|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
RESEARCH ARTICLE |
INMED/INSERM U29, 163 rue de Luminy, BP 13, 13273 Marseille Cedex 09, France
*Author for correspondence (e-mail: ferhat{at}inmed.univ-mrs)
Accepted July 26, 2001
| SUMMARY |
|---|
|
|
|---|
Key words: Microtubule, Microfilament, Motor proteins, Acidic calponin, Dynamitin
| INTRODUCTION |
|---|
|
|
|---|
From these observations, we postulate that process formation results from the imbalance between tensile and compressive forces mediated by myosins and dyneins, respectively. To test this hypothesis, we transfected non-neuronal cells that do not develop processes in control conditions with acidic calponin (ac.CaP), an actin-binding protein known to inhibit the actomyosin activity (Gimona and Small, 1996; Winder and Walsh, 1996; Winder et al., 1998) and/or dynamitin, which when present at abnormally high levels results in an immediate cessation of dynein activity (Echeverri et al., 1996; Wittmann and Hyman, 1999). We report that the overexpression of ac.CaP induces the formation of cell processes and that this effect is blocked by the overexpression of dynamitin. Our results provide evidence that the formation of processes, previously shown to be induced by a depolymerisation of microfilaments (Letourneau et al., 1987; Edson et al., 1993; Ferhat et al., 1996b; Ferhat et al., 1998; Meberg and Bamburg, 2000), is also produced by an inhibition of myosin-mediated forces. Our observations strongly support the idea that the formation of processes is a result of antagonistic forces. In addition, consistent with recent observations on primary neurons (Ahmad et al., 2000), our results indicate that these antagonistic forces are generated by motor proteins: tensile forces generated by myosins and compressive forces generated by dyneins. We conclude that the imbalance between myosin and dynein-mediated forces determines whether a neurite forms and elongates or whether it retracts.
| MATERIALS AND METHODS |
|---|
|
|
|---|
PCR, analysis of amplified PCR products and cloning
cDNAs encoding the full length of ac.CaP and dynamitin were amplified by PCR from P0 and adult rat hippocampal RNA, respectively, using the ThermoScript RT-PCR System, with forward primers containing an EcoRI and reverse primers containing a BamHI restriction sites. Ac.CaP primers were EcoRI calp: tatatagaattc CAGCCATGACCCACTTAACAAGGGCCCT and BamHI calp: atatatggatcccc GTAATCGATGCCCTGGTCGTCAC. Dynamitin primers were EcoRI dyn: tatatagaattccagaa ATGGCGGACCC-TAAATACG and BamHI dyn: atatatggatcccc CTTTCCCAGC-TTCTTCATCCGTTC. All the primers were selected in the rat cDNA sequences (Ferhat et al., 1996a; Echeverri et al., 1996).
PCR reactions were carried out in a programmable heating block (GeneAmp PCR System 9700). Following the gel analysis, the PCR products were purified using Qiagen spin columns. Finally, a PCR fragment encoding the full length ac.CaP protein was inserted into the mammalian expression vectors pDsRed1-N1 and pEGFP-N1 (Clontech) and the ones encoding the full length dynamitin and ac.CaP
proteins were inserted into pEGFP-N1. The vectors pDsRed1-N1 and pEGFP-N1 encode for Red Fluorescent Protein (RFP) and Green Fluorescent Protein (GFP), respectively. The obtained constructs were subsequently fully sequenced in order to verify the integrity of the fusion protein (ac.CaP-RFP/-GFP, dynamitin-GFP and ac.CaP
-GFP).
Cell line and transfection
Human embryonic kidney (HEK 293) cells from the American Type Tissue Culture Collection (ATCC) were grown in MEM (minimum essential medium, Gibco BRL), supplemented with 10% fetal bovine serum (FBS, Gibco BRL), 2 mM glutamine (Gibco BRL), 100 IU/ml penicillin and 100 mg/ml streptomycin (Sigma). Transfections were performed using Lipofectamine Plus according to the manufacturers protocol (Gibco BRL). Twenty-four hours after transfection, cells were fixed with 4% paraformaldehyde in phosphate buffered saline (PBS, pH 7.2) for 20 minutes at room temperature (RT).
