|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
RESEARCH ARTICLE |
International Centre for Genetic Engineering and Biotechnology, Padriciano 99, I-34012 Trieste, Italy
*Author for correspondence (e-mail: banks{at}icgeb.trieste.it)
Accepted August 16, 2001
| SUMMARY |
|---|
|
|
|---|
Key words: Dlg, Proteasome, Transformation, HPV
| INTRODUCTION |
|---|
|
|
|---|
In line with its role as a potential tumour suppressor, hDlg has also been shown to interact, through its PDZ domains, with several viral oncoproteins, including Adenovirus 9 E4ORF1 protein, HTLV-1 Tax and the high risk HPV E6 proteins. These interactions interfere with hDlg binding to APC and can perturb cell growth control (Kiyono et al., 1997; Lee et al., 1997; Suzuki et al., 1999). Significantly, only E6 proteins that are derived from oncogenic HPV types can interact with hDlg, and E6 mutants that can no longer bind hDlg also lose their transforming activity (Kiyono et al., 1997). Moreover, HPV E6 can target hDlg for ubiquitin-mediated degradation (Gardiol et al., 1999; Pim et al., 2000; Kühne et al., 2000), probably by enhancing a normally occurring process, as hDlg appears to be ubiquitinated in cells even in the absence of E6 (Gardiol et al., 1999). Interestingly, hScrib, the human homologue of Drosophila Scrib, has also recently been shown to be a target for high risk HPV E6-induced degradation (Nakagawa and Huibregtse, 2000). This suggests that the combined targeting of these two cooperating PDZ proteins is essential for viral interference with epithelial cell differentiation. However, there are also important implications for the development of cervical cancer, as misregulation of hDlg and hScrib functions, either by HPV E6 or by cellular mutations, would be expected to affect cell adhesion, polarity and proliferation, thus contributing to the invasiveness of the transformed cells.
Although it is now well established that hDlg is subjected to ubiquitin-mediated degradation by high risk HPV E6, little is known about the regulation of endogenous hDlg protein in normal and transformed epithelial cells. Therefore, in this study we have investigated the role of the proteasome in hDlg regulation in a variety of epithelial cell lines. We show that hDlg is degraded by the proteasome in both the presence and absence of HPV, with the most unstable forms of the protein being hyperphosphorylated. In addition, hDlg becomes intrinsically stabilised upon increased cell contact, but this activity is lost in highly transformed cells. These results demonstrate that hDlg is normally regulated by a complex pattern of events, including phosphorylation and ubiquitination, which in turn are determined by the degree of cell-cell contact, and that loss of this regulation correlates with malignant progression.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Cell culture and proteasome inhibition
HPV-16-positive CaSKi, HPV-18-positive HeLa and HPV-negative C33I human cervical carcinoma cell lines, plus the immortalised human skin keratinocytes HaCaT, were all maintained in DMEM (Dulbeccos Modified Eagles Medium) supplemented with 10% fetal calf serum at 37°C and 10% CO2. Primary baby rat kidney (BRK) cells were obtained from nine-day-old Wistar rats, and the subsequent transformation with HPV-16 E7 plus EJ-ras has been described previously (Massimi et al., 1997). BRK cells were grown under the same conditions as the epithelial tumour-derived cell lines. For proteasome inhibition, growing cells were treated with either N-CBZ-Leu-Leu-Leu-al (Sigma) or N-acetyl-Leu-eu-norleucinal (Sigma) at a final concentration of 50 µM or with 25 µM lactacystin (Calbiochem) for the time indicated, before harvesting for subsequent analysis.
Western blotting
Cells were extracted in a solution of 50 mM Hepes pH 7.0, 250 mM NaCl, 0.1% NP40 and 1% aprotinin. Protein concentrations were determined using the Bio-rad Protein Assay System, and equal amounts (100 µg) were separated on 7.5% PAGE and transferred to nitrocellulose membrane. Endogenous hDlg protein was detected by an anti-Dlg polyclonal antibody and developed with the Amersham ECL System according to the manufacturers instructions.
Phosphatase assays
Cell lysates were prepared as described above, and 50 µg of protein extract were incubated at 30°C for 30 minutes either with or without 2000 units of
protein phosphatase (New England Biolabs).
