|
|
![]() |
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
Research Article |

1 Department of Cell Biology and Genetics, Erasmus University, Rotterdam,
Netherlands
2 Centre for Genome Research, University of Edinburgh, Edinburgh, UK
3 Department of Hematology, Erasmus University, Rotterdam, Netherlands
4 Amgen, Thousand Oaks, CA, USA
* These authors contributed equally to this work
Author for correspondence (e-mail:
dzierzak{at}ch1.fgg.eur.nl
)
Accepted 12 March 2002
| Summary |
|---|
|
|
|---|
Key words: Stroma, Hematopoiesis, AGM, Development, tsA58 transgene
| Introduction |
|---|
|
|
|---|
The generation of many of the stromal cell lines used in hematopoietic
studies has relied on the expression of the SV40 Tag immortalizing
gene (Jat and Sharp, 1986
).
The conditionally active form (a thermolabile form that is active at 33°C)
encoded by the tsA58 gene
(Tegtmeyer, 1975
) has been
routinely used to overcome the alteration of functional or differentiation
properties sometimes associated with introduction of the SV40 Tag
gene into the target cells. Most often, the tsA58 gene has been
introduced into cells via retrovirus-mediated transduction
(Jat et al., 1986
), requiring
the cells of interest to divide ex vivo to achieve the integration and
expression of proviral sequences. Central to the use of cell lines in the
study of cellular differentiation and development is the assumption that they
are representative of cells that function within the normal cellular
physiology of the organism (Ridley et al.,
1988
). Hence, to alleviate extensive cultivation of target cells
before the onset of immortalizing gene expression, transgenic mice expressing
the tsA58 gene have been generated.
The `Immortomouse' (Jat et al.,
1991
), a transgenic mouse strain expressing the tsA58
gene under the transcriptional control of the H-2K promoter, has been used for
the isolation of cells from many different tissues including thymus
(Jat et al., 1991
), colon and
small intestine (Whitehead et al.,
1993
), gonads (Capel et al.,
1996
), skeletal muscle (Morgan
et al., 1994
) and smooth muscle
(Ehler et al., 1995
). To
promote high levels of of tsA58 expression, interferon-
is
added during the cultivation of transgenic cells. As interferons are general
activating agents and numerous investigators have demonstrated the deleterious
effects of interferon-
on hematopoiesis
(Gajewski et al., 1988
;
Klimpel et al., 1982
;
Sato et al., 1995
;
Selleri et al., 1995
;
Selleri et al., 1996
), the
addition of this cytokine may influence the outcome and impose a bias on the
cells isolated from the hematopoietic microenvironment of the `Immortomouse'.
Hence, other transgenic mice using the SV40 transcriptional elements to direct
widespread expression of the temperature-sensitive Tag gene
(Yanai et al., 1991
) have been
generated. However, these founder chimeric transgenic mice were not bred but
were used only to make primary cell lines and thus are not available for the
isolation of new cell lines.
We were interested in more specifically and directly isolating hematopoietic-supportive stromal cell lines from the in vivo hematopoietic microenvironments present in the midgestation embryo. This led us to generate our own transgenic mouse lines, ß-actin-tsA58 and PGK-tsA58, which express the thermolabile form of the SV40 Tag gene in a constitutive and ubiquitous manner. Here we present data on the isolation of over a hundred stromal cell lines from embryonic hematopoietic microenvironments. We show that expression of the tsA58 transgene generally leads to the more rapid and efficient isolation of hematopoietic stromal cell populations and clones from embryonic tissues. Furthermore, these stromal cell lines are effective but heterogenous in human hematopoietic progenitor cell support. For the individual stromal clones, the hematopoietic gene expression profiles of growth factor and interleukin genes are complex, showing no obvious pattern consistent with support. However, a small subset shows high levels of transcription of the chordin-like protein gene, the protein of which is known to be a potent inhibitor of bone morphogenic proteins. Taken together, we show that stromal cells isolated from the various hematopoietic sites within tsA58 transgenic mouse embryos can be effective supporters of hematopoiesis.
| Materials and Methods |
|---|
|
|
|---|
The HindIII-BglII fragment of the PGK promoter containing plasmid pPGKneob (from Austin Smith, CGR, Edinburgh, UK) was cloned into the EcoRV-BamHI fragment of SK-. This plasmid was digested with ClaI followed by blunting and SalI digestion, and the tsA58 gene (purified after BglI and ScaI digestion, blunting, and BamHI digestion of PucSV40/tsA58) was cloned downstream of the PGK promoter. The fragment of p(P+T+S) used for injection into mouse oocytes was gel purified after digestion with BglII, BamHI and ScaI.
Mice
Mouse (CBAxC57BL/10)F1 oocytes were microinjected with 5
ng/ml of DNA, cultured overnight and implanted into pseudopregnant females as
previously described (Miles et al.,
1997
). Founder mice and offspring were bred with
(CBAxC57BL/10)F1 mice. Hence, the isolated stromal cell lines
were on a (CBAxC57BL/10)F1 outbred background. Animals were
housed according to institutional guidelines, and procedures were carried out
in compliance with the Standards for Humane Care and Use of Laboratory
Animals.
Transgene and expression analysis
Transgenic mice were genotyped by PCR analysis of tail DNA. PCR primer
sequences are tsA58(S) 5'-tca acc tga ctt tgg agg ctt
ctg-3' and tsA58(AS) 5'- gtc aca cca cag aag taa ggt
tcc-3'. PCR reactions were performed at 1 cycle of 94°C for 4
minutes, 25 cycles of 94°C for 1 minute, 60°C for 2 minutes, 72°C
for 2 minutes and 1 cycle of 72°C for 10 minutes (resultant fragment is
277bp).