Quantitative analyses of the number of transfected cells were performed using a fluorescence microscope with a 20x objective. Twenty fields per coverslip per experiment (n=7) were analysed. Data were expressed as the mean percentage of total cells per experiment±s.e.m.
Immunofluorescence
Fixed cells were permeabilized with 0.5% Triton X-100 for 10 minutes and incubated overnight at 4°C with mouse monoclonal antibody directed against ß-tubulin (1/100, Sigma). Tubulin staining was revealed with the fluorescein (FITC)-conjugated goat anti-mouse (1/200, Jackson Immunoresearch). Before the actin staining, the cells were permeabilized with 0.1% Triton X-100 for 5 minutes and exposed for 2 hours at RT to 0.5 unit per coverslip of Texas Red-X phalloidin (Molecular Probes). Cells were then mounted with Fluoromount G (Southern Biotechnology Associates) and analysed using Zeiss LSM-410 laser scanning microscope.
| RESULTS |
|---|
|
|
|---|
-GFP displayed a diffuse staining pattern in the cytoplasm as well as in the nucleus. In contrast to ac.CaP-GFP, ac.CaP
-GFP, which do not have the actin-binding domains, did not exhibit any morphological changes (Fig. 1D). This observation reinforces the idea that ac.CaP acts through the inhibition of the actomyosin system to induce processes in non neuronal cells.
|
|
In control cells, Texas Red-X phalloidin detected the presence of actin stress fibres that cross over the cytoplasm and bundles of actin filaments beneath the plasma membrane (Fig. 2A). In all transfected cells (Fig. 2B-D), ac.CaP-GFP (Fig. 2C) was mainly co-distributed with microfilaments (Fig. 2B,D, yellow) suggesting that the majority of ac.CaP-GFP effectively bound microfilaments. Furthermore, our results show that in the transfected cells there was a striking microfilament reorganisation (Fig. 2B,D): twisted bundles of microfilaments were observed in the cell body. A few actin bundles that originate from this central core projected within the extensions. In addition, these cells had lost both actin stress fibres and cortical actin bundles.
Acidic calponin induces a reorganisation of microtubule arrays
Using ß-tubulin antibodies, we investigated the effects of ac.CaP-RFP on microtubule organisation (Fig. 3). In control cells (Fig. 3A-C), microtubules emerging from a centrosomal organising centre next to the nucleus radiated through the cytoplasm as individual filaments (Fig. 3B) until they were stopped by the presence of cortical actin filaments (Fig. 3A,C). By contrast, ac.CaP-RFP-transfected cells (Fig. 3D) displayed a clear-cut reorganisation of microtubules (Fig. 3E). Thick bundles of microtubules were observed within the cell bodies and extensions. In all transfected cells, the ac.CaP-RFP (in red) was not co-localised with microtubules (in green) but rather was adjacent (Fig. 3F). In addition, the ac.CaP /microfilaments bundles were detached from the cell cortex and localised in the core of the cytoplasm so that microtubules distributed at the cell periphery (Fig. 3F). We also noticed that in many cases, ac.CaP filaments/microfilaments (Fig. 3G,I, red) and microtubules (Fig. 3H,I, green) clearly form curves within the processes (see arrows). This wavy pattern of microfilaments and microtubules might be a consequence of the forces generated by motor proteins and bore by these two cytoskeletal elements.
|
|
| DISCUSSION |
|---|
|
|
|---|
Previous data have demonstrated that the formation of neurites and their elongation are induced by the depolymerisation of microfilaments using destabilising agents such as cytochalasins (Marsh and Letourneau, 1984; Bentley and Toroian-Raymond, 1986; Letourneau et al., 1987; Ferhat et al., 1996b; Ferhat et al., 1998). Consistent with these observations, it has more recently been reported that the depletion of microfilaments by the overexpression of endogenous factors such as actin depolymerising factor (ADF) also promotes neurite elongation (Meberg and Bamburg, 2000). By contrast, our results suggest that process formation induced by ac.CaP did not require a depolymerisation mechanism. Several lines of evidence reinforce this idea. First, cytochalasin treatment of control HEK 293 cells does not induce process formation (Ferhat et al., 1996b). Second, the main in vitro effect of calponin family is to inhibit the actomyosin activity (Gimona and Small, 1996; Winder and Walsh, 1996; Winder et al., 1998). Third, biochemical studies have shown that calponins also stimulate actin polymerisation, and bundling and stabilisation of F-actin filaments (Kake et al., 1995; Kolakowski et al., 1995). In agreement with these in vitro effects our present data show that ac.CaP-transfected cells display a more bundled organisation of actin filaments compared with control cells. Thus we suggest that the formation of processes induced by ac.CaP is due to the inhibition of actomyosin-mediated forces rather than to the depletion of the microfilaments array. Based on all these observations we propose that, to generate processes, cells can use two independent mechanisms in parallel: disassembly of microfilaments and inhibition of actomyosin activity.
