cbf beta. Mol. Cell. Biol. 18, 4197-4208.
van Steensel, B., Brink, M., van der Meulen, K., van Binnendijk, E. P., Wansink, D. G., de Jong, L., de Kloet, E. R. and van Driel, R. (1995a). Localization of the glucocorticoid receptor in discrete clusters in the cell nucleus. J. Cell Sci. 108, 3003-3011.[Abstract]
van Steensel, B., Jenster, G., Damm, K., Brinkmann, A. O. and van Driel, R. (1995b). Domains of the human androgen receptor and glucocorticoid receptor involved in binding to the nuclear matrix. J. Cell. Biochem. 57, 465-478.[Medline]
van Wijnen, A. J., Bidwell, J. P., Fey, E. G., Penman, S., Lian, J. B., Stein, J. L. and Stein, G. S. (1993). Nuclear matrix association of multiple sequence-specific DNA binding activities related to SP-1, ATF, CCAAT, C/EBP, OCT-1, and AP-1. Biochemistry 32, 8397-8402.[Medline]
Wang, Q., Stacy, T., Binder, M., Marin-Padilla, M., Sharpe, A. H. and Speck, N. A. (1996). Disruption of the Cbfa2 gene causes necrosis and hemorrhaging in the central nervous system and blocks definitive hematopoiesis. Proc. Natl. Acad. Sci. USA 93, 3444-3449.
Wei, X., Samarabandu, J., Devdhar, R. S., Siegel, A. J., Acharya, R. and Berezney, R. (1998). Segregation of transcription and replication sites into higher order domains. Science 281, 1502-1505.
Wei, X., Somanathan, S., Samarabandu, J. and Berezney, R. (1999). Three-dimensional visualization of transcription sites and their association with splicing factor-rich nuclear speckles. J. Cell Biol. 146, 543-558.
Yagi, R., Chen, L. F., Shigesada, K., Murakami, Y. and Ito, Y. (1999). A WW domain-containing yes-associated protein (YAP) is a novel transcriptional co-activator. EMBO J. 18, 2551-2562.[Medline]
Zeng, C., van Wijnen, A. J., Stein, J. L., Meyers, S., Sun, W., Shopland, L., Lawrence, J. B., Penman, S., Lian, J. B., Stein, G. S. et al. (1997). Identification of a nuclear matrix targeting signal in the leukemia and bone-related AML/CBF
transcription factors. Proc. Natl. Acad. Sci. USA 94, 6746-6751.
Zeng, C., McNeil, S., Pockwinse, S., Nickerson, J. A., Shopland, L., Lawrence, J. B., Penman, S., Hiebert, S. W., Lian, J. B., van Wijnen, A. J. et al. (1998). Intranuclear targeting of AML/CBF
regulatory factors to nuclear matrix-associated transcriptional domains. Proc. Natl. Acad. Sci. USA 95, 1585-1589.
Zhang, Y. W., Yasui, N., Ito, K., Huang, G., Fujii, M., Hanai, J., Nogami, H., Ochi, T., Miyazono, K. and Ito, Y. (2000a). A RUNX2/PEBP2alpha A/CBFA1 mutation displaying impaired transactivation and Smad interaction in cleidocranial dysplasia. Proc. Natl. Acad. Sci. USA 97, 10549-10554.
