|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
RESEARCH ARTICLE |
Institut der Anthropologie und Humangenetik fuer Biologen, Johann-Wolfgang-Goethe-Universitaet Frankfurt, Siesmayerstrasse 70, D-60054 Frankfurt/Main, Germany
*Author for correspondence (e-mail: starzinski-powitz{at}em.uni-frankfurt.de)
Accepted July 23, 2001
| SUMMARY |
|---|
|
|
|---|
Key words: p120(ctn) subfamily, MOM recruitment assay, Armadillo repeat protein
| INTRODUCTION |
|---|
|
|
|---|
The human gene maps to chromosome 22q11, the so-called DiGeorge critical region (Sirotkin et al., 1997; Bonne et al., 1998), which is hemizygous in 80-85% of DiGeorge patients and those with velo cardio facial syndrome (Desmaze et al., 1993; Kelly et al., 1993; Morrow et al., 1995). Human ARVCF appears to be more or less ubiquitously expressed, being found in a variety of tissues including heart, skeletal muscle, lung, brain, liver, pancreas and kidney (Sirotkin et al., 1997).
Murine and human ARVCF can associate with the membrane proximal amino acids in the cytoplasmic region of cadherins such as E-cadherin in epithelial cells and M-cadherin in muscle cells (Reynolds et al., 1994; Kaufmann et al., 2000; Mariner et al., 2000). This was shown in detail by binding assays using GST-fusion proteins comprising the cytoplasmic domain of M-cadherin plus several deletion mutants, demonstrating that the 55 membrane-proximal CPD amino acids of M-cadherin are necessary and sufficient for ARVCF binding. Vice versa, all ten armadillo repeats of ARVCF are necessary for efficient M-cadherin binding. Deletion of repeats 1 to 4 or 1 to 5 abolished the ability of ARVCF to colocalise with N-cadherin in rat ventricular cardiomyocytes, although such deletions still facilitated some interactions in vitro (Kaufmann et al., 2000). However, whether ARVCF directly connects the cadherin complex to the cytoskeleton or is involved in cadherin clustering is not yet clear.
In human ARVCF two alternative splicing events have been reported. One concerns the N-terminus leading to the removal of the coiled-coil domain and the use of an alternative start codon. The second splice event leads to the insertion of an 18 base pair exon in the armadillo region that alters the putative NLS (Sirotkin et al., 1997). It has also been shown for p120(ctn) and other members of the subfamily that different isoforms can arise by alternative splicing (Hatzfeld, 1999; Paulson et al., 2000). For p120(ctn) itself this applies to the N-terminus where alternative splicing leads to the use of different start codons. Furthermore, the armadillo repeat region and the C-terminus can be altered by using three alternative exons (Keirsebilck et al., 1998).
Cadherins are a multigene family of calcium-dependent transmembrane cell-cell adhesion glycoproteins that mediate homophilic interactions and are expressed in a tissue-specific manner (Ringwald et al., 1987; Takeichi, 1991; Geiger and Ayalon, 1992; Shapiro et al., 1995; Huber et al., 1996). Many of the cadherins have been classified according to the tissues from which they have been isolated, such as P-cadherin from placenta, E-cadherin first isolated from epithelial cells or M-cadherin from muscle. The classical cadherins (and M-cadherin) consist of an N-terminal extracellular domain, a short transmembrane region and a cytoplasmic domain (CPD) averaging 150-160 amino acids, which all exhibit a high degree of homology with each other (Chothia and Jones, 1997; Humphries and Newham, 1998; Kaufmann et al., 1999a). Most cadherins are known to form two distinct complexes with catenins via their CPD (Ozawa et al., 1989; Hirano et al., 1992; Aberle et al., 1994; Butz and Kemler, 1994; Hinck et al., 1994; Näthke et al., 1994; Knudsen et al., 1995; Hertig et al., 1996; Kuch et al., 1997; Finnemann et al., 1997; Yap et al., 1998; Allport et al., 2000). One complex is composed of the respective cadherin, ß-catenin and
-catenin, a second complex contains cadherin, plakoglobin (also called
-catenin) and
-catenin.
-catenin joins the complex by binding to ß-catenin or plakoglobin and connects this cadherin-catenin complex to components of the cytoskeleton (Hirano et al., 1987; Tsukita et al., 1992). ß-catenin interacts with the C-terminal part of cadherins CPD, whereas ARVCF and p120(ctn), for example, bind to the juxtamembrane region of the cadherins cytoplasmic tail, as discussed above. ARVCF and p120(ctn) compete for the same binding site in the CPD of cadherins (Mariner et al., 2000) but the different functions of the two molecules are as yet unknown.