In non-neuronal cells, the microtubules radiate through the cytoplasm as individual filaments until they are stopped by a dense network of actin filaments of the cell cortex. This cortical cytoskeleton has been suggested to act as a tensile envelope maintaining the shape of the cell (Bray and White, 1988; Janmey, 1991). In addition, physical studies indicated that actin filaments are more resistant to deformation than microtubules (Janmey et al., 1991). By contrast, when ac.CaP is overexpressed in HEK 293 cells, the organisation of these cytoskeleton components is strikingly altered. Indeed, in these cells, microtubules were localised at the cell periphery while microfilaments were detached from the cell cortex and accumulated within the cytoplasm. Therefore, the microfilament reorganisation observed in ac.CaP cells facilitates the microtubule bundles to pull out processes. One possible explanation of the microfilament reorganisation relates to the inability of myosins to generate forces required for the transport of microfilaments into the periphery. Indeed, it is now well established that motor proteins, known to convert the chemical energy released by nucleotide hydrolysis directly into movement, are capable not only of transporting organelles along microtubules or microfilaments but also of transporting and organising the cytoskeleton components themselves. Specifically, it has been shown that myosins are involved in the organisation and transport of microfilaments (Evans et al., 1998; Wu et al., 2000). Thus, the processes induced by ac.CaP may be mediated by the attenuation of myosin forces generated on microfilament arrays.
Our data show that the overexpression of ac.CaP is associated with the formation of processes containing microtubules. These processes cannot be the result of the assembly properties of microtubules since their formation depends on the dynein activity. It has been suggested that dynein drives microtubules down to the axon by generating forces upon the microfilament array (Ahmad et al., 1998; Baas, 1999; Baas and Ahmad, 2001). Thus we propose that the processes induced by the ac.CaP are mediated by the organisation and the transport of microtubules by dynein-mediated forces. This strongly supports the idea that the formation of processes is a result of antagonistic forces (Letourneau et al., 1987; Bray et al., 1986; Dennerll et al., 1989; Zheng et al., 1991; Edson et al., 1993) that are generated by motor proteins (Ahmad et al., 2000; Baas and Ahmad, 2001): tensile forces generated by myosins and compressive forces generated by dyneins. We propose that it is the imbalance between these forces that determines whether a process forms and elongates or whether it retracts. According to this model, a decrease in the tensile forces generated by myosins leads dyneins to induce process formation and elongatation. By contrast, an attenuation of the compressive forces generated by dyneins leads myosins to cause the process to retract.
Our observations in non-neuronal cells probably reflect the mechanisms that can be used by neurons during their development. Interestingly, we have shown that ac.CaP is a variant particularly enriched in neurons during early development (Ferhat et al., 1996b), where it co-localises with microfilaments in cell bodies and growth cones (Plantier et al., 1999). Preliminary data show that overexpression of acidic calponin in cultured hippocampal neurons induces a dramatic increase of neuritic branches (L. Ferhat et al., unpublished). These results suggest that during neuronal development, neurons generate their neurites using ac.CaP as an endogenous regulator that may modulate the actomyosin system. Ahmad et al. showed that inhibition of the motor activity of dynein induces the axon to retract and that this effect depends on myosin-mediated forces (Ahmad et al., 2000). Our observations indicate that the same motor-mediated forces are also involved in the formation, and probably in the elongation of neurites. Thus, the model of motor-generated forces proposed for non-neuronal cells may be extended to neurons.
In conclusion, we propose that the motor-mediated forces are one of the mechanisms by which microfilaments and microtubules are integrated in order to modulate the cell morphology.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Ahmad, F. J., Echeverri, C. J., Vallee, R. B. and Baas, P. W. (1998). Cytoplasmic dynein and dynactin are required for the transport of microtubules into the axon. J. Cell Biol. 140, 391-401.
