Fig. 1. Position of primers used for PCR mutagenesis of YPT7 gene. x, indicates the ypt7^D129A mutation. The first base of the YPT7 gene (A to ATG codon) is designated +1. Nucleotide positions refer to the first 5' base of oligonucleotide homologous to genomic DNA. For details see Materials and Methods. The sequences of the primers: oRK25: 5'GGAATAACCTCAGAACTCAC3'; oRK26: 5'TTGAAAGGGCCATCACATCC3'; oRK28: 5'TGCTGCCGAAGAATCTAA3' (the changed base is bold and underlined); oYPT1: 5'AATACTTATCATTGACA3'.

Return to article