Many proteins of the armadillo repeat family are known to enter the nucleus, although the mechanism and functional consequences of this have only been described for ß-catenin. In addition to its interaction with cadherins, ß-catenin can enter the nucleus alone or complexed with Tcf/Lef, a transcription factor of the Lef1/TCF family. Together with Tcf/Lef, ß-catenin can stimulate the transcription of different target genes (Behrens et al., 1996; Molenaar et al., 1996; van de Wetering et al., 1997). Similary, ARVCF and p120(ctn) show a dual localisation at cell-cell junctions and under some circumstances in the nucleus (van Hengel et al., 1999; Kaufmann et al., 2000; Mariner et al., 2000). Their role in the nucleus, however, remains to be determined.
We report here the identification and cloning of novel N- and C-terminal isoforms of murine ARVCF resulting, for example, from the use of different start codons. By using RT-PCR, we show that the appearance of the isoforms varies depending on the cell line or tissue examined. Cloned as EGFP-fusion proteins and expressed in different cell lines we demonstrate that the localisation of mARVCF isoforms is not influenced by the N- or C-terminus of the protein but depends on the cellular context. Using the MOM recruitment assay we examined the ability of all isoforms to associate with M-, E- or N-cadherin in different cell types.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Antibodies
The monoclonal antibody 4A6 described previously (Rüdiger et al., 1997) was used to identify the birch profilin (BP) tag. Monoclonal anti-GFP antibody was obtained from Clontech (Heidelberg, Germany). Polyclonal antibodies against the extracellular domain of M-cadherin were affinity-purified as described (Rose et al., 1994; Kaufmann et al., 1999b). Monoclonal pan-cadherin (clone CH-19) and monoclonal N-cadherin antibody (anti-A-CAM, clone GC-4) were obtained from Sigma (Buchs, Switzerland). E-cadherin antibody was obtained from Monosan (Germany). Secondary antibody (Alexa Fluor 568) was obtained from Molecular Probes (Leiden, The Netherlands).
Immunofluorescence
Cells grown on coverslips were rinsed in PBS and fixed in 4% paraformaldehyde (PFA) in PBS at room temperature for 10 minutes. After fixation, cells were permeabilised by incubation with 0.2% Triton X-100 in PBS for 10 minutes, washed three times with PBS and incubated with the relevant antibodies diluted in PBS/10% FCS for 1 hour (RT). After washing three times with PBS, binding of the primary antibodies was detected by species-specific fluorochrome-conjugated secondary antibodies diluted in PBS/10% FCS. Controls in the absence of primary antibodies confirmed the specificity of the immunolabelling. Fluorescence was monitored with a Zeiss Axiophot microscope. Pictures were taken with 40x, 63x or 100x objectives. Kodak Elite 400 film (400 ASA; Eastman Kodak, Rochester, NY) was used for colour slides.
Immunoblotting
SDS-PAGE and immunoblots were performed as described for E-cadherin (Butz and Kemler, 1994) and M-cadherin (Kuch et al., 1997; Kaufmann et al., 1999b). Membranes were incubated with a primary GFP-antibody for 1 hour followed by incubation with alkaline phosphatase (AP)-conjugated secondary antibody (Dianova, Hamburg, Germany), which was visualised using the phosphatase substrates nitroblue-tetrazolium and 5-bromo-4 chloro-3-indolyl (NBT/BCIP) (Boehringer Mannheim, Germany).
Isolation of mARVCF splice variants by RT-PCR
The different splice variants of mARVCF were obtained by RT-PCR using Pfx-polymerase (Gibco). First strand cDNA was prepared from RNA templates extracted from differentiating i28 cells 30 hours after induction for fusion using the primers indicated in Fig. 1 (primer sequences in 5'
3' orientation: 5' UTR: GCCTGTCTTGGGGGCGGA; 6R: ACTCGGTCCAAGCTGCCC; Seq5-5: ATCGCGCTGCGCAACCTCTCA; Seq5-6: TGCAGAGGGATGGCTGGACGA; Ex19as: GGATACTGGCACACAGGTGG; 11R: TCTCCTACCACACAGCACC). Subsequently, 1 µl Taq-polymerase (Gibco) was added to produce 3'-overhanging adenine nucleotides for cloning the fragments into the vector pGEMTM-T Easy (Promega). The fidelity of the amplified fragments was confirmed by DNA sequencing.
|
The vector pMOM was used for the analysis of intracellular recruitment of ARVCF by different cadherins (for plasmid construction see Kaufmann et al.) (Kaufmann et al., 2000). Mouse M-cadherin (residues 626-784; GenBank accession no. M74541) or mouse N-cadherin cytoplasmic domain (residues 747-906; GenBank accession no. AB008811) were amplified either from a plasmid (M-cadherin) or by RT-PCR from mRNA of mouse heart tissue (N-cadherin) with primers containing a BamHI (sense primer) and EcoRI restriction site (reverse primer) for insertion of the PCR fragments into pMOM.
GST-fusion constructs were generated by cloning the cytoplasmic domain of the respective cadherin as a PCR-product into the prokaryotic expression vector pGEX-5X-1 (Pharmacia, Freiburg, Germany) using BamHI and EcoRI restriction sites.
