|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
Research Article |
1 Department of Pathology, The University of Chicago, Chicago, IL 60637, USA
2 Department of Medicine, Section of Cardiology, The University of Chicago, Chicago, IL 60637, USA
3 Department of Human Genetics, The University of Chicago, Chicago, IL 60637, USA
*Author for correspondence (e-mail: emcnally{at}medicine.bsd.uchicago.edu)
Accepted September 26, 2001
| SUMMARY |
|---|
|
|
|---|
Key words: Spectrin repeat, Nuclear membrane, Lamin A/C, Transmembrane protein
| Introduction |
|---|
|
|
|---|
-helices separated by two loop regions, forming a triple-helical bundle (Pascual et al., 1996; Pascual et al., 1997; Yan et al., 1993). Spectrin repeat (SR)-containing proteins provide critical structural roles, and mutations in SR-protein genes have been implicated in human disease. For example, mutations in the ß-spectrin gene are associated with hereditary elliptocytosis (Delaunay, 1995). ß-spectrin contains 17 SRs within its rod region and is a major contributor to the stability of the erythrocyte membrane, where it interacts with an array of proteins including ankryin and actin (Bennett and Gilligan, 1993). Dystrophin, the protein product of the Duchenne muscular dystrophy locus, contains 24 SRs, and mutations that disrupt dystrophin lead to muscle membrane instability and muscular dystrophy (Anderson and Kunkel, 1992). The SRs of these and other cytoskeletal proteins serve as sites for protein-protein interaction, actin and microtubule crosslinking, and molecular scaffolding and stabilization. Additionally, SRs mediate dimerization in
- and ß-spectrin, and
-actinin (Djinovic-Carugo et al., 1999). In contrast to the plasma membrane, the stability of the nuclear membrane derives, in part, from an assembly of intermediate filaments underlying the inner nuclear membrane. Lamins are intermediate filament proteins that provide significant structure to the inner nuclear membrane, forming a meshwork that interacts with nuclear membrane receptors and associated proteins (Gruenbaum et al., 2000; Stuurman et al., 1998). Nuclear lamins display a typical intermediate filament domain profile, including a globular N-terminal head, a central rod domain and a C-terminal globular tail. Lamins are classified as type A or type B, depending on sequence, expression pattern and mitotic behavior. Lamins A and C, alternatively spliced products of the same precursor gene, are expressed in differentiated cells and tissues, whereas type B lamins are constitutively expressed within all embryonic and somatic tissues (Broers et al., 1997). In addition, during the mitotic disassembly of the nuclear membrane, A-type lamins solubilize and are dispersed throughout the cell, whereas B-type lamins remain firmly bound to nuclear membrane vesicles (Moir et al., 2000a; Moir et al., 2000b). A growing number of inner nuclear membrane proteins have been found to interact with nuclear lamins in vivo and in vitro and appear to regulate nuclear membrane function and assembly (Clements et al., 2000; Dechat et al., 2000; Gant and Wilson, 1997; Martins et al., 2000). For example, the lamin B receptor (LBR) contains a predicted eight-transmembrane segment in its C-terminus and a nucleoplasmic N-terminal domain that can be phosphorylated by protein kinase A and cdc2 kinase (Courvalin et al., 1992; Worman et al., 1990). Additionally, members of the LAP2 (Lamin-associated protein 2) family and LBR bind to chromatin (Chu et al., 1998; Foisner and Gerace, 1993; Furukawa et al., 1998; Ye and Worman, 1994). Such chromatinnuclear-envelope linker proteins may have essential roles in the regulation of gene expression.
Interestingly, a handful of structural proteins at the inner nuclear membrane have been shown to be important for cardiac and skeletal muscle disease (Cohen et al., 2001; Hegele, 2000; Nagano and Arahata, 2000). Mutations in emerin, an X-linked 34 kDa protein, produce muscular dystrophy (Bione et al., 1994; Nagano et al., 1996). In cardiac muscle, loss of emerin can lead to cardiac muscle dysfunction but more commonly results in aberrant electrical conduction, or heart block, suggesting that nuclear membrane proteins are specifically important for normal function of the cardiac atrio-ventricular node (Funakoshi et al., 1999). Most recently, mutations lamin A/C have been identified in humans with muscular dystrophy, cardiomyopathy and heart block, highlighting the importance of nuclear membrane function in normal heart and skeletal muscle physiology (Bonne et al., 1999; Fatkin et al., 1999). Missense and truncating mutations in lamin A/C suggest that many of these mutations exert a dominant interfering effect (Bonne et al., 1999; Di Barletta et al., 2000). A specific set of mutations that cluster within a small region of exon 8 of lamin A cause an unusual adipocyte wasting disorder, Dunnigans partial lipodystrophy (DPLD) (Cao and Hegele, 2000; Shackleton et al., 2000; Speckman et al., 2000). Mice with a homozygous null allele of lamin A/C were shown to develop early lethality resulting from muscular dystrophy and have an abnormal fat distribution (Sullivan et al., 1999). Lamin A/C is broadly expressed, yet the mechanism by which lamin A/C mutations lead to tissue-specific phenotypes is unknown. Disruption of tissue-specific protein interactions may explain the phenotypes attributed to lamin A/C mutations.