RNA was isolated from adult transgenic tissues using lithium chloride
method (Fraser et al., 1990
).
cDNA was generated with Superscript II reverse transcriptase (Gibco BRL/Life
Technologies, Breda, NL) and RT-PCR was performed using primers spanning the
SV40 large T antigen intron to yield a specific 372 bp fragment (genomic DNA
fragment is 720 bp). The primer sequences were: SV40Tag(S) 5'
gag ttt cat cct gat aaa gga gg 3' and SV40Tag(AS) 5' gtg
gtg taa ata gca aag caa gc 3'. PCR reactions were performed at 1 cycle
of 92°C for 5 minutes, 35 cycles of 92°C for 30 seconds, 60°C for
45 seconds, 72°C for 1 minute and 1 cycle of 72°C for 10 minutes. The
GAPDH RT-PCR primers were gapdh-s 5' ctt cac cac cat gga gaa gg 3'
and gapdh-1 5' cca ccc tgt tgc tgt agc c 3' (product 670 bp).
Reactions were performed at 1 cycle of 92°C for 5 minutes, 30 cycles of
92°C for 1 minute, 60°C for 2 minutes, 72°C for 2 minutes and 1
cycle of 72°C for 10 minutes.
Isolation of stromal lines and clones
AGM, embryonic liver (EL) and gastrointestinal region (gut and mesentery;
GI) cells were obtained from Tag5 (8 E11), Tag11 (7 E11 and
12 E10) and control BL1b (35 E11) transgenic embryos
(Dzierzak and de Bruijn, 2002
;
Medvinsky and Dzierzak, 1996
)
(Fig. 1C). The AGM region was
subdissected using 27G needles into the aorta, with surrounding mesenchymal
tissue (AM), and the urogenital ridges, containing the pro/mesonephros and the
gonads (UG) (de Bruijn et al.,
2000a
; de Bruijn et al.,
2000b
). Subdissected tissues from litters with at least seven
embryos were pooled and either explant cultured at the air-medium interface on
0.1% gelatin-coated 6-well plates (Costar, Badhoevedorp, NL) or cultured as a
single cell suspension (after a 15 minute incubation with 0.25% trypsin and
vigorous pipetting) on 0.1% gelatin-coated 6-well plates in stromal medium:
50% long-term culture medium (M5300, StemCell Technologies, Vancouver, BC,
Canada), 15% FCS, 35% AlphaMEM, supplemented with antibiotics (penicillin and
streptomycin; Gibco), Glutamax-I (Gibco) and 10 µM ß-mercaptothanol
(Merck Eurolab, Darmstadt, Germany). After 4 to 5 days, supernatants were
collected and adherent tissues/cells harvested by brief 0.25% trypsin exposure
and cultured on new dishes at a density of 5x104
cells/cm2. Cultures were supplemented with 10-20% 0.2
µm-filtered supernatant from the previous passage each week until cell
numbers increased consistently. Cells were then cloned at a density of one
cell per well in 0.1% gelatin-coated 24-well plates. After 2-3 weeks clones
were harvested and expanded.
|
Previously described stromal cell lines were used as controls for various
assays: AFT024 from K. Moore (Princeton U., USA)
(Moore et al., 1997a
), S17
from Rudi Hendriks (Dept. of Immunology, Erasmus U., Rotterdam, NL)
(Collins and Dorshkind, 1987
)
and MS-5 from Laure Coulombel (INSERM U474, Paris, France)
(Itoh et al., 1989
). FBMD-1
cells were cultured as described previously
(Breems et al., 1994
).
Production of conditioned media
Stromal cells were grown to confluence in stromal medium. One day after
reaching confluence, the supernatant was collected. This conditioned medium
was further centrifuged for 7 minutes at 1,600 g to remove the
remaining cells and debris, filtered through 0.2 µm filters (Schleicher and
Schüll, Dassel, Germany) and stored at 4°C until use.
Colony forming culture analysis
The number of murine colony-forming progenitors [colony forming culture
(CFC): total of erythroid burst-forming units (BFU-E),
granulocyte-erythroid-macrophage-megakaryocyte colony-forming units (CFU-GEMM)
and granulocyte-macrophage colony-forming units (CFU-GM)] was determined by
plating aliquots of BM cells in methylcellulose medium supplemented with
pokeweed mitogenstimulated spleen cell-conditioned medium (PWM-SCM) and human
erythropoietin (hu-EPO, 3 U/ml, M3430, StemCell Technologies). To investigate
the growth-stimulating properties of conditioned media, BM cells were plated
in methylcellulose medium with hu-EPO (M3334, StemCell Technologies)
additionally supplemented with 0.22 µm-filtered conditioned medium
harvested from confluent stromal cell cultures. Human CFC were assayed using
1.2% methylcellulose in IMDM supplemented with 30% FCS, ß-mercaptoethanol
(10-4 M), penicillin (100 U/ml), streptomycin (0.1 mg/ml), hu-EPO
(1 U/ml), hu-IL3 (20 ng/ml), hu-GM-CSF (5 ng/ml), hu-G-CSF (50 ng/ml) and
mu-SCF (100 ng/ml). Duplicate cultures were plated in 35 mm dishes (BD-Falcon)
and incubated at 37°C, 10% CO2 in a humidified atmosphere for
14 days. Colonies containing more than 50 cells were scored at 10-12 days
(murine CFC) or at day 14-18 (human CFC) by inverted light microscopy.