In vitro GST binding assay
mARVCF splice variants FL-C11 and FL-3/7 were cloned into the expression vector pcDNA3.1 (Invitrogen, Netherlands) and synthesised by in vitro transcription-translation in the presence of 35S-methionine using the TNTTM-coupled reticulocyte lysate (Promega, Mannheim, Germany). GST-fused cytoplasmic domain of the respective cadherin was expressed in and purified from E. coli strain BL21pLys.S. The in vitro GST binding assay was performed as described (Kaufmann et al., 2000).
Nucleotide sequence analysis
All clones were sequenced by SeqLab (Göttingen, Germany). DNA sequence analysis and homology searches were performed using HUSAR from DKFZ Heidelberg and the Blast-program-packet from NCBI, USA.
| RESULTS |
|---|
|
|
|---|
|
The longest open reading frame of mARVCF is encoded by the third new C-terminal isoform Y, which shows an in-frame insertion of 273 base pairs between exon 18 and 19 (Fig. 1B,C). Analysis of the extended peptide sequence has not revealed any homology to known protein domain motifs.
Finally, primer pairs were chosen to discover possible splice variants within the armadillo repeat region. Alternative splicing has been reported in this region for human p120(ctn), as well as human and xenopus ARVCF (Sirotkin et al., 1997; Keirsebilck et al., 1998; Paulson et al., 2000) resulting in an 18 base pair insertion in armadillo repeat six that converts the putative nuclear localisation motif present at this position into a shorter NLS. This alternative exon, or any other alternative exons within the armadillo repeat region, could not be detected within murine ARVCF using RT-PCR (data not shown).
Altogether, eight different mARVCF splice variants are possible by combining one out of four C-termini with either full length or the 5' alternative N-terminus. Fig. 1B schematically summarises the N- and C-terminal variants and Fig. 1C indicates the amino acid sequences derived from the different putative mARVCF isoforms.
Murine ARVCF mRNA expression
The next question was whether one splice variant is preferentially expressed in different cell lines or tissue types. In order to determine the relative quantity of the 5'- and the 3'- variants we performed RT-PCR with two pairs of oligonucleotide primers that either amplify both N-terminal variants or, alternatively, all four C-terminal variants simultaneously. Templates were cDNAs prepared from mRNA of differentiating i28 cells, CMT cells (derived from mouse colon carcinoma) and total mouse heart. As shown in Fig. 2A, the N-terminal full-length mARVCF mRNA is much more abundant than that encoding the 5'-alternative end missing the coiled-coil domain. However, at the 3'-end it is evident that the relative amounts of the four C-terminal isoforms are very similar in heart and CMT cells. Isoforms 3/5 and Y are expressed at low levels, whereas variants C11 and 3/7 are predominant. In i28 cells the mRNA of mARVCF splice variant Y is even less abundant, but can easily be amplified using exon Y specific primers (data not shown). Variant 3/5 mRNA is more abundant in this cell line than in CMT cells or heart tissue. Using this primer pair it was difficult to discriminate between isoform C11 and 3/7 because they differ in length by only 28 nucleotides. Therefore, one sense primer in exon 15 was used together with two antisense primers: one specific for the 3'-end of exon B and an other specific for the 5'-end of exon 19 generating bands that differ in length by 47 nucleotides. The exon 19-specific primer is also able to amplify isoform Y but this was not relevant owing to the very rare appearance of this variant (Fig. 2B). Fig. 2C shows that variant 3/7 is more abundant than variant C11 in i28 cells, heart tissue and CMT cells.
|
Cloning and expression of alternative splice variants
The eight possible splice variants of mARVCF were cloned as EGFP-fusion proteins and expressed in COS-7 cells. Protein extracts from the transfected cells were analysed by western blots using the monoclonal anti-GFP antibody (Fig. 3A). The results indicated that all eight constructs can be expressed and that the corresponding proteins appeared at the expected position in the blot. Furthermore, we expressed the most abundant splice variant full length 3/7 (FL-3/7) as a EGFP-fusion protein in each cell line used for further investigations. Western blot analysis of the protein extracts from the transfected cells lines indicates that EGFP-FL-3/7 protein is expressed at the correct size and in comparable amounts in all six cell lines (Fig. 3B).
|
i28 cells, the original source of the novel mARVCF splice variants, express M-cadherin, which localises to the cell membrane predominantly at cell-cell contacts (Fig. 4Ai). As described recently, mARVCF binds to the cytoplasmic domain of M-cadherin, which correlates with the fact that the ectopic fragment EGFP-ARVCF-C11 is localised at the membrane in i28 cells, although it is, to a certain extent, also found in the cytoplasm (Kaufmann et al., 2000). The membrane localisation is reproduced when the different mARVCF isoforms are expressed in i28 cells. The nuclei of the muscle cells were found to be free of the ectopically expressed mARVF isoforms whereas the sites of cell-cell contacts were clearly stained. Here the EGFP-fusion proteins colocalise with M-cadherin, as exemplified by the merged image (Fig. 4Am) with variant FL-3/7.
|
In contrast to MCF7 and RT112 cells, the human invasive bladder carcinoma cell line EJ28 does not express E-cadherin but is positive for N-cadherin (Fig. 4Di) (A. Zeitvogel, unpublished). When transfected into EJ28 cells none of the mARVCF isoforms appeared to colocalise with N-cadherin (Fig. 4D,Dm), although the adhesion molecule itself was found correctly at the plasma membrane (Fig. 4Di). All mARVCF isoforms were distributed equally in the EJ28 cells and no clear membrane-staining could be detected. However, after transfection of HeLa cells, which are also E-cadherin-negative but N-cadherin-positive (Fig. 4Ei), all of the EGFP-mARVCF isoforms clearly colocalised with N-cadherin at the sites of cell-cell contact (Fig. 4E,Em).