Toward this end, we have identified a novel SR protein that is expressed primarily in cardiac, skeletal and smooth muscle and associates with lamin A/C. Recently this protein product was identified as interacting with MuSK, a muscle-specific tyrosine kinase of the neuromuscular junction, and it was termed syne-1 for synaptic nuclear envelope (Apel et al., 2000). Here, we demonstrate that this protein displays a broader expression pattern than first thought, including high levels of expression at the nuclear membrane of smooth, skeletal and cardiac muscle. Therefore, we propose renaming this protein myne-1 (myocyte nuclear envelope). Myne-1 is predicted to be a type II transmembrane protein with a large cytoplasmic domain containing seven SR domains, an interrupted LEM domain and a C-terminal membrane-spanning domain. We found that myne-1 colocalizes completely with lamin A/C in all tissue types tested but shows only partial colocalization with emerin. Coimmunoprecipitation studies show an interaction with lamin A/C. Our data suggest that the myne-1lamin A/C interaction may be one mechanism by which lamin A/C mutations exert a tissue-specific effect.
| Materials and Methods |
|---|
|
|
|---|
-dCTP cDNA probe amplified from the myne-1 3'UTR region with the following primers: 5'TACACGAATGGCCCTCCTCC3' and 5'ACATGGTGCTTGGGAGGGTC3'. The probe was hybridized to a human multi-tissue mRNA blot (Clontech) and visualized on a Molecular Dynamics Phosphorimager (Amersham Pharmacia Biotech) and Kodak MS film. Using an EST-derived sequence, a forward primer 5'CTCCTTCTCTCGGCGGACAGTGGCGC3' was designed. A full-length clone of myne-1 was generated by using this forward primer and the reverse primer 5'CATGTGATCTGGAGGAGGGCTAAAGCTG3' to amplify a 3644 bp product from human skeletal muscle cDNA (GenBank accession number AF444779). The product was then cloned into pCRII-TOPO vector (Invitrogen) and fully sequenced to confirm the sequence of myne-1. Predicted amino-acid sequence alignments were performed using the MacVector (v. 6.0) program (Oxford Molecular Group). Prediction of orientation of transmembrane helices was performed on the TMHMM server (v. 2.0) at http://www.cbs.dtu.dk/services/TMHMM/. Prediction of amino-acid domain structure was performed on the Simple Modular Architecture Research Tool (SMART) at http://smart.embl-heidelberg.de/ and the ISREC ProfileScan protein domain analysis server at http://www.isrec.isb-sib.ch/
Generation of AM1
The peptide, TSGRSTPNRQKTPRGK, representing residues 970-985 of GenBank accession number AB018339 (KIAA0796) was synthesized and injected into rabbits to raise a polyclonal antisera (Zymed Laboratories, South San Francisco, CA). This sequence shows no significant homology to the related sequence KIAA1011/DKFZ 434G173 and no significant homology to any other sequence in the available electronic databases. A glutathione s-transferase (GST) fusion protein expressing a fragment of myne-1 (aa 979 to 1105) was expressed in E. coli using pGEX4T-1 (Amersham Pharmacia Biotech) and was used to affinity purify AM1 as described (McNally et al., 1996).
Immunocytochemistry and immunoblotting
Tissues from a C57/BL6 mouse were harvested and frozen in liquid-nitrogen-cooled isopentane. Frozen 7 µm sections were fixed in 20°C methanol for two minutes, washed twice in PBS and blocked with 5% FBS in PBS. Primary antibodies were used at the following dilutions: lamin A/C 1:200; emerin 1:250; anti-smooth muscle actin 1:100; and AM1 1:50. Each antibody was diluted in blocking solution and incubated overnight at 4°C. CY3-conjugated goat anti-rabbit and FITC-conjugated goat anti-mouse secondary antibodies (Jackson Immunochemicals) were used at 1:2000 in blocking solution. Results were visualized using a Zeiss AxioCam digital camera mounted on a Zeiss Axiophot 50 microscope (Carl Zeiss Inc.). Images were recorded and stored using the Zeiss AxioVision digital imaging software. Immunoblotting was performed as described in (Davis et al., 2000). AM1 was used at 1:200, and HRP-conjugated goat anti-rabbit antibody (Jackson Immunochemicals) was used at 1:5000. ECL plus (Amersham Pharmacia Biotech) and Kodak MS film were used for detection. Anti-smooth-muscle actin monoclonal antibody, 1A4, was purchased from Sigma (catalogue number A2547). Anti-lamin A/C monoclonal antibody, XB10, was obtained from Covance/BAbCo (catalogue number MMS-107P). Anti-emerin monoclonal antibody was from Novocastra (catalogue code NCL-EMERIN). DAPI mounting medium was from Vector Laboratories. Anti-LAP2ß monoclonal antibody was from BD Transduction Laboratories (catalogue number L74520).
Nuclear preparation and fractionation
Nuclear membrane preparations were prepared essentially as described in (Davis et al., 2000). Briefly, mouse skeletal muscle tissue was homogenized in PBS then washed in 1xPBS twice at 4°C and pelleted. Cells were lysed in hypotonic buffer (10 mM Hepes, pH 7.9, 1.5 mM MgCl2, 10 mM KCl, 0.5 mM DTT plus protease inhibitor cocktail (Boehringer Mannheim GmbH., catalogue number 1873580)), incubated on ice for 15 minutes, vortexed for 30 seconds, then nuclei were collected at 14,000 g for 10 seconds at 4°C. The light microsomal fraction was collected from the supernatant by centrifugation (30,000 g for 30 minutes). The heavy microsomes were subjected to 105,000 g for 30 minutes. The nuclear membrane and the nucleoplasm were separated by resuspending the initial nuclear pellets in high salt buffer (20 mM Hepes, pH=7.9, 25% glycerol, 0.42 M KCl, 1.5 mM MgCl2, 0.2 mM EDTA, 0.5 mM DTT plus protease inhibitor cocktail). Nuclear membranes were pelleted at 14,000 g for five minutes at 4°C. Equal volumes of each fraction (15 µl) were loaded. Immunoblotting was performed as described in (Davis et al., 2000). AM1 was used at 1:200, and HRP-conjugated goat anti-rabbit antibody (Jackson Immunochemicals) was used at 1:5000. ECL plus (Amersham Pharmacia Biotech) and Kodak MS film were used for detection.