Ahmad, F. J., Hughey, J., Wittmann, T., Hyman, A., Greaser, M. and Baas, P. W. (2000). Motor proteins regulate force interactions between microtubules and microfilaments in the axon. Nat. Cell Biol. 2, 276-280.[Medline]
Applegate, D., Feng, W., Green, R. S. and Taubman, M. B. (1994). Cloning and expression of a novel acidic calponin isoform from rat aortic vascular smooth muscle. J. Biol. Chem. 269, 10683-10690.
Baas, P. W. (1999). Microtubules and neuronal polarity: lessons from mitosis. Neuron 22, 23-31.[Medline]
Baas, P. W. and Ahmad F. J. (2001). Force generation by cytoskeletal motor proteins as a regulator of axonal elongation and retraction. Trends Cell Biol. 11, 244-249.[Medline]
Bentley, D. and Toroian-Raymond, A. (1986). Disoriented pathfinding by pioneer neuron growth cones deprived of filopodia by cytochalasin treatment. Nature 323, 712-715.[Medline]
Bray, D., Heath, J. and Moss, D. (1986). The membrane-associated cortex of animal cells: its structure and mechanical properties. J. Cell Sci. Suppl. 4, 71-88.[Medline]
Bray, D. and White, J. G. (1988). Cortical flow in animal cells. Science 239, 883-888.
Burkhardt, J. K., Echeverri, C. J., Nilsson, T. and Vallee, R. B. (1997). Overexpression of the dynamitin (p50) subunit of the dynactin complex disrupts dynein-dependent maintenance of membrane organelle distribution. J. Cell Biol. 139, 469-484.
Busson, S., Dujardin, D., Moreau, A., Dompierre, J. and De Mey, J. R. (1998). Dynein and dynactin are localized to astral microtubules and at cortical sites in mitotic epithelial cells. Curr. Biol. 8, 541-544.[Medline]
Carminati, J. L. and Stearns, T. (1997). Microtubules orient the mitotic spindle in yeast through dynein-dependent interactions with the cell cortex. J. Cell Biol. 138, 629-641.
Chomczynski, P. and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156-159.[Medline]
Dennerll, T. J., Lamoureux, P., Buxbaum, R. E. and Heidemann, S. R. (1989). The cytomechanics of axonal elongation and retraction. J. Cell Biol. 109, 3073-3083.
Echeverri, C. J., Paschal, B. M., Vaughan, K. T. and Vallee, R. B. (1996). Molecular characterization of the 50-kD subunit of dynactin reveals function for the complex in chromosome alignment and spindle organization during mitosis. Cell Biol. 132, 617-633.
Edson, K., Weisshaar, B. and Matus, A. (1993). Actin depolymerisation induces process formation on MAP2-transfected non-neuronal cells. Development. 117, 689-700.[Abstract]
Evans, L. L., Lee, A. J., Bridgman, P. C. and Mooseker, M. S. (1998). Vesicle-associated brain myosin-V can be activated to catalyze actin-based transport. J. Cell Sci. 111, 2055-2066.[Abstract]
Ferhat, L., Charton, G., Represa, A., Ben-Ari, Y., der Terrossian, E. and Khrestchatisky, M. (1996a). Acidic calponin cloned from neural cells is differentially expressed during rat brain development. Eur. J. Neurosci. 8, 1501-1509.[Medline]
Ferhat, L., Cook, C., Kuriyama, R. and Baas, P. W. (1998). The nuclear/mitotic apparatus protein NuMA is a component of the somatodendritic microtubule arrays of the neuron. J. Neurocytol. 27, 887-899.[Medline]
Ferhat, L., Represa, A., Bernard, A., Ben-Ari, Y. and Khrestchatisky, M. (1996b). MAP2d promotes bundling and stabilization of both microtubules and microfilaments. J. Cell Sci. 109, 1095-1103.[Abstract]
Gimona, M. and Small, J. V. (1996). Calponin. In Biochemistry of Smooth Muscle Contraction (ed. M. Barany), pp. 91-103. San Diego, CA: Academic Press.