Finally, in monkey kidney COS-7 cells, which express endogenous cadherin(s) detectable with a pan-cadherin antibody (Fig. 4Fi), the mARVCF isoforms localised at cell-cell contacts (Fig. 4F). Thus, our results support the idea that the subcellular localisation of mARVCF splice variants depends not only on the presence or absence of an appropriate interaction partner, in this case the cadherins, but also on additional factors.
unequal interaction of mARVCF with E-, M- and N-cadherin
The results above merited closer investigation into the binding potential of E-, M- and N-cadherin for the eight mARVCF splice variants. The general ability of M-, E- and N-cadherin to interact with mARVCF was demonstrated by in vitro GST binding assays. mARVCF splice variants FL-C11 and FL-3/7 were cloned into the expression vector pcDNA3.1 and used as a template for in vitro transcription and translation in the presence of 35S-methionine. The cytoplasmic domains of M-, E- and N-cadherin were expressed as GST-fusion proteins in bacteria. The results revealed that in vitro translated mARVCF splice variants FL-C11 and FL-3/7 can bind directly to the cytoplasmic domain of all three cadherins (Fig. 5).
|
|
Mouse EGFP-ARVCF-C11 colocalises with N-cadherin in cardiomyocytes suggesting an association of these molecules (Kaufmann et al., 2000). In the experiments described here, the localisation of mARVCF isoforms was found to be distinct when EJ28 and HeLa cells were compared, although both cell types express N-cadherin but not E-cadherin (Fig. 4Di,Ei) (A. Zeitvogel, unpublished). Thus, it was of interest to similarly test the interaction of N-cadherins CPD with mARVCF isoforms in various cellular environments, including EJ28 cells. Co-transfection of the pMOM-N-cadherin and each EGFP-mARVCF isoform revealed that the interaction between each of the mARVCF splice variants and N-cadherin is possible, as exemplified by FL-3/7 in Fig. 7A-C. Also in EJ28 cells, such an interaction takes place between the transfected cytoplasmic N-cadherin domain and mARVCF. This finding suggests that there are no or few factors preventing this protein-protein interaction. But in contrast to the assays done with M- or E-cadherin, this interaction did not take place in every single cell, although both constructs were present and expressed (Fig. 7). Neighbouring cells, all of which expressed the MOM-N-cadherin construct and mARVCF, exhibited distinct interactions. For example, one cell showed interaction while the neighbour did not (Fig. 7). This inhomogeneous pattern of association between the cytoplasmic domain of N-cadherin and EGFP-mARVCF could be detected in every cell line examined with all the mARVCF isoforms. By counting 1.5x103 cotransfected MCF7 cells we could show that 36.7% of these cells were positive for FL-3/7-MOM-N-cadherin interaction, whereas 63.3% of these cells showed no interaction of EGFP-FL-3/7 with MOM-N-cadherin, although both constructs were present (Fig. 7D). The results of the subcellular localisation and the MOM recruitment assays are summarised in Table 2.
|
|
|
In addition, the percentage of cells interacting with the cytoplasmic domain of N-cadherin in the MOM-recruitment assay was not altered significally by co-transfecting EGFP-p120(ctn). In the absence of p120(ctn), 36.7% of co-transfected cells showed an interaction of mARVCF and MOM-N-cadherin (Fig. 7D). In cells co-transfected with MOM-N-cadherin, FL-3/7 and p120(ctn), 32.9% showed an interaction of mARVCF with MOM-N-cadherin, and 35.2% of them exhibited an interaction of p120(ctn) with the CPD of N-cadherin (Fig. 8Af). Thus an interaction between mARVCF and MOM-N-cadherin is not affected significantly by the co-transfection of p120(ctn).
