spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    


Right arrow Help viewing high resolution images
Right arrow Return to article
(Downloading may take up to 30 seconds.
If the slide opens in your browser, select File -> Save As to save it.)



Fig. 1. Position of primers used for PCR mutagenesis of YPT7 gene. x, indicates the ypt7D129A mutation. The first base of the YPT7 gene (A to ATG codon) is designated +1. Nucleotide positions refer to the first 5' base of oligonucleotide homologous to genomic DNA. For details see Materials and Methods. The sequences of the primers: oRK25: 5'GGAATAACCTCAGAACTCAC3'; oRK26: 5'TTGAAAGGGCCATCACATCC3'; oRK28: 5'TGCTGCCGAAGAATCTAA3' (the changed base is bold and underlined); oYPT1: 5'AATACTTATCATTGACA3'.





Right arrow Return to article