Gonczy, P., Pichler, S., Kirkham, M. and Hyman, A. A. (1999). Cytoplasmic dynein is required for distinct aspects of MTOC positioning, including centrosome separation, in the one cell stage Caenorhabditis elegans embryo. J. Cell Biol. 147, 135-150.
Inoue, S., Yoder, O. C., Turgeon, B. G. and Aist, J. R. (1998). A cytoplasmic dynein required for mitotic aster formation in vivo. J. Cell Sci. 111, 2607-2614.[Abstract]
Janmey, P. A. (1991). Mechanical properties of cytoskeletal polymers. Curr. Opin. Cell Biol. 3, 4-11.[Medline]
Janmey, P. A., Euteneuer, U., Traub, P. and Schliwa, M. (1991). Viscoelastic properties of vimentin compared with other filamentous biopolymer networks. J. Cell Biol. 113, 155-160.
Kake, T., Kimura, S., Takahashi, K. and Maruyama, K. (1995). Calponin induces actin polymerization at low ionic strength and inhibits depolymerization of actin filaments. Biochem. J. 312, 587-592.
Kolakowski, J., Makuch, R., Stepkowski, D. and Dabrowska, R. (1995). Interaction of calponin with actin and its functional implications. Biochem. J. 306, 199-204.
Koonce, M. P., Kohler, J., Neujahr, R., Schwartz, J. M., Tikhonenko, I. and Gerisch, G. (1999). Dynein motor regulation stabilizes interphase microtubule arrays and determines centrosome position. EMBO J. 18, 6786-6792.[Medline]
Letourneau, P. C., Shattuck, T. A. and Ressler, A. H. (1987). Pull and push in neurite elongation: observations on the effects of different concentrations of cytochalasin B and taxol. Cell Motil. Cytoskeleton 8, 193-209.[Medline]
Ma, S., Trivinos-Lagos, L., Graf, R. and Chisholm, R. L. (1999). Dynein intermediate chain mediated dynein-dynactin interaction is required for interphase microtubule organization and centrosome replication and separation in Dictyostelium. J. Cell Biol. 147, 1261-1274.
Marsh, L. and Letourneau, P. C. (1984). Growth of neurites without filopodial or lamellipodial activity in the presence of cytochalasin B. J. Cell Biol. 99, 2041-2047.
Meberg, P. J. and Bamburg, J. R. (2000). Increase in neurite outgrowth mediated by overexpression of actin depolymerizing factor. J. Neurosci. 20, 2459-2469.
Plantier, M., Fattoum, A., Menn, B., Ben-Ari, Y., Der Terrossian, E. and Represa, A. (1999). Acidic calponin immunoreactivity in postnatal rat brain and cultures: subcellular localization in growth cones, under the plasma membrane and along actin and glial filaments. Eur. J. Neurosci. 11, 2801-2812.[Medline]
Winder, S. J., Allen, B. G., Clement-Chomienne, O. and Walsh M. P. (1998). Regulation of smooth muscle actin-myosin interaction and force by calponin. Acta Physiol. Scand. 164, 415-426.[Medline]
Winder, S. J. and Walsh, M. P. (1996). Calponin. Curr. Top. Cell Regul. 34, 33-61.[Medline]
Wittmann, T. and Hyman, T. (1999). Recombinant p50/dynamitin as a tool to examine the role of dynactin in intracellular processes. Methods Cell Biol. 61, 37-43.
Wu, X., Jung, G. and Hammer, J. A. (2000). Functions of unconventional myosins. Curr. Opin. Cell Biol. 12, 42-51.[Medline]
Zheng, J., Lamoureux, P., Santiago, V., Dennerll, T., Buxbaum, R. E. and Heidemann, S. R. (1991). Tensile regulation of axonal elongation and initiation. J. Neurosci. 11, 1117-1125.[Abstract]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
M. M. Hossain, J. F. Crish, R. L. Eckert, J. J.-C. Lin, and J.-P. Jin h2-calponin Is Regulated by Mechanical Tension and Modifies the Function of Actin Cytoskeleton J. Biol. Chem., December 23, 2005; 280(51): 42442 - 42453. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Burgstaller, W. J. Kranewitter, and M. Gimona The molecular basis for the autoregulation of calponin by isoform-specific C-terminal tail sequences J. Cell Sci., May 15, 2002; 115(10): 2021 - 2029. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||