| DISCUSSION |
|---|
|
|
|---|
In contrast to M- and -E-cadherin, N-cadherin exhibits an inhomogenous pattern of association with the mARVCF isoforms, although it is generally able to interact with them. Not every cell expressing the MOM-N-cadherin fusion protein and a mARVCF isoform permits the protein interaction. ARVCF belongs to the p120(ctn) subfamily of armadillo proteins and shows a high homology to the namegiving molecule. Both relatives can bind to the juxtamembrane region of cadherins (Kaufmann et al., 2000; Mariner et al., 2000) and are mutually exclusive for one another in E-cadherin complexes (Mariner et al., 2000). Our results clearly demonstrate that the inhomogeneous pattern of interaction of mARVCF and the CPD of N-cadherin observed in the MOM recruitment assay, is not due to a competition between mARVCF and p120(ctn) for N-cadherin binding. The two members of the p120(ctn) subfamily can interact with endogenous, membrane-located cadherins in the presence of overexpressed MOM-N-cadherin. Alternatively, both mARVCF and p120(ctn) can be recruited to MOM-N-cadherin constructs in the same cell. Taking into account the results of Mariner et al. (Mariner et al., 2000), it is obvious that these two members of the p120(ctn) subfamily do not bind simultaneously to the same MOM-N-cadherin molecule. The inhomogeneous pattern of interaction might be the result of heterogeneity in the cellular context (e.g. expression profile of regulatory proteins) leading to differential modifications of the interaction partners in individual cells.
It is also interesting to note that the mARVCF isoforms cannot colocalise with N-cadherin in EJ28 carcinoma cells but do so in HeLa cells. Both cell types express N-cadherin and not E-cadherin (A. Zeitvogel, unpublished; and this paper). Furthermore, it could be shown by Kaufmann et al. (Kaufmann et al., 2000) that EGFP-ARVCF-C11 colocalises with N-cadherin in rat ventricular cardiomyocytes. This indicates that a given cellular background may determine the capacity of mARVCF to interact with its partner, in this case N-cadherin. In line with this, a previous report described the regulation of p120(ctn) binding to the cytoplasmic domain of cadherins by phosphorylation, thereby modulating cadherin-mediated adhesion in either a positive or negative manner. This process appears to depend on the cell context (Yap et al., 1998; Aono et al., 1999; Anastasiadis and Reynolds, 2000).
The evidence for the inhomogenous association of mARVCF isoforms with N-cadherin might also be relevant in the context of results that imply that expression of N-cadherin is associated with metastasis and cell migration (Nieman et al., 1999; Hazan et al., 2000). In particular, over-expression of N-cadherin in MCF7 cells leads to abnormal invasive behaviour of these cells in cell culture (Hazan et al., 2000). In turn, expression of E-cadherin in invasive cells abolishes invasion (Frixen et al., 1991). Furthermore, N-cadherin has been reported to be a path-finding molecule for migrating dermomyotomal cells during chicken embryogenesis (Brand-Saberi et al., 1996). Considering the concept that cell invasion and migration is incompatible with strong adhesion (as provided by E-cadherin) but still requires guidance mediated by low affinity cadherins (such as N-cadherin) that allow movement, mARVCF might play a modulatory role in these processes.
Apparently, the binding of the identified mARVCF isoforms to cadherins is generally unaffected by the altered N- and C-termini of the mARVCF proteins arising by differential splicing. This is in line with results described by Kaufmann et al. showing that the armadillo repeat region of mARVCF is required and sufficient for cadherin binding (Kaufmann et al., 2000). Alternative splicing events have been reported for most of the p120(ctn) subfamily members (Paffenholz and Franke, 1997; Keirsebilck et al., 1998; Hatzfeld, 1999) suggesting that the isoforms may be important modulators of the function of these proteins. Modulation might, for example, occur due to the presence (as in full length mARVCF) or absence (such as in 5'-alt mARVCF) of the N-terminal coiled-coil domain, which may allow the recruitment of different partners into the junctional cadherin-catenin complexes. Similarly, the expression of a putative PDZ-binding domain in mARVCF is regulated through alternative splicing and only occurs in variant 3/7.
The PDZ domain has been generally shown to mediate protein-protein interactions (Fanning and Anderson, 1996; Fanning and Anderson, 1998). For example, it has been demonstrated that one PDZ domain of the junction protein PAPIN is responsible for the interaction of this molecule with the armadillo repeat proteins
-catenin or p0071 (Deguchi et al., 2000). Furthermore, ß-catenin can associate with LIN-7 via its PDZ domain at cell junctions (Perego et al., 2000). Postulating a similar function of the potential PDZ-binding domain in mARVCF, it might be that this domain can modulate the interaction of the cadherin-catenin complex by recruiting additional proteins to the complex.
With human p120(ctn) alternative splicing leads to at least 32 potential isoforms. In the N-terminal region four different variants have been described that use four different start methionines (isoforms one to four, of which variants two to four lack the coiled-coil region). These can be combined with three alternative exons A, B, and C, in the armadillo repeat region or the C-terminus (Keirsebilck et al., 1998). So far, however, only the differential expression of exon B could be assigned to a defined mechanism, namely the insertion of a functional NES (nuclear export signal) directing the molecule out of the nucleus (van Hengel et al., 1999). Thus, the major roles for the isoforms of both ARVCF and p120(ctn) remain to be elucidated.
In summary, our data imply that the function of mARVCF may be regulated by multiple mechanisms including alternative splicing, cellular context and the cadherins themselves.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Allport, J. R., Muller, W. A. and Luscinskas, F. W. (2000). Monocytes induce reversible focal changes in vascular endothelial cadherin complex during transendothelial migration under flow. J. Cell Biol. 148, 203-216.