RNA extraction, RT-PCR and Southern blot analysis
Total cellular RNA was isolated from cultured cells with RNAzolB according to the manufacturers instructions, then DNAse treated and quantified. 5 µg of total RNA were reverse transcribed for 1 hour at 39°C using 200 U of Moloney murine Leukaemia virus reverse transcriptase (Gibco BRL) and either a hDlg-specific antisense primer (5'GTAGAGCTTGGAAGGCTGGAA3') or a TBP (TATA box binding protein)-specific antisense primer (5'GGTACATGAATTCCATTACGTCGT3'). 13 cycles of amplification were then performed using either hDlg primers: 5'ATGCCGGTCCGGAAGCAAGAT3' and 5'GTAGAGCTTGGAAGGCTGGAA3', or, previously described TBP primers (Massimi et al., 1997): 5'GCTGCGGGATCCATGAGGATAAGA3' and 5'GGTACATGAATTCCATTACGTCGT3'. Amplification conditions were: 1 minute at 95°C, 1 minute at 56°C and 1 minute at 72°C. hDlg (371 bp) and TBP (426 bp) amplificates were then separated on 1% agarose gels and transferred to Hybond-N+ membranes (Amersham). Blots were hybridised with [
-32P]ATP labelled internal oligonucleotides: hDlg probe 5'CAGACGGCTTTGAACGATGTA3' and TBP probe 5'TGGCTCAGAATTCCTAAATTGTT3'. Quantitation of mRNA expression was done by scanning the Southern blots using a Packard Instant PhosphoImager.
Immunofluorescence assays and confocal microscopy
Cells were washed in PBS, fixed in 3% paraformaldehyde in PBS, incubated for 5 minutes in 0.1% Triton-PBS, stained with
-hDlg monoclonal antibody (2D11 Santa Cruz Biotech., 5 µg/ml) and detected with a FITC-conjugated secondary antibody (Molecular Probes). Images were analysed by confocal laser scanning microscopy with a Zeiss Axiovert 100M microscope attached to a LSM 510 confocal unit.
Anchorage-independence assays
Substrate-independent cell growth was assayed in soft agar. 1x105 cells were suspended in growth medium containing 0.5% (w/v) noble agar in 60 mm diameter Petri dishes. Colonies were counted after 10 days.
| RESULTS |
|---|
|
|
|---|
|
|
We were intrigued as to the meaning of these differences in the regulation of hDlg between different cell lines, and analysis of the cellular morphology appears to provide an indication. As can be seen from Fig. 3, those cells that have higher levels of hDlg, which increase consistently following proteasome inhibition, such as CaSKi and HaCaT cells, retain relatively differentiated phenotypes and grow in structured, epithelial-like sheets, held together by tight contacts between cells. In contrast, cell lines that contain little hDlg and are less responsive to proteasome inhibition, such as HeLa and C33I cells, show the most undifferentiated phenotypes: these are round cells with disorderly growth that form loose cell-cell contacts. This is reminiscent of the phenotypes described for Dlg and Scrib mutations in Drosophila epithelia (Bilder and Perrimon, 2000), where loss of Dlg function causes both disorganisation of tissue architecture and uncontrolled cell proliferation crucial steps in the acquisition of an invasive phenotype. To determine if there is a correlation between the degree of invasiveness and the very low levels of hDlg in these epithelial cell lines, we tested their ability to grow in soft agar and the results are shown in Table 1. Interestingly, when cultured in DMEM with 0.5% noble agar, only HeLa and C33I cells were able to form colonies, whereas CaSKi and HaCaT, which retain remarkably higher hDlg levels, were unable to proliferate.
|
|
|
|
|
phosphatase. As shown in the western blot of Fig. 7, in both cell lines the phosphatase treatment dramatically changes the mobility of the higher molecular weight forms of hDlg, demonstrating that they were indeed phosphorylated. These results indicate that hDlg becomes hyper-phosphorylated as a result of increased cell-cell contact and that these phosphorylated forms of hDlg are also more readily degraded by the proteasome under conditions of low cell density.
|
| DISCUSSION |
|---|
|
|
|---|
In this paper, we show that hDlg is degraded by the proteasome in cell lines derived from cervical tumours containing high-risk HPV. Interestingly, our results also show that HPVs make use of an existing cellular pathway to target hDlg for degradation, as we provide evidence that hDlg protein is intrinsically subject to dynamic regulation via the ubiquitin-proteasome pathway in epithelial cells lacking HPV, such as HaCaT skin keratinocytes and primary rodent epithelial cells. Starting from this finding, the next important step will be to understand how this cellular pathway is modified by the viral oncoproteins and what are the consequences of this for cell fate. Preliminary data indicate that, although in non-synchronised HPV-positive cells the proteasome degradation of hDlg does not appear dissimilar to the HPV-negative cells, cell cycle analyses reveal striking differences, suggesting that HPV-mediated degradation of hDlg takes place during a restricted window of time (P.M., F.M. and L.B., unpublished).