In vitro muscle differentiation and immunofluorescence
Murine muscle C2C12 cells were obtained from American Type Culture Collection and maintained at below 70% confluence to avoid differentiation. Cells were grown on glass coverslips and differentiated by allowing cells to grow to 70% confluence followed by serum starvation. Cells were harvested at sequential stages of differentiation, fixed, and stained and visualized as described above. The antibodies used are listed above.
Immunoprecipitation of lamin A/C and myne-1
For immunoprecipitations, differentiated C2C12 cells were harvested, sonicated on ice in immunoprecipitation buffer (10 mM Hepes, pH 7.4, 10 mM KCl, 5 mM EDTA, 1% Triton X-100 and protease inhibitor cocktail) and then centrifuged at 16,000 g for 15 minutes at 4°C. Lysate was then precleared with Protein A/G sepharose. Immunoprecipitations with relevant antibodies (diluted 1:75) were performed at room temperature for three hours, followed by incubation with Protein A/G sepharose for two hours and centrifugation at 4,000 g for 10 minutes. Immune complexes were washed four times and proteins eluted in SDS sample buffer and run on duplicate 4-12% gradient SDS-PAGE. One gel was stained with Coomassie Blue stain and destained to visualize proteins and the second gel was transferred to a PVDF membrane. Membranes were blocked in 3% BSA/TBS-T for one hour before overnight incubation with lamin A/C, 1:500. Secondary antibodies were applied and visualized as described above.
| Results |
|---|
|
|
|---|
-actinin-type actin-binding domain at its N-terminus and is important for attaching muscle to epidermis (Gregory and Brown, 1998; Prokop et al., 1998; Strumpf and Volk, 1998) and for dendritic sprouting of motor neurons (Prokop et al., 1998). BLAST searches with kakapo SRs identified a novel SR protein encoded by the EST KIAA0796. A 5' EST (GenBank AW952703) was aligned with the existing KIAA0796 to encode the 5' end. This consensus sequence contains a Kozak sequence and predicted start methionine, completing a 4163 bp cDNA sequence with a 3507 bp open reading frame. This sequence was recently reported as encoding syne-1 (synaptic nuclear envelope protein-1) (Apel et al., 2000). We propose the name myne-1 (myocyte nuclear envelope protein-1) as the protein is preferentially expressed in striated and smooth muscle (see below).
Using the Simple modular architecture research tool (SMART) algorithm (Ponting et al., 1999; Schultz et al., 2000; Schultz et al., 1998) and TMHMM transmembrane helix server (Krogh et al., 2001), we found that the primary structure of myne-1 predicts a 131 kDa protein containing seven SRs, a central coiled-coil domain and a type II transmembrane domain followed by a short intraluminal C-terminus (Fig. 1A). Analysis of cDNAs encoding myne-1 reveals that alternative splicing in this region results in the loss of the serine-rich region (Fig. 1B). A BLAST alignment indicates that the first 1020 amino acids of the 1169 amino acid myne-1 share 40% overall homology with the central SR-containing domain of dystrophin. The second and third SRs of myne-1 share 50% overall homology with the C-terminal two SRs found in mAKAP, an A-kinase anchoring protein preferentially expressed in muscle (Kapiloff et al., 1999). Myne-1 residues 595-670 share homology with the LEM domain, a 43 residue region of homology found in LAP2, emerin, and MAN1 (Lin et al., 2000). The LEM domain has been demonstrated to bind to BAF (Shumaker et al., 2001), which in turn binds to chromatin (Zheng et al., 2000). A predicted 20 residue coiled-coil domain (Fig. 1C) disrupts the myne-1 LEM domain. Two bipartite nuclear localization signals are found in myne-1 (amino acids 348-365 and 563-580), located in the last
-helix of the third and fifth SRs, respectively. All SRs of myne-1 except for the fourth SR are predicted to be acidic (pI 4.6-6.2). The fourth SR is predicted to be basic (pI 9.7).
|
9.5 kb mRNA signal was observed throughout all tissues on a human multi-tissue mRNA blot.
|
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
Previously, this protein was identified as syne-1 (synaptic nuclear expressed protein-1) (Apel et al., 2000). Because of our findings, we propose renaming this as myne-1 (myocyte nuclear envelope protein-1) to account for its expression pattern and potential interactions outside of postsynaptic nuclei. Apel et al. identified the transmembrane domain as a klarisht-like domain. klarisht is a protein critical for migration of nuclei to the cell periphery in Drosophila. This is consistent with the peripheral localization of nuclei in skeletal myocytes but is inconsistent with the centrally located nuclei of cardiac and smooth muscle. Using the SMART and TMHMM server algorithms, we found that this region is highly likely to encode a type II transmembrane domain. This prediction was tested experimentally by a nuclear membrane extraction performed on mouse muscle where myne-1 was greatly enriched in the nuclear membrane fractions.
In addition to SRs and the transmembrane domain, we found that myne-1 contains an interrupted or broken LEM domain. The LEM domain is a region of 43 amino acids and is so named for its presence in LAP2, emerin and MAN-1 protein of the inner nuclear membrane (Lin et al., 2000). The function of the LEM domain is not fully understood, but recent data (Shumaker et al., 2001) suggest that this residue is critical for binding BAF, a small molecular weight protein that binds to double stranded DNA (Zheng et al., 2000). Therefore, the LEM domain may be important for crosslinking chromatin to the inner nuclear membrane. The disrupted LEM sequences in myne-1 may function similarly or may have additional functions given to the tissue-specific expression of myne-1.