Anastasiadis, P. Z. and Reynolds, A. B. (2000). The p120 catenin family: complex roles in adhesion, signaling and cancer. J. Cell Sci. 113, 1319-1334.[Abstract]
Aono, S., Nakagawa, S., Reynolds, A. B. and Takeichi, M. (1999). p120(ctn) acts as an inhibitory regulator of cadherin function in colon carcinoma cells. J. Cell Biol. 145, 551-562.
Aberle, H., Butz, S., Stappert, J., Weissig, H., Kemler, R. and Hoschuetzky, H. (1994). Assembly of the cadherin-catenin complex in vitro with recombinant proteins. J. Cell Sci. 107, 3655-3663.[Abstract]
Behrens, J., von Kries, J. P., Kühl, M., Bruhn, L., Wedlich, D., Grosschedl, R. and Birchmeier, W. (1996). Functional interaction of ß-catenin with the transcription factor LEF-1. Nature 382, 638-642.[Medline]
Bonne, S., van Hengel, J. and van Roy, F. (1998). Chromosomal mapping of human armadillo genes belonging to the p120(ctn)/plakoglobin subfamily. Genomics 51, 452-454.[Medline]
Brand-Saberi, B., Gamel, A. J., Krenn, V., Mueller, T. S., Wilting, J. and Christ, B. (1996). N-cadherin is involved in myoblast migration and muscle differentiation in the avian limb bud. Dev. Biol. 178, 160-173.[Medline]
Butz, S. and Kemler, R. (1994). Distinct cadherin-catenin complexes in Ca(2+)-dependent cell-cell adhesion. FEBS Lett. 355, 195-200.[Medline]
Chothia, C. and Jones, E. Y. (1997). The molecular structure of cell adhesion molecules. Annu. Rev. Biochem. 66, 823-862.[Medline]
Deguchi, M., Iizuka, T., Hata, Y., Nishimura, W., Hirao, K., Yao, I., Kawabe, H. and Takai, Y. (2000). PAPIN. A novel multiple PSD-95/Dig-A/ZO-1 protein inetracting with neural plakophilin-related armadillo repeat protein/delta-catenin and p0071. J. Biol. Chem. 275, 29875-29880.
Desmaze, C., Prieur, M., Amblard, F., Aikem, M., LeDeist, F., Demczuk, S., Zucman, J., Plougastel, B., Delattre, O., Croquette, M. F. et al. (1993). Phisical mapping by FISH of the DiGeorge critical region (DGCR): involvement of the region in familial cases. Am. J. Hum. Genet. 53, 1239-1249.[Medline]
Fanning, A. S. and Anderson, J. M. (1996). Protein-protein interactions: PDZ domain networks. Curr. Biol. 6, 1385-1388.[Medline]
Fanning, A. S. and Anderson, J. M. (1998). PDZ domains and the formation of protein networks at the plasma membrane. Curr. Top. Microbiol. Immunol. 228, 209-233.[Medline]
Finnemann, S., Mitrik, I., Hess, M., Otto, G. and Wedlich, D. (1997). Uncoupling of XB/U-cadherin-catenin complex formation from its function in cell cell adhesion. J. Biol. Chem. 272, 11856-11862.
Frixen, U. H., Behrens, J., Sachs, M., Eberle, G., Voss, B., Warda, A., Lochner, D. and Birchmeier, W. (1991). E-cadherin-mediated cell-cell adhesion prevents invasiveness of human carcinoma cells. J. Cell. Biol. 113, 173-185.
Gaetje, R., Kotzian, S., Herrmann, G., Baumann, R. and Starzinski-Powitz, A. (1997). Nonmalignant epithelial cells, potentially invasive in human endometriosis, lack the tumor suppressor molecule E-cadherin. Am. J. Pathol. 150, 461-467.[Abstract]
Geiger, B. and Ayalon, O. (1992). Cadherins. Annu. Rev. Cell Biol. 8, 307-332.
Hatzfeld, M. (1999). The armadillo family of structural proteins. Int. Rev. Cytol. 186, 179-224.[Medline]
Hazan, R. B., Phillips, G. R., Qiao, R. F., Norton, L. and Aaroson, S. A. (2000). Exogenous expression of N-cadherin in breast cancer cells induces cell migration, invasion, and metastasis. J. Cell Biol. 148, 779-790.
Hertig, C. M., Butz, S., Koch, S., Eppenberger-Ebehardt, M., Kemler, R. and Eppenberger, H. M. (1996). N-cadherin in adult rat cardiomyocytes in culture. J. Cell Sci. 109, 11-20.[Abstract]
Hinck, L., Näthke, I. S., Papkoff, J. and Nelson, W. J. (1994). Dynamics of cadherin-catenin complex formation: novel protein interactions and pathways of complex assembly. J. Cell Biol. 125, 1327-1340.