We also show that readily detectable levels of proteasome-regulated hDlg protein are found in those cells that have a more differentiated phenotype. These cells are characterised by the presence of stable junctions that hold the cells together in epithelial structures and regulate their growth upon cell contact. Conversely, low levels of hDlg protein, which is poorly stabilised following proteasome inhibition, were found in those cells that exhibit a more undifferentiated phenotype, make very loose cell contacts and grow in a disorderly fashion without contact inhibition. Thus, loss of hDlg expression correlates with a more undifferentiated phenotype, and this would appear to occur, in part, at the level of mRNA expression. Moreover, the levels of hDlg protein are regulated by the degree of cell contact. Thus, in isolated cells hDlg is continually degraded by the proteasome pathway; however, once contacts with neighbouring cells are established, the hDlg protein, which localises at membrane junctions, becomes stabilised. Again, stabilisation is only seen in the more differentiated cell types and appears to be independent of the presence of HPV sequences. Interestingly, analysis of primary BRK cells also demonstrates a very similar pattern of Dlg regulation; however, once those cells become fully transformed, the ability to regulate Dlg is lost, together with the capacity to form cell junctions, and the protein fails to accumulate even when the cells reach high density. These results suggest that the loss of hDlg expression, and in particular, loss of the ability to upregulate it upon cell contact, is a vital step during malignant progression. Indeed, we have observed that in all cells that have impaired Dlg regulation there is a parallel acquisition of an invasive phenotype and of a capacity to grow in an anchorage-independent manner. Although the cellular roles of hDlg are still largely unknown, there is growing evidence that it may have tumour suppressive functions in regulating cell polarity and proliferation. It would therefore be of great interest to determine if loss of hDlg expression is a common feature in all highly malignant tumours.
Not all forms of the hDlg protein are degraded with equal efficiency by the proteasome. Some of them are in fact eliminated more dramatically, being stabilised only after treating the cells with proteasome inhibitors or by cell contact. This would also imply their direct involvement in the molecular organisation of the epithelial junctions. Previous reports have suggested that different isoforms of hDlg might exhibit exclusive binding properties, thus being able to perform specialised functions in the cell. The binding site for the cytoskeletal protein 4.1 has been mapped to an alternatively spliced domain of hDlg (Marfatia et al., 1996), which may therefore be involved in its subcellular targeting. Another alternatively spliced domain of hDlg encodes a potential SH3-binding site in the N-terminus, a region that mediates its selective recruitment to sites of cell contact (Wu et al., 1998). Using phosphatase experiments, we show that the most unstable forms of hDlg, which become stabilised upon increased cell density, are phosphorylated. This finding further supports the idea of different hDlg pools performing specific roles that need to be tightly regulated in the cell. Post-translational modifications have been shown to regulate the membrane targeting of several Dlg family members: palmitoylation controls association of PSD-95 with the plasma membrane (Topinka and Bredt, 1998; El-Husseini et al., 2000), whereas phosphorylation of insect Dlg by CaMKII regulates its anchoring to the synaptic complex (Koh et al., 1999), and phosphorylation of the MAGUK ZO-1 has been proposed to play a role in the assembly of tight junctions (Kurihara et al., 1995). Phosphorylation could also be part of a signalling cascade that regulates proteasome degradation of hDlg. ß-catenin, a protein involved in both cell-cell adhesion and growth factor signal transduction, is part of such a cascade. Upon phosphorylation, ß-catenin is targeted for proteasome degradation (Orford et al., 1997) and, interestingly, also forms a complex with hDlg and APC (Matsumine et al., 1996).