RT-PCR expression analysis
The following murine RT-PCR primer sets were used: TPO (S):
tgatggcagcacgaggacagttggaa; TPO (AS): gtgaggttccagcaaagagcccatg; SCF (S):
gattccagagtcagtgtcac; SCF (AS): ctggacacatgttcttgtcc; FL (S):
aaagaaaaactcgagatgacagtgctggcgccagcc; FL (AS):
tttgactttttaattaattactgcctgggccgaggctctgg; G-CSF (S):
gacggctcgccttgctctgcacca; G-CSF (AS): acctggctgccactgtttctttagg; CHL-S (S):
gtcatcaataacaagcacaaac; CHL-S (AS): ggagatagaggttagatagtag; CHL-L (S):
gtggagaagaaaccatgcctg; CHL-L (AS): atgtgctctataaccacctgac; ß-actin (S):
gtgggaattcgtcagaaggactcctatgtg; ß-actin (AS): gaagtctagagcaacatagcacagc;
IL-1ß (S): cctgtgtaatgaaagacggc; IL-1ß (AS): ggagattgagctgtctgctc;
IL-3 (S): gatacccaccgtttaaccagaacgttg; IL-3 (AS): tccacggttaggagagacggag; IL-6
(S): gacttcacagaggataccac; IL-6 (AS): ctccagcttatctgttaggag; IL-11 (S):
agatctggacagcgctgttctctcctaa; IL-11 (AS): agtcgagtctttaacaacagcaggcc; LIF (S):
cgtggagtccagtgtcttgc; LIF (AS): accgcttcttcctatcacac; OSM (S):
gggtctgatgacacaagctg; OSM (AS): acagagaacgctgacattcg; TGF-ß1 (S):
cacagagaagaactgctgtg; TGF-ß1 (AS): aggagcgcacaatcatgttgg. RNA made from
confluent layers of irradiated (30 Gy) stromal cell clones was used for the
RT-PCR analysis. 1 µg of total RNA (isolated by the Trizol method) per
reaction was used with a kit from Qiagen (Leusden, NL, OneStep RT-PCR Kit cat#
210212). The conditions used for TPO RT-PCR were 50°C for 30 minutes,
95°C for 15 minutes followed by 33 cycles at 94°C for 30 seconds and
72°C for 70 seconds and a final step at 72°C for 10 minutes (with Q
buffer). For CHL-S and CHL-L RT-PCR, the conditions were 50°C for 30
minutes, 95°C for 15 minutes followed by 35 cycles at 94°C for 30
seconds, 60°C for 30 seconds and 72°C for 40 seconds with a final step
at 72°C for 10 minutes (with Q buffer). For SCL, FLK-2L and G-CSF RT-PCR,
the conditions were 50°C for 30 minutes, 95°C for 15 minutes followed
by 33 cycles at 94°C for 30 seconds, 65°C for 30 seconds and 72°C
for 40 seconds with a final cycle at 72°C for 10 minutes (no Q-buffer).
The conditions for IL-1, -6 and -11 were 95°C for 5 minutes followed by 35
cycles at 95°C for 1 minute, 56°C for 1 minute and 72°C for 2
minutes with a final cycle at 72°C for 7 minutes; and for IL-3, OSM, LIF
and TGF-ß1, the conditions were 92°C for 5 minutes followed by 30
cycles at 92°C for 45 seconds, 45°C for 58 seconds and 72°C for 1
minute with a final cycle at 72°C for 7 minutes.
Phenotypic surface analysis of stromal cells
Irradiated (30 Gy) stromal cells were surface phenotyped by FACS analysis.
Antibodies used for FACS analysis were anti-FL and SCF (R&D Systems,
Abingdon, UK) and anti-Flk-2/Flt-3 and IL-6R
and Sca-1 (BD-Pharmingen,
Heidelberg, Germany). Briefly, stromal cells were irradiated (30 Gy) and grown
for 2 weeks under LTC-CFC assay conditions without cytokines. Cells were
trypsinized, washed, stained and analyzed on a FACScan (BD-Biosciences,
Erembodegem, Belgium).
Extended long-term cultures of human cord blood cells on the stromal
clones
Human cord blood (CB) cells were obtained from term pregnancies with
informed consent. The cells were layered upon Ficoll-Paque (density d=1.077
g/ml) and spun for 20 minutes at 600 g, and interface cells were
positively selected for the expression of CD34 using the CD34 Isolation Kit
(Miltenyi Biotec, Bergisch Gladbach, Germany). The purity of the CD34-selected
CB cells was 90±3%.
Stromal clones were grown to confluence in 25 cm2 flasks and irradiated at 30 Gy with a 137Cs source. 1 or 2x104 CD34+ CB cells were seeded and cultured in long-term culture (LTC) medium (IMDM, 20% FCS, penicillin (100 U/ml), streptomycin (0.1 mg/ml), ß-mercaptoethanol (10-4 M, Merck), cholesterol (15 µM, Sigma, Zwijndrecht, NL), linolic acid (15 µM Merck), iron-saturated human transferrin (0.62 g/l, Intergen, Uithoorn, NL), nucleic acids (cytidine, adenosine, uridine, guanosine, deoxyribonuclei 2'-deoxycytidine, 2'-deoxyadenosine, thymidine, 2'-deoxyguanosine, all at 10-3 g/ml, Sigma). Initially, cells were deposited on stromal layers without cytokine supplements. However, since most stromal clones failed to support extended long-term cultures, the cultures were further supplemented by addition of thrombopoietin (TPO, 10 ng/ml, Genentech, South San Fransisco, CA, USA). Flask cultures of each group were set up in duplicate and maintained at 33°C and 10% CO2 for 12 weeks with weekly half medium changes and the consequent removal of half of the non-adherent cells. At weeks 7/8 or 12 the total cell cultures were assayed for the level of CFC.
| Results |
|---|
|
|
|---|
Establishment of stromal cell lines from tsA58 transgenic mouse
embryos
Embryos were generated from Tag5 and Tag11 transgenic lines and also from a
control transgenic strain of mice so that we could evaluate the effects of the
tsA58 gene in the isolation of stromal cell lines. We used the BL1b
transgenic line as the control [Miles et
al., 1997
); Ly-6E (Sca-1) lacZ transgene on
(C57BL/10xCBA) outbred background], as Sca-1 is known to be expressed on
most stromal lines (Montecino-Rodriguez et
al., 1994
). AGM regions, embryonic livers (EL), gastrointestinal
tracts (GI; gut and mesentery) and yolk sacs were dissected at embryonic days
10 and 11 (E10 and E11) (Fig.
1C). Previously, it has been suggested that at these times during
midgestation there may be differences in the HSC generation and supportive
capacities of the aorta and surrounding mesenchyme when compared with the
gonads and mesonephros (de Bruijn et al.,
2000b
). Thus, AGMs were subdissected into the aorta-mesenchyme
(AM) and the gonadmesonephros (urogenital ridges, UG)
(Fig. 1C) to examine whether
functional distinctions could be identified in stromal cells isolated from
these subregions.