We identified myne-1 by its homology to the SRs of kakapo. SRs are normally associated with a number of cytoskeletal proteins, such as spectrin, dystrophin, utrophin,
-actinin, plectin and ACF7, and participate in protein-protein interactions with other cytoskeletal proteins such as actin and zyxin (Amann et al., 1998; Crawford et al., 1992; Rybakova et al., 1996; Rybakova and Ervasti, 1997). Because SR proteins are generally associated with the cytoskeleton and the plasma membrane, the nuclear membrane localization of myne-1 is unusual. mAKAP, a protein kinase A anchoring protein targeted to the nuclear membrane of differentiated myocytes, possesses three SRs, two of which are critical for targeting mAKAP to the nuclear membrane (Kapiloff et al., 1999). Downstream regulation of cAMP-dependent proteins such as protein kinase A (PKA) is mediated by anchoring proteins (AKAPs) that sequester PKA to discrete subcellular locations. This compartmentalization is critical for cellular function, as specificity of cAMP-mediated signaling and function is based in a large part on distinct spatial positioning. In the case of mAKAP, it is the SRs of the protein that are critical for the compartmentalization of the protein, targeting mAKAP to the nuclear membrane (Kapiloff et al., 1999). Like mAKAP, myne-1 may serve as a scaffolding protein for kinases. Using the yeast two-hybrid system, Apel et al., demonstrated that syne-1 binds to MuSK, a tyrosine kinase expressed in postsynaptic myocytes (Apel et al., 2000). The in vitro interaction between syne-1 and MuSK occurs in the cytoplasmic domain of MuSK. This cytoplasmic domain contains the tyrosine kinase domain of MuSK (Valenzuela et al., 1995) and demonstrates high homology to many tyrosine kinases when subjected to a BLAST search. Thus, syne-1/myne-1 may act as a scaffold for any number of tyrosine kinases, or serine/threonine kinases, as its serine-rich C-terminal domain implies.
We observed complete colocalization between myne-1 and lamin A/C, but only partial overlap between myne-1 and emerin. Although this observation does not exclude the possibility of a myne-1emerin interaction, it indicates that an interaction is not necessary for myne-1 and emerin to localize to the nuclear membrane of cells. Myne-1 and lamin A/C coimmunoprecipitate from muscle extracts, indicating an interaction between the two proteins. At this point, it is not known whether the lamin-A/Cmyne-1 interaction is a direct or indirect interaction. It is possible that other nuclear membrane or nuclear-membrane-associated proteins participate in or in some way mediate the lamin-A/C-myne-1 interaction.
Mutations in the genes encoding emerin and lamin A/C specifically alter the phenotype of skeletal muscle, cardiac muscle and, in particular, the atrio-ventricular node of the cardiac conduction system (Becane et al., 2000; Bonne et al., 2000; Fatkin et al., 1999; Funakoshi et al., 1999). The phenotypic spectrum of lamin A/C and emerin mutations overlaps strikingly and is distinct from a number of other muscular dystrophies that alter genes encoding plasma membrane proteins (Hack et al., 2000). Lamin A/C and emerin are broadly expressed, and the mode by which tissue-specific effects develop from mutations in these genes is not known. We hypothesize that mutations in these genes may disrupt tissue-specific protein interactions. For example, mutations within exon 8 of lamin A/C are associated with a unique adipocyte-wasting disorder, DLPD (Speckman et al., 2000). It is possible that particular lamin A/C mutations disrupt the localization or function of myne-1. Further dissection of the myne-1lamin-A/C interaction will determine whether there is direct binding between these proteins and what other proteins may participate in the subcortical network of the inner nuclear membrane. A better understanding of the cell biology of these interactions may shed light on the tissue-specific mechanisms of pathogenesis in these disorders.
| REFERENCES |
|---|
|
|
|---|
Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J., Zhang, Z., Miller, W. and Lipman, D. J. (1997). Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res. 25, 3389-3402.
Amann, K. J., Renley, B. A. and Ervasti, J. M. (1998). A cluster of basic repeats in the dystrophin rod domain binds F-actin through an electrostatic interaction. J. Biol. Chem. 273, 28419-28423.
Anderson, M. S. and Kunkel, L. M. (1992). The molecular and biochemical basis of Duchenne muscular dystrophy. Trends Biochem. Sci. 17, 289-292.[Medline]
Apel, E. D., Lewis, R. M., Grady, R. M. and Sanes, J. R. (2000). Syne-1, a dystrophin- and Klarsicht-related protein associated with synaptic nuclei at the neuromuscular junction. J. Biol. Chem. 275, 31986-31995.
Becane, H. M., Bonne, G., Varnous, S., Muchir, A., Ortega, V., Hammouda, E. H., Urtizberea, J. A., Lavergne, T., Fardeau, M., Eymard, B. et al. (2000). High incidence of sudden death with conduction system and myocardial disease due to lamins A and C gene mutation. Pacing Clin. Electrophysio.l 23, 1661-1666.[Medline]
Bennett, V. and Gilligan, D. M. (1993). The spectrin-based membrane skeleton and micron-scale organization of the plasma membrane. Annu. Rev. Cell. Biol. 9, 27-66.