In this paper we have begun to elucidate the complex and dynamic pattern of hDlg protein regulation. This is reminiscent of ß-catenin regulation, and it is therefore tempting to hypothesise that hDlg also functions in cell signalling, in addition to its roles in the organisation of membrane junctions. hDlg belongs to a family of proteins called membrane-associated guanylate kinase homologues (MAGUKs) which have indeed been shown to be involved in cell signalling in Caenorhabditis elegans vulva precursor cells (Hoskins et al., 1995), and several lines of evidence suggest that hDlg may also transduce growth inhibitory signals. It has long been known that some mutations in Drosophila Dlg cause neoplastic growth of epithelial cells (Woods and Bryant, 1989) without affecting the structural functions of the protein (Woods et al., 1996), and although now its role in suppressing cell proliferation is well established, the underlying molecular mechanisms are only starting to be investigated. For example, overexpression of hDlg is able to block cell cycle progression from the G0/G1 to S phase (Ishidate et al., 2000), probably by means of its interaction with APC (Matsumine et al., 1996), as mutant APC lacking a hDlg-binding motif exhibits weaker antiproliferative activity (Ishidate et al., 2000). Phosphorylation and ubiquitination of hDlg, regulated by cell contact, may well modulate interactions of hDlg with its protein partners, thereby affecting downstream pathways.
In conclusion, our findings support the notion that hDlg plays an active role in the molecular organisation of epithelial junctions and in the maintenance of a differentiated epithelial architecture. Moreover, we provide evidence that, in epithelial cells, hDlg is subjected to a complex pattern of regulation through both phosphorylation and ubiquitination. These events can modulate hDlg stability in a dynamic fashion, depending upon the extent of cell-cell contact, and they may also affect additional functions of hDlg that regulate cell proliferation. Work is in progress to investigate in further detail the molecular mechanisms of hDlg regulation and their consequences, as well as the events that correlate their misregulation with the undifferentiated and invasive phenotype.
| ACKNOWLEDGMENTS |
|---|
| REFERENCES |
|---|
|
|
|---|
Bilder, D. and Perrimon, N. (2000). Localisation of apical epithelial determinants by the basolateral PDZ protein Scribble. Nature 403, 676-680.[Medline]
Bilder, D., Li, M. and Perrimon, N. (2000). Cooperative regulation of cell polarity and growth by Drosophila tumor suppressors. Science 289, 113-116.
Craven, S. and Bredt, D. (1998). PDZ proteins organize synaptic signaling pathways. Cell 93, 495-498.[Medline]
Doorbar, J., Foo, C., Coleman, N., Medcalf, L., Hartley, O., Prospero, T., Napthine, S., Sterling, J., Winter, G. and Griffin, H. (1997). Characterisation of events during the late stages of HPV 16 infection in vivo using high affinity synthetic Fabs to E4. Virology 238, 40-52.[Medline]
El-Husseini, A., Craven, S., Chetkovich, D., Firestein, B., Schnell, E., Aoki, C. and Bredt, D. (2000). Dual palmitoylation of PSD-95 mediates its vesiculotubular sorting, postsynaptic targeting, and ion channel clustering. J. Cell Biol. 148, 159-171.
Gardiol, D., Kühne, C., Glausinger, B., Lee, S., Javier, R. and Banks, L. (1999). Oncogenic human papillomavirus E6 proteins target the discs large tumour suppressor for proteasome mediated degradation. Oncogene 18, 5487-5496.[Medline]
Gaudet, S., Branton, D. and Lue, R. A. (2000). Characterization of PDZ-binding kinase, a mitotic kinase. Proc. Natl. Acad. Sci. USA 97, 5167-5172.
Hanada, T., Lin, L., Chandy, G., Oh, S. and Chishti, H. (1997). Human homologue of the Drosophila discs large tumour suppressor binds to p56lck tyrosine kinase and Shaker type Kv 1.3 potassium channel in T lymphocytes. J. Biol. Chem. 272, 26899-26904.
Hoskins, R., Hajnal, A., Harp, S. and Kim, S. (1995). The C. elegans vulval induction gene lin-2 encodes a member of the MAGUK family of cell junction proteins. Development. 122, 97-111.[Abstract]
Ishidate, T., Matsumine, A., Toyoshima, K. and Akiyama, T. (2000). The APC-hDlg complex negatively regulates cell cycle progression from the G0/G1 to S phase. Oncogene 19, 365-372.[Medline]
Kim, E., Niethammer, M., Rothschild, A., Nung Yan, Y. and Sheng, M. (1995). Clustering of Shaker-type K+ channels by interaction with a family of membrane-associated guanylate kinases. Nature 378, 85-88.[Medline]
Kim, S. (1997). Polarized signalling: basolateral receptor localization in epithelial cells by PDZ-containing proteins. Curr. Opin. Cell Biol. 9, 853-859.[Medline]
Kiyono, T., Hiraiwa, A., Fujita, M., Hayashi, Y., Akiyama, T. and Ishibashi, M. (1997). Binding of high-risk human papillomavirus E6 oncoproteins to the human homologue of the Drosophila discs large tumour suppressor protein. Proc. Natl. Acad. Sci. USA 94, 11612-11616.