Tissues were initially cultured at the air-medium interphase at 33°C on
gelatin-coated culture plates containing 250 µl of stroma medium, as
previously these conditions provided efficient growth of HSCs in AGM explants
(Medvinsky and Dzierzak,
1996
). Following one day of culture, adherent cells were seen
growing out of the explants. After 4 to 5 days of culture, culture
supernatants were harvested and the adherent cells trypsinized and passaged at
densities of 1-3x104/cm2 usually in the presence
of 20% conditioned medium from the previous passage. In this manner, more than
28 cultures were established and grown for several months. At E11, the Tag11
line yielded one starting cell line per 1.4 embryos, and the Tag5 line yielded
one starting cell line per 1.6 embryos. This is in contrast to the BL1b
control transgenics, which yielded one starting cell line for every three
embryos. Thus, the tsA58 transgene enhances the initial in vitro
establishment of cell populations from the midgestational hematopoietic
sites.
Stromal cell line growth and cloning efficiency correlates with the
presence of the tsA58 transgene
The number of cells in the different cultures was monitored at each passage
so as to determine the effect of the tsA58 transgene on growth rates.
Cells were passaged once a week or earlier in cases when cells were more than
90% confluent. As shown in Fig.
2, most cell populations, after the first 2 to 3 weeks of culture,
regardless of whether the tsA58 transgene was present or not,
underwent a crisis in which the absolute cell number decreased. This decrease
persisted in the control BL1b AM-derived cultures for approximately 6-8 weeks
and approximately 10 weeks in the BL1b UG-, EL- and GI-derived cultures.
Thereafter, cell numbers began to increase and henceforth, all post-crisis
cell populations are referred to as stromal cell lines. Interestingly,
increases in cell number were observed earlier for all cell lines derived from
tsA58 transgenic embryos and in particular from the EL
(Fig. 2C). (The increase
occurred up to 8 weeks earlier in tsA58 EL than in BL1b EL.) In
contrast, the control BL1b AM-derived cells increased their growth after 6
weeks, almost simultaneously with the increase in tsA58 AM cells,
suggesting little or minor affects by the immortalizing gene in this tissue
(Fig. 2A). Taken together,
these data demonstrate that, with the exception of the AM, the tsA58
transgene enhances the early expansion of midgestational stage embryo-derived
cell populations.
|
When the stromal cell lines showed a consistent increase in absolute cell number for more than two passages, cloning was performed at a density of one cell per well on gelatincoated plates in the presence of 30% conditioned medium from the parental cell line. This corresponded to a time of 7 to 10 weeks after initiation of the cultures for the tsA58 transgenic tissues and between 9 to 14 weeks after initiation of the BL1b-derived tissues. In this manner, we generated 32 AM-derived clones, 27 UG-derived clones, 18 EL-derived clones, 4 GI-derived clones, as well as 12 clones from whole AGM regions (Fig. 1C). Although a large number of clones were derived from tsA58 cell lines, several were obtained from the BL1b cell lines. The cloning efficiencies of cells orginating from each transgenic line are 3.5% for BL1b, 9% for Tag5 and 13-15% for Tag11. These results demonstrate that the tsA58 transgene not only increases the growth rate but also the cloning efficiencies of stromal cells from the midgestation embryo.
Conditioned medium from stromal cell lines promotes the
differentiation and growth of hematopoietic colonies
Since the stromal cell lines were isolated from several midgestational
hematopoietic sites and each site is known to harbor functionally different
but some overlapping sets of hematopoietic cells, it was of interest to first
examine which lines produced hematopoietic growth factors. Cell line
supernatants were harvested and tested for CFC-promoting activity on adult BM
cells in methylcellulose cultures. As shown in
Table 1, all the tested stromal
cell lines from the AM, UG and EL produced conditioned medium capable of
supporting the differentiated growth of CFCs. On average, the AM-derived lines
stimulated 48.2 CFC/104 BM cells (n=5), UG-derived lines
stimulated 49.8 CFC/104 BM cells (n=3) and EL-derived
lines stimulated 44.0 CFC/104 BM cells (n=5). No
correlation was observed between activity and tissue origin or the presence of
the tsA58 transgene. Also, the activity in the supernatants of these
stromal cell lines was similar to supernatants isolated from other previously
published stromal clones: AFT024 [E14.5 EL-derived
(Moore et al., 1997a
)]
stimulated 35.8 CFC/104 BM cells, FBMD-1 [adult BM-derived
(Breems et al., 1994
)]
stimulated 37.5 CFC/104 BM cells and S17 [adult BM-derived
(Collins and Dorshkind, 1987
)]
stimulated 46.8 CFC/104 BM cells.
|
In addition, conditioned media obtained from stromal clones was measured using the CFC assay (Table 2). All tested stromal clones produced conditioned medium with a similar level of activity to the starting stromal lines. With the exception of one AM-derived line and clone, none of the stromal lines or clones surpassed the number of CFCs yielded by the PWM-SCM control. The AM20 line and its derived clone AM20-1A4 consistently produced the highest numbers of CFCs (72.3 and 83.5 CFC/104 BM cells, respectively) and yielded 90.9-105.5% and 114.0% activity (respectively) of the PWM-SCM control, suggesting that these cells elaborate an abundance of hematopoietic growth factors. The AM20 and AM20-1A4 supernatants also promoted outgrowth of the different types of CFC (BFU-E, GEMM-CFC and GM-CFC), comparable to PWM-SCM (data not shown). In contrast to the other stromal cells derived from E11 tissues, the AM20 line was derived from an E10 AM subregion. Thus, despite the visible absence of hematopoietic differentiation in vivo in the E10 and E11 AGM region, AGM-derived stromal cells are able to produce conditioned medium that support the in vitro growth of BM-derived CFCs.