Hirano, S., Nose, A., Hatta, K., Kawakami, A. and Takeichi, M. (1987). Calcium-dependent cell-cell adhesion molecules (cadherins): subclass specifities and possible involvement of actin bundles. J. Cell Biol. 105, 2501-2510.
Hirano, S., Kimoto, N., Shimoyama, Y., Hirohashi, S. and Takeichi, M. (1992). Identification of a neural alpha-catenin as a key regulator of cadherin function and multicellular organization. Cell. 70, 293-301.[Medline]
Huber, O., Bierkamp, C. and Kemler, R. (1996). Cadherins and catenins in development. Curr. Opin. Cell Biol. 8, 685-691.[Medline]
Humphries, M. J. and Newham, P. (1998). The structure of cell adhesion molecules. Trends Cell Biol. 8, 78-83.[Medline]
Kaufmann, U., Martin, B., Link, D., Witt, K., Zeitler, R., Reinhard, S. and Starzinski-Powitz, A. (1999a). M-cadherin and its sisters in development of straited muscle. Cell. Tissue Res. 296, 191-198.[Medline]
Kaufmann, U., Kirsch, J., Irintchev, A., Wernig, A. and Starzinski-Powitz, A. (1999b). The M-cadherin catenin complex interacts with microtubules in skeletal muscle cells: implications for the fusion of myoblasts. J. Cell Sci. 112, 55-67.[Abstract]
Kaufmann, U., Zuppinger, C., Waibler, Z., Ruediger, M., Urbich, C., Martin, B., Jockusch, B., Eppenberger, H. and Starzinski-Powitz, A. (2000). The armadillo repeat region targets ARVCF to cadherin-based cellular junctions. J Cell Sci. 113, 4121-4135.[Abstract]
Keirsebilck, A., Bonne, S., Staes, K., van Hengel, J., Nollet, F., Reynolds, A. and van Roy, F. (1998). Molecular cloning of the human p120ctn catenin gene (CTNND1): Expression of multiple alternative spliced isoforms. Genomics 50, 129-146.[Medline]
Kelly, D., Goldberg, R., Wilson, D., Lindsay, E., Carey, A., Goodship, J., Burn, J., Cross, I., Shprintzen, R. J. and Scambler, P. J. (1993). Confirmation that the velo-cardio-facial syndrome is associated with haplo-insufficiency of genes at chomosome 22q11. Am. J. Med. Genet. 45, 308-312.[Medline]
Knudsen, K. A., Soler, A. P., Johnson, K. R. and Wheelock, M. J. (1995). Interaction of alpha-actinin with the cadherin/catenin cell-cell adhesion complex via alpha-catenin. J. Cell Biol. 130, 67-77.
Kuch, C., Winnekendonk, D., Butz, S., Unvericht, U., Kemler, R. and Starzinski-Powitz, A. (1997). M-cadherin-mediated cell adhesion and complex formation with the catenins in myogenic mouse cells. Exp. Cell Res. 232, 331-338.[Medline]
Mariner, D. J., Wang, J. and Reynolds, A. B. (2000). ARVCF localizes to the nucleus and adherens junction and is mutually exclusive with p120ctn in E-cadherin complexes. J. Cell Sci. 113, 1481-1490.[Abstract]
Molenaar, M., van de Wetering, M., Oosterwegel, M., Peterson-Maduro, J., Godsave, S., Korinek, V., Roose, J., Destrée, O. and Clevers, H. (1996). XTcf-3 transcription factor mediates ß-catenin - induced axis formation in Xenopus embryos. Cell 86, 391-399.[Medline]
Morrow, B., Goldberg, R., Carlson, C., DasGupta, R., Sirotkin, H., Collins, J., Dunham, I., ODonnell, H., Scambler, P., Shprintzen, R. and Kucherlapati, R. (1995). Molecular definition of the 22q11 deletions in velo-cardio-facial syndrome. Am. J. Hum. Genet. 56, 1391-1403.[Medline]
Näthke, I., Hinck, S., Swedlow, J. R., Papkoff, J. and Nelson, J. W. (1994). Defining interactions and distributions of cadherin and catenin complexes in polarised epithelial cells. J. Cell Biol. 125, 1341-1352.
Nieman, M. T., Prudoff, R. S., Johnson, K. R. and Wheelock, M. J. (1999). N-cadherin promotes motility in human breast cancer cells regardless of their E-cadherin expression. J. Cell Biol. 147, 631-644.
Ozawa, M., Baribault, H. and Kemler, R. (1989). The cytoplasmatic domain of the cell adhesion molecule uvomorulin associates with three independent proteins structurally related in different species. EMBO J. 8, 1711-1717.[Medline]
Paffenholz, R. and Franke, W. (1997). Identification and loclization of a neurally expressed member of the plakoglobin/armadillo multigene family. Differentiation 61, 293-304.[Medline]
Paulson, A. J., Mooney, E., Fang, X., Ji, H. and McCrea, P. D. (2000). XARVCF, xenopus member of the p120 catenin subfamily associates with cadherin juxtamembrane region. J. Biol. Chem. 275, 30124-31031.