Bione, S., Maestrini, E., Rivella, S., Mancini, M., Regis, S., Romeo, G. and Toniolo, D. (1994). Identification of a novel X-linked gene responsible for Emery-Dreifuss muscular dystrophy. Nat. Genet. 8, 323-327.[Medline]
Bonne, G., Di Barletta, M. R., Varnous, S., Becane, H. M., Hammouda, E. H., Merlini, L., Muntoni, F., Greenberg, C. R., Gary, F., Urtizberea, J. A. et al. (1999). Mutations in the gene encoding lamin A/C cause autosomal dominant Emery-Dreifuss muscular dystrophy. Nat. Genet. 21, 285-288.[Medline]
Bonne, G., Mercuri, E., Muchir, A., Urtizberea, A., Becane, H. M., Recan, D., Merlini, L., Wehnert, M., Boor, R., Reuner, U. et al. (2000). Clinical and molecular genetic spectrum of autosomal dominant Emery-Dreifuss muscular dystrophy due to mutations of the lamin A/C gene. Ann. Neurol. 48, 170-180.[Medline]
Broers, J. L., Machiels, B. M., Kuijpers, H. J., Smedts, F., van den Kieboom, R., Raymond, Y. and Ramaekers, F. C. (1997). A- and B-type lamins are differentially expressed in normal human tissues. Histochem. Cell Biol. 107, 505-517.[Medline]
Cao, H. and Hegele, R. A. (2000). Nuclear lamin A/C R482Q mutation in canadian kindreds with Dunnigan-type familial partial lipodystrophy. Hum. Mol. Genet. 9, 109-112.
Chu, A., Rassadi, R. and Stochaj, U. (1998). Velcro in the nuclear envelope: LBR and LAPs. FEBS Lett. 441, 165-169.[Medline]
Clements, L., Manilal, S., Love, D. R. and Morris, G. E. (2000). Direct interaction between emerin and lamin A. Biochem. Biophys. Res. Commun. 267, 709-714.[Medline]
Cohen, M., Lee, K. K., Wilson, K. L. and Gruenbaum, Y. (2001). Transcriptional repression, apoptosis, human disease and the functional evolution of the nuclear lamina. Trends Biochem. Sci. 26, 41-47.[Medline]
Courvalin, J. C., Segil, N., Blobel, G. and Worman, H. J. (1992). The lamin B receptor of the inner nuclear membrane undergoes mitosis-specific phosphorylation and is a substrate for p34cdc2-type protein kinase. EMBO J. 11, 4027-4036.[Medline]
Crawford, A. W., Michelsen, J. W. and Beckerle, M. C. (1992). An interaction between zyxin and alpha-actinin. J. Cell Biol. 116, 1381-1393.
Davis, D. B., Delmonte, A. J., Ly, C. T. and McNally, E. M. (2000). Myoferlin, a candidate gene and potential modifier of muscular dystrophy. Hum. Mol. Genet. 9, 217-226.
Dechat, T., Korbei, B., Vaughan, O. A., Vlcek, S., Hutchison, C. J. and Foisner, R. (2000). Lamina-associated polypeptide 2alpha binds intranuclear A-type lamins. J. Cell Sci. 113, 3473-3484.[Abstract]
Delaunay, J. (1995). Genetic disorders of the red cell membranes. FEBS Lett. 369, 34-37.[Medline]
Di Barletta, M., Ricci, E., Galluzzi, G., Tonali, P., Mora, M., Morandi, L., Romorini, A., Voit, T., Orstavik, K. H., Merlini, L. et al. (2000). Different mutations in the LMNA gene cause autosomal dominant and autosomal recessive Emery-Dreifuss muscular dystrophy. Am. J. Hum. Genet. 66, 1407-1412.[Medline]
Djinovic-Carugo, K., Young, P., Gautel, M. and Saraste, M. (1999). Structure of the alpha-actinin rod: molecular basis for cross-linking of actin filaments. Cell 98, 537-546.[Medline]
Fairley, E. A., Kendrick-Jones, J. and Ellis, J. A. (1999). The Emery-Dreifuss muscular dystrophy phenotype arises from aberrant targeting and binding of emerin at the inner nuclear membrane. J. Cell Sci. 112, 2571-2582.[Abstract]
Fatkin, D., MacRae, C., Sasaki, T., Wolff, M. R., Porcu, M., Frenneaux, M., Atherton, J., Vidaillet, H. J., Spudich, S., De Girolami, U. et al. (1999). Missense mutations in the rod domain of the lamin A/C gene as causes of dilated cardiomyopathy and conduction-system disease. N. Engl. J. Med. 341, 1715-1724.
Foisner, R. and Gerace, L. (1993). Integral membrane proteins of the nuclear envelope interact with lamins and chromosomes, and binding is modulated by mitotic phosphorylation. Cell 73, 1267-1279.[Medline]
Funakoshi, M., Tsuchiya, Y. and Arahata, K. (1999). Emerin and cardiomyopathy in Emery-Dreifuss muscular dystrophy. Neuromuscul. Disord. 9, 108-114.[Medline]
Furukawa, K., Fritze, C. E. and Gerace, L. (1998). The major nuclear envelope targeting domain of LAP2 coincides with its lamin binding region but is distinct from its chromatin interaction domain. J. Biol. Chem. 273, 4213-4219.
Gant, T. M. and Wilson, K. L. (1997). Nuclear assembly. Annu. Rev. Cell Dev. Biol. 13, 669-695.[Medline]
Gregory, S. L. and Brown, N. H. (1998). kakapo, a gene required for adhesion between and within cell layers in Drosophila, encodes a large cytoskeletal linker protein related to plectin and dystrophin. J. Cell Biol. 143, 1271-1282.