|
Stromal support for primitive progenitor cells in human extended
long-term co-cultures
To examine the ability of embryonic stromal clones to support the sustained
generation of primitive hematopoietic progenitors, we tested the CFC
production from human CD34+ cord blood cells co-cultured for 7 or 8 (7/8) and
12 days with irradiated stromal clones. Pilot experiments demonstrated that in
the absence of growth factors, neither the clones nor FBMD-1 or AFT024 control
cells supported sustained CFC or cobblestone-area-forming cell production
(data not shown). (N.K., R.A.J.O. and W. J. L. M. Koevoet et al.,
unpublished). In the presence of TPO, several embryonic stromal clones
(AM06-2C4, AM20-1B4, UG15-1B7, UG26-2D3 and EL23-1C2) still failed to support
sustained progenitor production (Table
3). However, UG26-1B4, UG26-3D4, AM30-2A4, AM30-3A3 and AM30-3F4
maintained the number of hematopoietic progenitors in the adherent compartment
(an expansion between half- and threefold). Several other clones (AM30-1C6,
UG26-1B6, GI09-2E6 and GI29-2B4) supported a net expansion of CFC comparable
to the control cells. FBMD-1 and AFT024 showed a fourfold and twofold
expansion after 7/8 and 12 weeks, respectively. Interestingly, EL08-1D2
supported a tremendous expansion of hematopoietic progenitors in the adherent
layer of more than 9- and 12-fold under similar conditions at weeks 7/8 and 12
after culture, respectively (Table
3). Thus, stromal clones from several different murine embryonic
sites support human hematopoiesis.
|
Characterization of stromal clones for growth factor mRNA
expression
Since several of the embryonic stromal clones were capable of supporting
the in vitro hematopoietic differentiation of human progenitors and the
maintenance of murine stem cells
(Oostendorp et al., 2002
), we
tested and compared the relative levels of expression of growth factors
thought to be important in hematopoiesis using RT-PCR. We also measured the
expression of the recently described chordin-like protein (CHL) in the short
and long forms (-S and -L), which are inhibitors of bone morphogenetic
proteins and are preferentially expressed in mesenchymal cells
(Nakayama et al., 2001
).
In the first experiments, mRNA isolated from 22 stromal (non-irradiated) clones was analysed for the expression of thrombopoietin (TPO), stem cell factor (SCF), Flk-2 ligand (FL), granulocyte-colony stimulating factor (G-CSF) and CHL-S and -L genes in a semi-quantitative manner. As shown in Table 4, most of the stromal clones expressed TPO, SCF and G-CSF mRNA to varying levels. TPO and SCF were expressed from high to intermediate levels in 14/22 and 17/22 of the clones, respectively. G-CSF was expressed predominantly at intermediate levels (12/22 of the clones). In contrast, the Flk-2 ligand was expressed only at a low level in 14/22 of the clones. For comparison, in adult marrow-derived stromal cell lines (FBMD-1, M2-10B4, and MS-5), the expression of TPO, SCF, G-CSF and FL was high. But, all in all, no overall consistent pattern of expression was observed for this panel of molecules within the stromal clones tested. However, a restricted high-level expression (both forms) of the CHL gene was observed in 4/22 of the stromal clones tested. A further three clones expressed CHL to intermediate levels and 13 clones expressed no CHL-S and only low level or no expression of CHL-L. The expression patterns do not correlate with derivation from a specific embryonic day, tissue or transgenic line. The three marrow-derived lines all expressed the long form of CHL, but the short form was only observed in FBMD-1.
|
Additionally, we examined 15 embryonic stromal clones for their expression of growth factors IL-1, -3, -6, -11, LIF, Oncostatin M and TGF-ß1 by RT-PCR after irradiation (since the clones were irradiated in the hematopoietic support experiments). As shown in Table 4, varying expression patterns were observed. Consistently, we found that the stromal clones did not express detectable levels of IL-3 and Oncostatin M (OSM) transcripts, even though cDNA controls (WEHI 3 for IL-3 and fetal liver for OSM) were strongly positive. IL-1, IL-11 and LIF expression was found in only a few of the clones, whereas most of the stromal clones expressed IL-6 and TGF-ß1. Taken together with CFC data, no correlation can be found between expression patterns and supernatants promoting hematopoietic growth. Thus, the clones tested exhibit a heterogeneous pattern of growth factor expression on the mRNA level.
Surface phenotype of stromal cells
FACS analysis was performed on a small number of irradiated stromal clones
(chosen for their ability to support sustained CFC production) and the
control, FBMD-1, to determine whether some growth factors and growth factor
receptor proteins were produced and elaborated on the cell surface. As in the
co-cultures, the lines were irradiated and grown in LTC medium. FACS analysis
revealed SCF expression at low levels on the surface of one of the clones,
AM20-1B4 (Table 5). Only
GI29-2B4 was found to express the FL. None of the clones expressed the Flk-2
receptor tyrosine kinase. However, IL-6R
expression was found on six
out of six of the tested clones. In addition, all of the lines, including
FBMD-1, strongly expressed the Sca-1 antigen, a marker expressed on all
supportive stromal cell lines
(Rémy-Martin et al.,
1999
). Taken together, these limited protein expression data do
not correlate with site of origin of the stromal clone or the presence of the
tsA58 transgene and support the notion that the isolated stromal
clones are heterogeneous.
|
| Discussion |
|---|
|
|
|---|
In the numerous fertilized mouse eggs microinjected with ß-actin- and PGK-tsA58 constructs, we found a low frequency of transgenesis. Although it is clear that construct preparation, the quality of the eggs and the injection procedure play an important role in the success of transgenesis, we were able to produce only four transgenic founders. One founder did not pass the transgene through the germline, and one had severe eye and skeletal problems. Thus, the tsA58 protein may have some debilitating effects in vivo both at developmental and adult stages. It is possible that areas of lower temperature (i.e. testis, long bones) could promote activation of the T antigen protein and result in abnormal cell function. Additionally, alterations in expression levels caused by the site of transgene integration and/or the specific sites of T antigen protein production may play a role in such abnormalities. The result that only low copy numbers were found in the two established transgenic lines, together with the low efficiency of transgenic founder generation, strongly suggests that high copy number/high expression levels are prohibitive for viability.