Zhang, Y., Yasui, N., Kakazu, N., Abe, T., Takada, K., Imai, S., Sato, M., Nomura, S., Ochi, T., Okuzumi, S. et al. (2000b). PEBP2alphaA/CBFA1 mutations in Japanese cleidocranial dysplasia patients. Gene 244, 21-28.[Medline]
This article has been cited by other articles:
![]() |
C. R. Dowdy, R. Xie, D. Frederick, S. Hussain, S. K. Zaidi, D. Vradii, A. Javed, X. Li, S. N. Jones, J. B. Lian, et al. Definitive hematopoiesis requires Runx1 C-terminal-mediated subnuclear targeting and transactivation Hum. Mol. Genet., January 6, 2010; (2010) ddp568v2. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Li, W. Pan, W. Xu, N. He, X. Chen, H. Liu, L. Darryl Quarles, H. Zhou, and Z. Xiao RUNX2 mutations in Chinese patients with cleidocranial dysplasia Mutagenesis, September 1, 2009; 24(5): 425 - 431. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Baniwal, O. Khalid, D. Sir, G. Buchanan, G. A. Coetzee, and B. Frenkel Repression of Runx2 by Androgen Receptor (AR) in Osteoblasts and Prostate Cancer Cells: AR Binds Runx2 and Abrogates Its Recruitment to DNA Mol. Endocrinol., August 1, 2009; 23(8): 1203 - 1214. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.H. Jonason, G. Xiao, M. Zhang, L. Xing, and D. Chen Post-translational Regulation of Runx2 in Bone and Cartilage Journal of Dental Research, August 1, 2009; 88(8): 693 - 703. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Moenning, R. Jager, A. Egert, W. Kress, E. Wardelmann, and H. Schorle Sustained Platelet-Derived Growth Factor Receptor {alpha} Signaling in Osteoblasts Results in Craniosynostosis by Overactivating the Phospholipase C-{gamma} Pathway Mol. Cell. Biol., February 1, 2009; 29(3): 881 - 891. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. D. Jensen, R. Gopalakrishnan, and J. J. Westendorf Bone Morphogenic Protein 2 Activates Protein Kinase D to Regulate Histone Deacetylase 7 Localization and Repression of Runx2 J. Biol. Chem., January 23, 2009; 284(4): 2225 - 2234. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Li, M. Huang, H. Zheng, Y. Wang, F. Ren, Y. Shang, Y. Zhai, D. M. Irwin, Y. Shi, D. Chen, et al. CHIP promotes Runx2 degradation and negatively regulates osteoblast differentiation J. Cell Biol., October 21, 2008; 181(6): 959 - 972. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. M. Teplyuk, M. Galindo, V. I. Teplyuk, J. Pratap, D. W. Young, D. Lapointe, A. Javed, J. L. Stein, J. B. Lian, G. S. Stein, et al. Runx2 Regulates G Protein-coupled Signaling Pathways to Control Growth of Osteoblast Progenitors J. Biol. Chem., October 10, 2008; 283(41): 27585 - 27597. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Q. Hassan, R. Tare, S. H. Lee, M. Mandeville, B. Weiner, M. Montecino, A. J. van Wijnen, J. L. Stein, G. S. Stein, and J. B. Lian HOXA10 Controls Osteoblastogenesis by Directly Activating Bone Regulatory and Phenotypic Genes Mol. Cell. Biol., May 1, 2007; 27(9): 3337 - 3352. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. W. Young, M. Q. Hassan, X.-Q. Yang, M. Galindo, A. Javed, S. K. Zaidi, P. Furcinitti, D. Lapointe, M. Montecino, J. B. Lian, et al. Mitotic retention of gene expression patterns by the cell fate-determining transcription factor Runx2 PNAS, February 27, 2007; 104(9): 3189 - 3194. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. F.-X. Ainscough, F. A. Rahman, H. Sercombe, A. Sedo, B. Gerlach, and D. Coverley C-terminal domains deliver the DNA replication factor Ciz1 to the nuclear matrix J. Cell Sci., January 1, 2007; 120(1): 115 - 124. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. J. Nichols, M. S. Wiebe, and P. Traktman The Vaccinia-related Kinases Phosphorylate the N' Terminus of BAF, Regulating Its Interaction with DNA and Its Retention in the Nucleus Mol. Biol. Cell, May 1, 2006; 17(5): 2451 - 2464. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. Moorefield, H. Yin, T. D. Nichols, C. Cathcart, S. O. Simmons, and J. M. Horowitz Sp2 Localizes to Subnuclear Foci Associated with the Nuclear Matrix Mol. Biol. Cell, April 1, 2006; 17(4): 1711 - 1722. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Seo, M. M. Lozano, and J. P. Dudley Nuclear Matrix Binding Regulates SATB1-mediated Transcriptional Repression J. Biol. Chem., July 1, 2005; 280(26): 24600 - 24609. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Galindo, J. Pratap, D. W. Young, H. Hovhannisyan, H.-J. Im, J.-Y. Choi, J. B. Lian, J. L. Stein, G. S. Stein, and A. J. van Wijnen The Bone-specific Expression of Runx2 Oscillates during the Cell Cycle to Support a G1-related Antiproliferative Function in Osteoblasts J. Biol. Chem., May 27, 2005; 280(21): 20274 - 20285. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Vradii, S. K. Zaidi, J. B. Lian, A. J. van Wijnen, J. L. Stein, and G. S. Stein Point mutation in AML1 disrupts subnuclear targeting, prevents myeloid differentiation, and effects a transformation-like phenotype PNAS, May 17, 2005; 102(20): 7174 - 7179. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. K. Inman, N. Li, and P. Shore Oct-1 Counteracts Autoinhibition of Runx2 DNA Binding To Form a Novel Runx2/Oct-1 Complex on the Promoter of the Mammary Gland-Specific Gene {beta}-casein Mol. Cell. Biol., April 15, 2005; 25(8): 3182 - 3193. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Javed, G. L. Barnes, J. Pratap, T. Antkowiak, L. C. Gerstenfeld, A. J. van Wijnen, J. L. Stein, J. B. Lian, and G. S. Stein Impaired intranuclear trafficking of Runx2 (AML3/CBFA1) transcription factors in breast cancer cells inhibits osteolysis in vivo PNAS, February 1, 2005; 102(5): 1454 - 1459. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Q. Hassan, A. Javed, M. I. Morasso, J. Karlin, M. Montecino, A. J. van Wijnen, G. S. Stein, J. L. Stein, and J. B. Lian Dlx3 Transcriptional Regulation of Osteoblast Differentiation: Temporal Recruitment of Msx2, Dlx3, and Dlx5 Homeodomain Proteins to Chromatin of the Osteocalcin Gene Mol. Cell. Biol., October 15, 2004; 24(20): 9248 - 9261. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Zaidi, D. W. Young, J.-Y. Choi, J. Pratap, A. Javed, M. Montecino, J. L. Stein, J. B. Lian, A. J. van Wijnen, and G. S. Stein Intranuclear Trafficking: Organization and Assembly of Regulatory Machinery for Combinatorial Biological Control J. Biol. Chem., October 15, 2004; 279(42): 43363 - 43366. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. W. Young, S. K. Zaidi, P. S. Furcinitti, A. Javed, A. J. van Wijnen, J. L. Stein, J. B. Lian, and G. S. Stein Quantitative signature for architectural organization of regulatory factors using intranuclear informatics J. Cell Sci., October 1, 2004; 117(21): 4889 - 4896. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. L. Sierra, S.-L. Cheng, A. P. Loewy, N. Charlton-Kachigian, and D. A. Towler MINT, the Msx2 Interacting Nuclear Matrix Target, Enhances Runx2-dependent Activation of the Osteocalcin Fibroblast Growth Factor Response Element J. Biol. Chem., July 30, 2004; 279(31): 32913 - 32923. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Telfer, E. E. Hedblom, M. K. Anderson, M. N. Laurent, and E. V. Rothenberg Localization of the Domains in Runx Transcription Factors Required for the Repression of CD4 in Thymocytes J. Immunol., April 1, 2004; 172(7): 4359 - 4370. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Zaidi, D. W. Young, S. M. Pockwinse, A. Javed, J. B. Lian, J. L. Stein, A. J. van Wijnen, and G. S. Stein Mitotic partitioning and selective reorganization of tissue-specific transcription factors in progeny cells PNAS, December 9, 2003; 100(25): 14852 - 14857. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Zhang, D. R. Dowd, A. Staal, C. Gu, J. B. Lian, A. J. van Wijnen, G. S. Stein, and P. N. MacDonald Nuclear Coactivator-62 kDa/Ski-interacting Protein Is a Nuclear Matrix-associated Coactivator That May Couple Vitamin D Receptor-mediated Transcription and RNA Splicing J. Biol. Chem., September 12, 2003; 278(37): 35325 - 35336. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Jin, H. Mao, R. W. Schnepp, S. M. Sykes, A. C. Silva, A. D. D'Andrea, and X. Hua Menin Associates with FANCD2, a Protein Involved in Repair of DNA Damage Cancer Res., July 15, 2003; 63(14): 4204 - 4210. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Tazawa, W. Osman, Y. Shoji, E. Treuter, J.-A. Gustafsson, and J. Zilliacus Regulation of Subnuclear Localization Is Associated with a Mechanism for Nuclear Receptor Corepression by RIP140 Mol. Cell. Biol., June 15, 2003; 23(12): 4187 - 4198. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Barseguian, B. Lutterbach, S. W. Hiebert, J. Nickerson, J. B. Lian, J. L. Stein, A. J. van Wijnen, and G. S. Stein Multiple subnuclear targeting signals of the leukemia-related AML1/ETO and ETO repressor proteins PNAS, November 26, 2002; 99(24): 15434 - 15439. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. J. Westendorf, S. K. Zaidi, J. E. Cascino, R. Kahler, A. J. van Wijnen, J. B. Lian, M. Yoshida, G. S. Stein, and X. Li Runx2 (Cbfa1, AML-3) Interacts with Histone Deacetylase 6 and Represses the p21CIP1/WAF1 Promoter Mol. Cell. Biol., November 15, 2002; 22(22): 7982 - 7992. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Zaidi, A. J. Sullivan, A. J. van Wijnen, J. L. Stein, G. S. Stein, and J. B. Lian Integration of Runx and Smad regulatory signals at transcriptionally active subnuclear sites PNAS, June 11, 2002; 99(12): 8048 - 8053. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||