Gruenbaum, Y., Wilson, K. L., Harel, A., Goldberg, M. and Cohen, M. (2000). Nuclear laminsstructural proteins with fundamental functions. J. Struct. Biol. 129, 313-323.[Medline]
Hack, A. A., Groh, M. E. and McNally, E. M. (2000). Sarcoglycans in muscular dystrophy. Microsc. Res. Tech. 48, 167-180.[Medline]
Hegele, R. A. (2000). The envelope, please: nuclear lamins and disease. Nat. Med. 6, 136-137.[Medline]
Kapiloff, M. S., Schillace, R. V., Westphal, A. M. and Scott, J. D. (1999). mAKAP: an A-kinase anchoring protein targeted to the nuclear membrane of differentiated myocytes. J. Cell Sci. 112, 2725-2736.[Abstract]
Krogh, A., Larsson, B., von Heijne, G. and Sonnhammer, E. L. (2001). Predicting transmembrane protein topology with a hidden Markov model: application to complete genomes. J. Mol. Biol. 305, 567-580.[Medline]
Lin, F., Blake, D. L., Callebaut, I., Skerjanc, I. S., Holmer, L., McBurney, M. W., Paulin-Levasseur, M. and Worman, H. J. (2000). MAN1, an inner nuclear membrane protein that shares the LEM domain with lamina-associated polypeptide 2 and emerin. J. Biol. Chem. 275, 4840-4847.
Martins, S. B., Eide, T., Steen, R. L., Jahnsen, T., Skalhegg, B. S. and Collas, P. (2000). HA95 is a protein of the chromatin and nuclear matrix regulating nuclear envelope dynamics. J. Cell Sci. 113, 3703-3713.[Abstract]
McNally, E. M., Duggan, D., Gorospe, J. R., Bonnemann, C. G., Fanin, M., Pegoraro, E., Lidov, H. G., Noguchi, S., Ozawa, E., Finkel, R. S. et al. (1996). Mutations that disrupt the carboxyl-terminus of gamma-sarcoglycan cause muscular dystrophy. Hum. Mol. Genet. 5, 1841-1847.
Moir, R. D., Spann, T. P., Lopez-Soler, R. I., Yoon, M., Goldman, A. E., Khuon, S. and Goldman, R. D. (2000a). The dynamics of the nuclear lamins during the cell cycle-relationship between structure and function. J. Struct. Biol. 129, 324-334.[Medline]
Moir, R. D., Yoon, M., Khuon, S. and Goldman, R. D. (2000b). Nuclear lamins A and B1: different pathways of assembly during nuclear envelope formation in living cells. J. Cell Biol. 151, 1155-1168.
Nagano, A. and Arahata, K. (2000). Nuclear envelope proteins and associated diseases. Curr. Opin. Neurol. 13, 533-539.[Medline]
Nagano, A., Koga, R., Ogawa, M., Kurano, Y., Kawada, J., Okada, R., Hayashi, Y. K., Tsukahara, T. and Arahata, K. (1996). Emerin deficiency at the nuclear membrane in patients with Emery-Dreifuss muscular dystrophy. Nat. Genet. 12, 254-259.[Medline]
Pascual, J., Pfuhl, M., Rivas, G., Pastore, A. and Saraste, M. (1996). The spectrin repeat folds into a three-helix bundle in solution. FEBS Lett. 383, 201-207.[Medline]
Pascual, J., Pfuhl, M., Walther, D., Saraste, M. and Nilges, M. (1997). Solution structure of the spectrin repeat: a left-handed antiparallel triple-helical coiled-coil. J. Mol. Biol. 273, 740-751.[Medline]
Ponting, C. P., Schultz, J., Milpetz, F. and Bork, P. (1999). SMART: identification and annotation of domains from signalling and extracellular protein sequences. Nucleic Acids Res. 27, 229-232.
Prokop, A., Uhler, J., Roote, J. and Bate, M. (1998). The kakapo mutation affects terminal arborization and central dendritic sprouting of Drosophila motorneurons. J. Cell Biol. 143, 1283-1294.
Pugh, G. E., Coates, P. J., Lane, E. B., Raymond, Y. and Quinlan, R. A. (1997). Distinct nuclear assembly pathways for lamins A and C lead to their increase during quiescence in Swiss 3T3 cells. J. Cell Sci. 110, 2483-2493.[Abstract]
Rybakova, I. N. and Ervasti, J. M. (1997). Dystrophin-glycoprotein complex is monomeric and stabilizes actin filaments in vitro through a lateral association. J. Biol. Chem. 272, 28771-28778.
Rybakova, I. N., Amann, K. J. and Ervasti, J. M. (1996). A new model for the interaction of dystrophin with F-actin. J. Cell Biol. 135, 661-672.
Schultz, J., Milpetz, F., Bork, P. and Ponting, C. P. (1998). SMART, a simple modular architecture research tool: identification of signaling domains. Proc. Natl. Acad. Sci. USA 95, 5857-5864.
Schultz, J., Copley, R. R., Doerks, T., Ponting, C. P. and Bork, P. (2000). SMART: a web-based tool for the study of genetically mobile domains. Nucleic Acids Res. 28, 231-234.
Shackleton, S., Lloyd, D. J., Jackson, S. N., Evans, R., Niermeijer, M. F., Singh, B. M., Schmidt, H., Brabant, G., Kumar, S., Durrington, P. N. et al. (2000). LMNA, encoding lamin A/C, is mutated in partial lipodystrophy. Nat. Genet. 24, 153-156.[Medline]
Shumaker, D. K., Lee, K. K., Tanhehco, Y. C., Craigie, R. and Wilson, K. L. (2001). LAP2 binds to BAF small middle dotDNA complexes: requirement for the LEM domain and modulation by variable regions. EMBO J. 20, 1754-1764.[Medline]
Speckman, R. A., Garg, A., Du, F., Bennett, L., Veile, R., Arioglu, E., Taylor, S. I., Lovett, M. and Bowcock, A. M. (2000). Mutational and haplotype analyses of families with familial partial lipodystrophy (Dunnigan variety) reveal recurrent missense mutations in the globular C-terminal domain of lamin A/C. Am. J. Hum. Genet. 66, 1192-1198.[Medline]
Strumpf, D. and Volk, T. (1998). Kakapo, a novel cytoskeletal-associated protein is essential for the restricted localization of the neuregulin-like factor, vein, at the muscle-tendon junction site. J. Cell Biol. 143, 1259-1270.