Koh, Y., Popova, E., Thomas, U., Griffith, L. and Budnik, V. (1999). Regulation of DLG localization at synapses by CaMKII-dependent phosphorylation. Cell 98, 353-363.[Medline]
Kühne, C., Gardiol, D., Guarnaccia, C., Amenitsch, H. and Banks, L. (2000). Differential regulation of human papillomavirus E6 by protein kinase A: conditional degradation of human discs large protein by oncogenic E6. Oncogene 19, 5884-5891.[Medline]
Kurihara, H., Anderson, J. and Farquhar, M. (1995). Increased tyr phosphorylation of ZO-1 during modification of tight junctions between glomerular foot processes. Am. J. Physiol. F514-F524.
Lee, S., Weiss, R. and Javier, R. (1997). Binding of human virus oncoproteins to hDlg/SAP97, a mammalian homolog of the Drosophila discs large tumour suppressor protein. Proc. Natl. Acad. Sci. USA 94, 6670-6675.
Lue, R., Brandin, E., Chan, E. and Branton, D. (1996). Two independent domains of hDlg are sufficient for subcellular targeting: the PDZ1-2 conformational unit and an alternatively spliced domain. J. Cell Biol. 135, 1125-1137.
Lue, R., Marfatia, S., Branton, D. and Chishti, A. (1994). Cloning and characterisation of hDlg: the human homologue of the Drosophila discs large tumour suppressor binds to protein 4.1. Proc. Natl. Acad. Sci. USA 91, 9818-9822.
Marfatia, S., Morais Cabral, J., Lin, L., Hough, C., Bryant, P., Stolz, L. and Chishti, A. (1996). Modular organisation of the PDZ domains in the human discs-large protein suggests a mechanism for coupling PDZ domain-binding proteins to ATP and the membrane cytoskeleton. J. Cell Biol. 135, 753-766.
Massimi, P., Pim, D. and Banks, L. (1997). Human papillomovirus type 16 E7 binds to thge conserved carboxy-terminal region of the TATA-box binding protein and this contributes to E7 transforming activity. J. Gen. Virol. 78, 2607-2613.[Abstract]
Matsumine, A., Ogai, A., Senda, T., Okumura, N., Satoh, K., Baeg, G., Kawahara, T., Tobayashi, S., Okada, M., Toyoshima, K. and Akyama, T. (1996). Binding of APC to the human homolog of the Drosophila discs large tumour suppressor protein. Science 272, 1020-1023.[Abstract]
Nakagawa, S. and Huibregtse, J. M. (2000). Human Scribble (Vartul) is targeted for ubiquitin-mediated degradation by the high-risk papillomavirus E6 proteins and the E6AP ubiquitin-protein ligase. Mol. Cell Biol. 20, 8244-8253.
Orford, K., Crockett, C., Jensen, J., Weissman, A. and Byers, S. (1997). Serine phosphorylation-regulated ubiquitination and degradation of ß-catenin. J. Biol. Chem. 272, 24735-24738.
Pim, D., Thomas, M., Javier, R., Gardiol, D. and Banks, L. (2000). HPV E6 targeted degradation of the discs large protein: evidence for the involvement of a novel ubiquitin ligase. Oncogene 19, 719-725.[Medline]
Ren, R., Mayer, B., Cicchetti, P. and Baltimore, D. (1993). Identification of a ten-amino acid proline-rich SH3 binding site. Science 259, 1157-1161.