The presence of the tsA58 gene leads to more efficient
stromal cell line and clone isolation from embryonic tissues, except for the
aorta-mesenchyme
We have demonstrated that the use of ß-actin and
PGK-tsA58 transgenic mice was instrumental in the efficient isolation
of so many lines from early midgestation embryos. By direct comparison, twice
as many lines were isolated from the tsA58 transgenic embryos than
from the control lacZ transgenic embryos. Furthermore, the presence
of the tsA58 gene allowed for a three- to four-fold greater cloning
efficiency compared with control lacZ marker transgenics. Although
the limiting dilution culture step assured us that our stromal cells were
clonal (yielding morphologically divergent clones as compared with the initial
lines), in some cases the initial lines may already have been clonal.
Although the tsA58 gene had an enhancing effect on the growth of EL-, UG- and GI-derived cell lines, it did not affect the growth of AM-derived lines. What is most intriguing is that this subregion undergoes such a short crisis phase, followed by rapid growth. The cells from the AM may be already undergoing such a high rate of proliferation that their growth could not be further increased by tsA58. Our preliminary data with in vivo BrdU labeling of embryos suggests that the cells of the AM are undergoing rapid proliferation (E.D., unpublished). Thus, with an interest in understanding the generation and expansion of the hematopoietic system in the AGM region, the molecular basis of the high proliferation rate of AM-derived cells will be further examined.
Most embryonic stromal cell lines and clones express hematopoietic
growth factors
By analyzing the supernatants of the stromal cell lines, we were able to
determine that all the isolated cell lines and clones do have
hematopoiesis-promoting activity, with the E10 AM-derived line AM20 producing
the most effective conditioned medium. RNA and/or FACS analysis revealed that
most of the stromal clones tested expressed a panel of hematopoietic growth
factors. All of our clones were positive for SCF transcripts. However, FACS
analysis showed detectable SCF protein on only one out of the six clones
tested, suggesting that the majority of clones secrete SCF, which is known to
be important for the migration, proliferation and/or differentiation of early
hematopoietic progenitors. And although most of the clones expressed TPO RNA,
we found no surface-bound TPO (data not shown), suggesting that a secreted
form may provide support for HSCs, which are known to express c-mpl, the
receptor for TPO (McKinstry et al.,
1997
). Future studies will test for support of HSCs by our stromal
clones in non-contact cultures. Similar to the previously published AGM
stromal clones (Ohneda et al.,
1998
; Xu et al.,
1998
), our clones exhibited variable expression of IL-11 and LIF,
low expression of IL-1 and no expression of IL-3 and OSM. Contrasting with the
three published AGM stromal clones (Ohneda
et al., 1998
; Xu et al.,
1998
), most of our stromal clones were positive for G-CSF RNA.
Finally, the expression patterns of TGF-ß1 and CHL in our stromal clones
are the most intriguing. TGF-ß1 was thought to have a strong negative
influence on the growth of HSCs. Surprisingly, we found high levels of
TGF-ß1 expression in most of our stromal clones, even in the supportive
clones. However, in some of the clones we also found expression of the
CHL gene (both forms). The CHL protein is thought to inhibit the
negative effects of BMP-4 and TGFß molecules on hematopoietic cells
(Nakayama et al., 2001
).
Hence, the appropriate balanced expression of these molecules in the stromal
clones may be important for hematopoietic-supportive properties, and future
experiments should examine such interactions.
Stromal clones supporting human hematopoietic progenitors express
most hematopoietic growth factors
In functional studies examining the long-term support of human
hematopoietic progenitors, we found a few stromal clones from each of the
embryonic hematopoietic subregions to be highly active: AM-derived AM30-1C6
and AM30-3F4, urogenital-ridge-derived UG26-1B4 and UG26-1B6,
gastrointestine-derived GI09-2E6 and GI29-2B4 and the embryonic liver-derived
EL-08-1D2, which is the best, supporting three- to five-fold expansion of CFC
production in 12 week cultures supplemented with FL and/or TPO
(Table 3). In related studies
characterizing the stromal cell support for murine progenitors and HSCs
(Oostendorp et al., 2002
), we
found that most of these clones also support the long-term maintenance of
adult BM-enriched murine HSCs and that the second best supporter of human CFC
production, UG26-1B6, is best at maintaining murine HSC activity
(Oostendorp et al., 2002
).
Interestingly, five out of the seven clones listed above express both forms of
the CHL gene. Thus, when compared against the expression profiles,
there appears to be a correlation between widespread, high-level growth
factor/CHL transcription and long-term support for human and mouse
hematopoietic progenitors.
In conclusion, the Tag5 and Tag11 transgenic lines of mice have been instrumental in the isolation of numerous hematopoietic stromal cells to further our studies of the midgestational hematopoietic microenvironment. We have shown here that these each of the subregions yields hematopoietic supportive stromal clones and that they transcribe an abundance of hematopoietic growth factors. A general trend in expression profiles suggests that widespread, high level transcription of at least some of these factors is necessary for hematopoietic support. In future studies these stromal clones will serve as the basis for comparative microarray screening to further evaluate the complex panel of genes necessary for the growth and maintenance of hematopoietic progenitors.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Baum, C. M., Weissman, I. L., Tsukamoto, A. S., Buckle, A. M.
and Peault, B. (1992). Isolation of a candidate human
hematopoietic stem-cell population. Proc. Natl. Acad. Sci.
USA 89,2804
-2808.
Breems, D. A., Blokland, E. A., Neben, S. and Ploemacher, R. E. (1994). Frequency analysis of human primitive haematopoietic stem cell subsets using a cobblestone area forming cell assay. Leukemia 8,1095 -1104.[Medline]
Capel, B., Hawkins, J. R., Hirst, E., Kioussis, D. and Lovell-Badge, R. (1996). Establishment and characterization of conditionally immortalized cells from the mouse urogenital ridge. J. Cell Sci. 109,899 -909.[Abstract]
Collins, L. S. and Dorshkind, K. (1987). A
stromal cell line from myeloid long-term bone marrow cultures can support
myelopoiesis and B lymphopoiesis. J. Immunol.