Stuurman, N., Heins, S. and Aebi, U. (1998). Nuclear lamins: their structure, assembly, and interactions. J. Struct. Biol. 122, 42-66.[Medline]
Sullivan, T., Escalante-Alcalde, D., Bhatt, H., Anver, M., Bhat, N., Nagashima, K., Stewart, C. L. and Burke, B. (1999). Loss of A-type lamin expression compromises nuclear envelope integrity leading to muscular dystrophy. J. Cell Biol. 147, 913-920.
Valenzuela, D. M., Stitt, T. N., DiStefano, P. S., Rojas, E., Mattsson, K., Compton, D. L., Nunez, L., Park, J. S., Stark, J. L., Gies, D. R. et al. (1995). Receptor tyrosine kinase specific for the skeletal muscle lineage: expression in embryonic muscle, at the neuromuscular junction, and after injury. Neuron 15, 573-584.[Medline]
Worman, H. J., Evans, C. D. and Blobel, G. (1990). The lamin B receptor of the nuclear envelope inner membrane: a polytopic protein with eight potential transmembrane domains. J. Cell Biol. 111, 1535-1542.
Yan, Y., Winograd, E., Viel, A., Cronin, T., Harrison, S. C. and Branton, D. (1993). Crystal structure of the repetitive segments of spectrin. Science 262, 2027-2030.
Ye, Q. and Worman, H. J. (1994). Primary structure analysis and lamin B and DNA binding of human LBR, an integral protein of the nuclear envelope inner membrane. J. Biol. Chem. 269, 11306-11311.
Zheng, R., Ghirlando, R., Lee, M. S., Mizuuchi, K., Krause, M. and Craigie, R. (2000). Barrier-to-autointegration factor (BAF) bridges DNA in a discrete, higher-order nucleoprotein complex. Proc. Natl. Acad. Sci. USA 97, 8997-9002.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
C. Ostlund, E. S. Folker, J. C. Choi, E. R. Gomes, G. G. Gundersen, and H. J. Worman Dynamics and molecular interactions of linker of nucleoskeleton and cytoskeleton (LINC) complex proteins J. Cell Sci., November 15, 2009; 122(22): 4099 - 4108. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Zhang, A. Felder, Y. Liu, L. T. Guo, S. Lange, N. D. Dalton, Y. Gu, K. L. Peterson, A. P. Mizisin, G. D. Shelton, et al. Nesprin 1 is critical for nuclear positioning and anchorage Hum. Mol. Genet., November 9, 2009; (2009) ddp499v2. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Attali, N. Warwar, A. Israel, I. Gurt, E. McNally, M. Puckelwartz, B. Glick, Y. Nevo, Z. Ben-Neriah, and J. Melki Mutation of SYNE-1, encoding an essential component of the nuclear lamina, is responsible for autosomal recessive arthrogryposis Hum. Mol. Genet., September 15, 2009; 18(18): 3462 - 3469. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Razafsky and D. Hodzic Bringing KASH under the SUN: the many faces of nucleo-cytoskeletal connections J. Cell Biol., August 24, 2009; 186(4): 461 - 472. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Starr A nuclear-envelope bridge positions nuclei and moves chromosomes J. Cell Sci., March 1, 2009; 122(5): 577 - 586. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Puckelwartz, E. Kessler, Y. Zhang, D. Hodzic, K. N. Randles, G. Morris, J. U. Earley, M. Hadhazy, J. M. Holaska, S. K. Mewborn, et al. Disruption of nesprin-1 produces an Emery Dreifuss muscular dystrophy-like phenotype in mice Hum. Mol. Genet., February 15, 2009; 18(4): 607 - 620. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Holaska Emerin and the Nuclear Lamina in Muscle and Cardiac Disease Circ. Res., July 3, 2008; 103(1): 16 - 23. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Luke, H. Zaim, I. Karakesisoglou, V. M. Jaeger, L. Sellin, W. Lu, M. Schneider, S. Neumann, A. Beijer, M. Munck, et al. Nesprin-2 Giant (NUANCE) maintains nuclear envelope architecture and composition in skin J. Cell Sci., June 1, 2008; 121(11): 1887 - 1898. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Zhang, C. Bethmann, N. F. Worth, J. D. Davies, C. Wasner, A. Feuer, C. D. Ragnauth, Q. Yi, J. A. Mellad, D. T. Warren, et al. Nesprin-1 and -2 are involved in the pathogenesis of Emery Dreifuss muscular dystrophy and are critical for nuclear envelope integrity Hum. Mol. Genet., December 1, 2007; 16(23): 2816 - 2833. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kandert, Y. Luke, T. Kleinhenz, S. Neumann, W. Lu, V. M. Jaeger, M. Munck, M. Wehnert, C. R. Muller, Z. Zhou, et al. Nesprin-2 giant safeguards nuclear envelope architecture in LMNA S143F progeria cells Hum. Mol. Genet., December 1, 2007; 16(23): 2944 - 2959. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. L. Stewart, K. J. Roux, and B. Burke Blurring the Boundary: The Nuclear Envelope Extends Its Reach Science, November 30, 2007; 318(5855): 1408 - 1412. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Liu, N. Pante, T. Misteli, M. Elsagga, M. Crisp, D. Hodzic, B. Burke, and K. J. Roux Functional association of Sun1 with nuclear pore complexes J. Cell Biol., August 27, 2007; 178(5): 785 - 798. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. B. Pestov, N. Ahmad, T. V. Korneenko, H. Zhao, R. Radkov, D. Schaer, S. Roy, S. Bibert, K. Geering, and N. N. Modyanov Evolution of Na,K-ATPase betam-subunit into a coregulator of transcription in placental mammals PNAS, July 3, 2007; 104(27): 11215 - 11220. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zhang, R. Xu, B. Zhu, X. Yang, X. Ding, S. Duan, T. Xu, Y. Zhuang, and M. Han Syne-1 and Syne-2 play crucial roles in myonuclear anchorage and motor neuron innervation Development, March 1, 2007; 134(5): 901 - 908. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Wilhelmsen, M. Ketema, H. Truong, and A. Sonnenberg KASH-domain proteins in nuclear migration, anchorage and other processes J. Cell Sci., December 15, 2006; 119(24): 5021 - 5029. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Haque, D. J. Lloyd, D. T. Smallwood, C. L. Dent, C. M. Shanahan, A. M. Fry, R. C. Trembath, and S. Shackleton SUN1 Interacts with Nuclear Lamin A and Cytoplasmic Nesprins To Provide a Physical Connection between the Nuclear Lamina and the Cytoskeleton Mol. Cell. Biol., May 15, 2006; 26(10): 3738 - 3751. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Zastrow, D. B. Flaherty, G. M. Benian, and K. L. Wilson Nuclear Titin interacts with A- and B-type lamins in vitro and in vivo J. Cell Sci., January 15, 2006; 119(2): 239 - 249. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Crisp, Q. Liu, K. Roux, J.B. Rattner, C. Shanahan, B. Burke, P. D. Stahl, and D. Hodzic Coupling of the nucleus and cytoplasm: role of the LINC complex J. Cell Biol., January 3, 2006; 172(1): 41 - 53. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Wilhelmsen, S. H.M. Litjens, I. Kuikman, N. Tshimbalanga, H. Janssen, I. van den Bout, K. Raymond, and A. Sonnenberg Nesprin-3, a novel outer nuclear membrane protein, associates with the cytoskeletal linker protein plectin J. Cell Biol., December 5, 2005; 171(5): 799 - 810. [Abstract] [Full Text] [PDF] |
||||
![]() |
V.C. Padmakumar, T. Libotte, W. Lu, H. Zaim, S. Abraham, A. A. Noegel, J. Gotzmann, R. Foisner, and I. Karakesisoglou The inner nuclear membrane protein Sun1 mediates the anchorage of Nesprin-2 to the nuclear envelope J. Cell Sci., August 1, 2005; 118(15): 3419 - 3430. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Libotte, H. Zaim, S. Abraham, V. C. Padmakumar, M. Schneider, W. Lu, M. Munck, C. Hutchison, M. Wehnert, B. Fahrenkrog, et al. Lamin A/C-dependent Localization of Nesprin-2, a Giant Scaffolder at the Nuclear Envelope Mol. Biol. Cell, July 1, 2005; 16(7): 3411 - 3424. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Ruegg Organization of synaptic myonuclei by Syne proteins and their role during the formation of the nerve-muscle synapse PNAS, April 19, 2005; 102(16): 5643 - 5644. [Full Text] [PDF] |
||||
![]() |
I. Mariappan and V. K. Parnaik Sequestration of pRb by Cyclin D3 Causes Intranuclear Reorganization of Lamin A/C during Muscle Cell Differentiation Mol. Biol. Cell, April 1, 2005; 16(4): 1948 - 1960. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Grady, D. A. Starr, G. L. Ackerman, J. R. Sanes, and M. Han From the Cover: Syne proteins anchor muscle nuclei at the neuromuscular junction PNAS, March 22, 2005; 102(12): 4359 - 4364. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. R. Croft, M. L. Coleman, S. Li, D. Robertson, T. Sullivan, C. L. Stewart, and M. F. Olson Actin-myosin-based contraction is responsible for apoptotic nuclear disintegration J. Cell Biol., January 17, 2005; 168(2): 245 - 255. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Vantyghem, P. Pigny, C. A. Maurage, N. Rouaix-Emery, T. Stojkovic, J. M. Cuisset, A. Millaire, O. Lascols, P. Vermersch, J. L. Wemeau, et al. Patients with Familial Partial Lipodystrophy of the Dunnigan Type Due to a LMNA R482W Mutation Show Muscular and Cardiac Abnormalities J. Clin. Endocrinol. Metab., November 1, 2004; 89(11): 5337 - 5346. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Zhao, N. B. Pestov, T. V. Korneenko, M. I. Shakhparonov, and N. N. Modyanov Accumulation of {beta}m, a structural member of X,K-ATPase {beta}-subunit family, in nuclear envelopes of perinatal myocytes Am J Physiol Cell Physiol, April 1, 2004; 286(4): C757 - C767. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Zastrow, S. Vlcek, and K. L. Wilson Proteins that bind A-type lamins: integrating isolated clues J. Cell Sci., March 1, 2004; 117(7): 979 - 987. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Fan and K. A. Beck A role for the spectrin superfamily member Syne-1 and kinesin II in cytokinesis J. Cell Sci., February 1, 2004; 117(4): 619 - 629. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Starr and M. Han ANChors away: an actin based mechanism of nuclear positioning J. Cell Sci., January 15, 2003; 116(2): 211 - 216. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. A. Starr and M. Han Role of ANC-1 in Tethering Nuclei to the Actin Cytoskeleton Science, October 11, 2002; 298(5592): 406 - 409. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||