Reuver, S. and Garner, C. (1998). E-cadherin mediated cell adhesion recruits SAP97 into the cortical cytoskeleton. J. Cell Sci. 111, 1071-1080.[Abstract]
Rock, K., Gramm, C., Rothstein, L., Clark, K., Stein, R., Dick, L., Hwang, D. and Goldberg, D. (1994). Inhibition of the proteasome blocks the degradation of most cell proteins and the generation of peptides presented on MHC class I molecules. Cell 78, 761-771.[Medline]
Storey, A., Pim, D., Murray, A., Banks, L. and Crawford, L. (1988) Comparison of the in vitro transforming activities of human papillomavirus types. EMBO J. 7, 1815-1820.[Medline]
Suzuki, T., Ohsugi, Y., Uchida-Toita, M., Akiyama, T. and Yoshida, M. (1999). Tax oncoprotein of HTLV-1 binds to the human homologue of Drosophila discs large tumour suppressor protein, hDlg, and perturbs its function in cell growth control. Oncogene 18, 5967-5972.[Medline]
Topinka, R. and Bredt, S. (1998). N-terminal palmitoylation of PSD-95 regulates association with cell membranes and interaction with K+ channel Kv1.4. Neuron 20, 125-134.[Medline]
Woods, D. F. and Bryant, P. J. (1989). Molecular cloning of the lethal (1) discs large-1 oncogene of Drosophila. Dev. Biol. 134, 222-235.[Medline]
Woods, D. F. and Bryant, P. J. (1991). The discs-large tumour suppressor gene of Drosophila encodes a guanylate kinase homolog localized at septate junctions. Cell 66, 451-464.[Medline]
Woods, D. F. and Bryant, P. J. (1993). ZO-1, Dlg-A and PSD-95/SAP90 homologous proteins in tight, septate and synaptic cell junctions. Mech. Dev. 44, 85-89.[Medline]
Woods, D. F., Hough, C., Peel, D., Callaini, G. and Bryant, P. J. (1996). Dlg protein is required for junction structure, cell polarity, and proliferation control in Drosophila epithelia. J. Cell Biol. 134, 1469-1482.
Wu, H., Reuver, S., Kuhlendahl, S., Chung, W. and Garner, C. (1998). Subcellular targeting and cytoskeletal attachment of SAP97 to the epithelial lateral membrane. J. Cell Sci. 111, 2365-2376.[Abstract]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
K. M. Bedard, M. P. Underbrink, H. L. Howie, and D. A. Galloway The E6 Oncoproteins from Human Betapapillomaviruses Differentially Activate Telomerase through an E6AP-Dependent Mechanism and Prolong the Lifespan of Primary Keratinocytes J. Virol., April 15, 2008; 82(8): 3894 - 3902. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Takizawa, K. Nagasaka, S. Nakagawa, T. Yano, K. Nakagawa, T. Yasugi, T. Takeuchi, T. Kanda, J. M. Huibregtse, T. Akiyama, et al. Human scribble, a novel tumor suppressor identified as a target of high-risk HPV E6 for ubiquitin-mediated degradation, interacts with adenomatous polyposis coli Genes Cells, April 1, 2006; 11(4): 453 - 464. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Hayakawa, H. Kitagawa, K. Miyazawa, M. Kitagawa, and K. Kikugawa The FWD1/{beta}-TrCP-mediated degradation pathway establishes a 'turning off switch' of a Cdc42 guanine nucleotide exchange factor, FGD1 Genes Cells, March 1, 2005; 10(3): 241 - 251. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. M. Six, D. Ndiaye, G. Sauer, Y. Laabi, R. Athman, A. Cumano, C. Brou, A. Israel, and F. Logeat The Notch Ligand Delta1 Recruits Dlg1 at Cell-Cell Contacts and Regulates Cell Migration J. Biol. Chem., December 31, 2004; 279(53): 55818 - 55826. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. S. Grm and L. Banks Degradation of hDlg and MAGIs by human papillomavirus E6 is E6-AP-independent J. Gen. Virol., October 1, 2004; 85(10): 2815 - 2819. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Watson, M. Thomas, L. Banks, and S. Roberts Activity of the human papillomavirus E6 PDZ-binding motif correlates with an enhanced morphological transformation of immortalized human keratinocytes J. Cell Sci., December 15, 2003; 116(24): 4925 - 4934. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Mantovani and L. Banks Regulation of the Discs Large Tumor Suppressor by a Phosphorylation-dependent Interaction with the {beta}-TrCP Ubiquitin Ligase Receptor J. Biol. Chem., October 24, 2003; 278(43): 42477 - 42486. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A. Watson, T. P. Rollason, G. M. Reynolds, P. G. Murray, L. Banks, and S. Roberts Changes in expression of the human homologue of the Drosophila discs large tumour suppressor protein in high-grade premalignant cervical neoplasias Carcinogenesis, November 1, 2002; 23(11): 1791 - 1796. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Kumar, Y. Zhao, G. Meng, M. Zeng, S. Srinivasan, L. M. Delmolino, Q. Gao, G. Dimri, G. F. Weber, D. E. Wazer, et al. Human Papillomavirus Oncoprotein E6 Inactivates the Transcriptional Coactivator Human ADA3 Mol. Cell. Biol., August 15, 2002; 22(16): 5801 - 5812. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||