138,1082
-1087.
de Bruijn, M., Peeters, M., Luteijn, T., Visser, P., Speck, N.
and Dzierzak, E. (2000a). CFU-S11 activity does
not localize solely with the aorta in the AGM region.
Blood 96,2902
-2904.
de Bruijn, M. R. T. R., Speck, N. A., Peeters, M. C. E. and Dzierzak, E. (2000b). Definitive hematopoietic stem cells first emerge from the major arterial regions of the mouse embryo. EMBO J 19,2465 -2474.[Medline]
Deryugina, E. I., Ratnikov, B. I., Bourdon, M. A. and Muller-Sieburg, C. E. (1994). Clonal analysis of primary marrow stroma: functional homogeneity in support of lymphoid and myeloid cell lines and identification of positive and negative regulators. Exp. Hematol. 22,910 -918.[Medline]
Dzierzak, E. and de Bruijn, M. (2002). Isolation and analysis of hematopoietic stem cells from mouse embryos. In Methods in Molecular Medicine: Hematopoietic Stem Cell Protocols (ed. C. Klug and C. Jordan), pp.1 -14. Totowa: The Humana Press Inc.
Dzierzak, E., Medvinsky, A. and de Bruijn, M. (1998). Qualitative and quantitative aspects of haemopoietic cell development in the mammalian embryo. Immunol. Today 19,228 -236.[Medline]
Ehler, E., Jat, P. S., Noble, M. D., Citi, S. and Draeger,
A. (1995). Vascular smooth muscle cells of H-2Kb-tsA58
transgenic mice. Characterization of cell lines with distinct properties.
Circulation 92,3289
-3296.
Fennie, C., Cheng, J., Dowbenko, D., Young, P. and Lasky, L.
A. (1995). CD34+ endothelial cell lines derived from murine
yolk sac induce the proliferation and differentiation of yolk sac CD34+
hematopoietic progenitors. Blood
86,4454
-4467.
Fraser, P., Hurst, J., Collis, P. and Grosveld, F.
(1990). DNasel hypersensitive sites 1, 2 and 3 of the human
beta-globin dominant control region direct position-independent expression.
Nucleic Acids Res. 18,3503
-3508.
Gajewski, T. F., Goldwasser, E. and Fitch, F. W. (1988). Anti-proliferative effect of IFN-gamma in immune regulation. II. IFN-gamma inhibits the proliferation of murine bone marrow cells stimulated with IL-3, IL-4, or granulocyte-macrophage colony-stimulating factor. J. Immunol. 141,2635 -2642.[Abstract]
Godin, I., Garcia-Porrero, J. A., Dieterlen-Lievre, F. and
Cumano, A. (1999). Stem cell emergence and hemopoietic
activity are incompatible in mouse intraembryonic sites. J. Exp.
Med. 190,43
-52.
Itoh, K., Tezuka, H., Sakoda, H., Konno, M., Nagata, K., Uchiyama, T., Uchino, H. and Mori, K. J. (1989). Reproducible establishment of hemopoietic supportive stromal cell lines from murine bone marrow. Exp. Hematol. 17,145 -153.[Medline]
Jat, P. S., Cepko, C. L., Mulligan, R. C. and Sharp, P. A.
(1986). Recombinant retroviruses encoding simian virus 40 large T
antigen and polyomavirus large and middle T antigens. Mol. Cell
Biol. 6,1204
-1217.
Jat, P. S., Noble, M. D., Ataliotis, P., Tanaka, Y., Yannoutsos,
N., Larsen, L. and Kioussis, D. (1991). Direct derivation of
conditionally immortal cell lines from an H-2Kb-tsA58 transgenic
mouse. Proc. Natl. Acad. Sci. USA
88,5096
-5100.
Jat, P. S. and Sharp, P. A. (1986). Large T
antigens of simian virus 40 and polyomavirus efficiently establish primary
fibroblasts. J. Virol.
59,746
-750.
Jordan, C. T. and Lemischka, I. R. (1990).
Clonal and systemic analysis of long-term hematopoiesis in the mouse.
Genes Dev. 4,220
-232.
Klimpel, G. R., Fleischmann, W. R. and Klimpel, K. D. (1982). Gamma interferon (IFN gamma) and IFN alpha/beta suppress murine myeloid colony formation (CFU-C)N: magnitude of suppression is dependent upon level of colony-stimulating factor (CSF). J. Immunol. 129,76 -80.[Abstract]
Lemischka, I. R. (1991). Clonal, in vivo behavior of the totipotent hematopoietic stem cell. Semin. Immunol. 3,349 -355.[Medline]
Lemoine, F. M., Dedhar, S., Lima, G. M. and Eaves, C. J.
(1990). Transformation-associated alterations in interactions
between pre-B cells and fibronectin. Blood
76,2311
-2320.
Lord, B. I., Testa, N. G. and Hendry, J. H.
(1975). The relative spatial distributions of CFUs and CFUc in
the normal mouse femur. Blood
46, 65-72.
McKinstry, W. J., Li, C. L., Rasko, J. E., Nicola, N. A.,
Johnson, G. R. and Metcalf, D. (1997). Cytokine receptor
expression on hematopoietic stem and progenitor cells.
Blood 89,65
-71.
Medvinsky, A. and Dzierzak, E. (1996). Definitive hematopoiesis is autonomously initiated by the AGM region. Cell 86,897 -906.[Medline]
Medvinsky, A. L., Samoylina, N. L., Muller, A. M. and Dzierzak, E. A. (1993). An early pre-liver intraembryonic source of CFU-S in the developing mouse. Nature 364, 64-67.[Medline]
Metcalf, D. (ed.) (1988). The molecular control of blood cells. Cambridge, MA: Harvard University Press.