Perego, C., Vanoni, C., Massari, S., Longhi, R. and Pietrini, G. (2000). Mammalian LIN-7 PDZ proteins associate with beta-catenin at the cell-cell junctions of epithelia and neurons. EMBO 19, 3978-3989.[Medline]
Reynolds, A. B., Daniel, J., McCrea, P. D., Wheelock, M. J., Wu, J. and Zhang, Z. (1994). Identification of a new catenin: the tyrosine kinase substrate p120cas associates with E-cadherin complexes. Mol. Cell. Biol. 14, 8333-8342.
Riggleman, B., Wieschaus, E. and Schedl, P. (1989). Molecular analysis of the armadillo locus: uniformly distributed transcripts and a protein with novel internal repeats are associated with a Drosophila segment polarity gene. Genes Dev. 3, 96-113.
Ringwald, M., Schuh, R., Vestweber, D., Eistetter, H., Lottspeich, F., Engel, J., Dölz, R., Jähnig, F., Epplen, J., Mayer, S., Müller, C. and Kemler, R. (1987). The structure of the cell adhesion molecule uvomorulin. Insights into the molecular mechanism of Ca2+ dependent cell adhesion. EMBO J. 6, 3647-3653.[Medline]
Rose, O., Rohwedel, J., Reinhardt, S., Bachmann, S., Cramer, M., Rotter, M., Wobus, M. and Starzinski-Powitz, A. (1994). Expression of M-cadherin protein in myogenic cells during prenatal mouse development and differentiation of embryonic stem cells in culture. Dev. Dyn. 201, 245-259.[Medline]
Rüdiger, M., Jockusch, B. M. and Rothkegel, M. (1997). A novel epitope-antibody combination for the detection of protein expression in prokaryotic and eukaryotic cells. Biotechniques 23, 96-97.[Medline]
Shapiro, L., Fannon, A. M., Kwong, P. D., Thompson, A., Lehmann, M. S., Grübel, G., Legrand, I., Als-Nielsen, J., Colman, D. R. and Hendrickson, W. A. (1995). Structural basis of cell-cell adhesion by cadherins. Nature 374, 327-336.[Medline]
Sirotkin, H., ODonnell, H., DasGupta, R., Halford, S., St Jore, B., Puech, A., Parimoo, S., Morrow, B., Skoultchi, A., Weissman, S. M. et al. (1997). Identification of a new human catenin gene family member (ARVCF) from the region deleted in velo-cardio-facial syndrome. Genomics 41, 75-83.[Medline]
Takeichi, M. (1991). Cadherin cell adhesion receptors as a morphogenic regulator. Science 251, 1451-1455.
Tsukita, S., Tsukita, S., Nagafuchi, A. and Yonemura, S. (1992). Molecular linkage between cadherins and actin filaments in cell-cell adhesion junctions. Curr. Opin. Cell Biol. 4, 834-839.[Medline]
van de Wetering, M., Cavallo, R., Dooijes, D., van Beest, M., van Es, J., Loureiro, J., Ypma, A., Hursh, D., Jones, T., Bejsovec, A. et al. (1997). Armadillo coactivates transcription driven by the product of the Drosophila segment polarity gene dTCF. Cell 88, 789-799.[Medline]
van Hengel, J., Vanhoenacker, P., Staes, K. and van Roy, F. (1999). Nuclear localisation of the p120 ctn Armadillo-like catenin is counteracted by a nuclear export signal and by E-cadherin expression. Proc. Natl. Acad. Sci USA 96, 7980-7985.
Wieschaus, E. and Riggleman, R. (1987). Autonomous requirements for the segment polarity gene armadillo during Drosophila embryogenesis. Cell 49, 177-184.[Medline]
Yap, A. S., Niessen, C. M. and Gumbiner, B. M. (1998). The juxtamembrane region of cadherin cytoplasmic tail supports lateral clustering, adhesive strengthening, and interaction with p120(ctn). J. Cell Biol. 4, 779-789.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
D. D. Mruk, B. Silvestrini, and C. Y. Cheng Anchoring Junctions As Drug Targets: Role in Contraceptive Development Pharmacol. Rev., June 1, 2008; 60(2): 146 - 180. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Kausalya, D. C.Y. Phua, and W. Hunziker Association of ARVCF with Zonula Occludens (ZO)-1 and ZO-2: Binding to PDZ-Domain Proteins and Cell-Cell Adhesion Regulate Plasma Membrane and Nuclear Localization of ARVCF Mol. Biol. Cell, December 1, 2004; 15(12): 5503 - 5515. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Davis, R. C. Ireton, and A. B. Reynolds A core function for p120-catenin in cadherin turnover J. Cell Biol., November 10, 2003; 163(3): 525 - 534. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hatzfeld, K. J. Green, and H. Sauter Targeting of p0071 to desmosomes and adherens junctions is mediated by different protein domains J. Cell Sci., April 1, 2003; 116(7): 1219 - 1233. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||