Miles, C., Sanchez, M.-J., Sinclair, A. and Dzierzak, E. (1997). Expression of the Ly-6E.1 (Sca-1) transgene in adult hematopoietic stem cells and the developing mouse embryo. Development 124,537 -547.[Abstract]
Montecino-Rodriguez, E., Landreth, K. S. and Dorshkind, K. (1994). Differential expression of bone marrow stromal cell-surface antigens on myeloid and lymphoid cells. Hybridoma 13,175 -181.[Medline]
Moore, K. A., Ema, H. and Lemischka, I. R.
(1997a). In vitro maintenance of highly purified, transplantable
hematopoietic stem cells. Blood
89,4337
-4347.
Moore, K. A., Pytowski, B., Witte, L., Hicklin, D. and
Lemischka, I. R. (1997b). Hematopoietic activity of a stromal
cell transmembrane protein containing epidermal growth factor-like repeat
motifs. Proc. Natl. Acad. Sci. USA
94,4011
-4016.
Moore, M. A. and Metcalf, D. (1970). Ontogeny of the haemopoietic system: yolk sac origin of in vivo and in vitro colony forming cells in the developing mouse embryo. Br. J. Haematol. 18,279 -296.[Medline]
Morgan, J. E., Beauchamp, J. R., Pagel, C. N., Peckham, M., Ataliotis, P., Jat, P. S., Noble, M. D., Farmer, K. and Partridge, T. A. (1994). Myogenic cell lines derived from transgenic mice carrying a thermolabile T antigen: a model system for the derivation of tissue-specific and mutation-specific cell lines. Dev. Biol. 162,486 -498.[Medline]
Müller, A. M., Medvinsky, A., Strouboulis, J., Grosveld, F. and Dzierzak, E. (1994). Development of hematopoietic stem cell activity in the mouse embryo. Immunity 1, 291-301.[Medline]
Nakayama, N., Han, C.-H., Scully, S., Nishinakamura, R., He, C., Zeni, L., Yamane, H., Chang, D., Yu, D., Yokota, T. and Wen, D. (2001). A novel chordin-like protein inhibitor for bone morphogenetic proteins expressed preferentially in mesenchymal cell lineages. Dev. Biol. 232,372 -387.[Medline]
Ogawa, M. (1993). Differentiation and
proliferation of hematopoietic stem cells. Blood
81,2844
-2853.
Ohneda, O., Fennie, C., Zheng, Z., Donahue, C., La, H.,
Villacorta, R., Cairns, B. and Lasky, L. A. (1998).
Hematopoietic stem cell maintenance and differentiation are supported by
embryonic aorta-gonad-mesonephros region-derived endothelium.
Blood 92,908
-919.
Ohneda, O., Ohneda, K., Nomiyama, H., Zheng, Z., Gold, S. A., Arai, F., Miyamoto, T., Taillon, B. E., McIndoe, R. A., Shimkets, R. A. et al. (2000). WECHE: a novel hematopoietic regulatory factor. Immunity 12,141 -150.[Medline]
Okuyama, R., Koguma, M., Yanai, N. and Obinata, M.
(1995a). Bone marrow stromal cells induce myeloid and lymphoid
development of the sorted hematopoietic stem cells in vitro.
Blood 86,2590
-2597.
Okuyama, R., Yanai, N. and Obinata, M. (1995b). Differentiation capacity toward mesenchymal cell lineages of bone marrow stromal cells established from temperature-sensitive SV40 T-antigen gene transgenic mouse. Exp. Cell Res. 218,424 -429.[Medline]
Oostendorp, R. A. J., Harvey, K. N., Kusadasi, N., de Bruijn, M.
F. T. R., Saris, C., Ploemacher, R. E., Medvinsky, A. L. and Dzierzak, E.
A. (2002). Stromal cell lines from mouse
aorta-gonad-mesonephros subregions are potent supporters of hematopoietic stem
cell activity. Blood 99,1183
-1189.
Rémy-Martin, J. P., Marandin, A., Challier, B., Bernard, G., Deschaseaux, M., Herve, P., Wei, Y., Tsuji, T., Auerbach, R., Dennis, J. E. et al. (1999). Vascular smooth muscle differentiation of murine stroma: a sequential model. Exp. Hematol. 27,1782 -1795.[Medline]
Ridley, A. J., Paterson, H. F., Noble, M. and Land, H. (1988). Ras-mediated cell cycle arrest is altered by nuclear oncogenes to induce Schwann cell transformation. EMBO J. 7,1635 -1645.[Medline]
Sato, T., Selleri, C., Young, N. S. and Maciejewski, J. P.
(1995). Hematopoietic inhibition by interferon-gamma is partially
mediated through interferon regulatory factor-1. Blood
86,3373
-3380.
Selleri, C., Sato, T., Anderson, S., Young, N. S. and Maciejewski, J. P. (1995). Interferon-gamma and tumor necrosis factor-alpha suppress both early and late stages of hematopoiesis and induce programmed cell death. J. Cell Physiol. 165,538 -546.[Medline]
Selleri, C., Maciejewski, J. P., Sato, T. and Young, N. S.
(1996). Interferongamma constitutively expressed in the stromal
microenvironment of human marrow cultures mediates potent hematopoietic
inhibition. Blood 87,4149
-4157.
Smith, J. R. and Pereira-Smith, O. M. (1996). Replicative senescence: implications for in vivo aging and tumor suppression. Science 273,63 -67.[Abstract]
Tegtmeyer, P. (1975). Function of simian virus
40 gene A in transforming infection. J. Virol.
15,613
-618.
Whitehead, R. H., VanEeden, P. E., Noble, M. D., Ataliotis, P.
and Jat, P. S. (1993). Establishment of conditionally
immortalized epithelial cell lines from both colon and small intestine of
adult H-2Kb-tsA58 transgenic mice. Proc. Natl. Acad. Sci.
USA 90,587
-591.
Wineman, J., Moore, K., Lemischka, I. and Muller-Sieburg, C.
(1996). Functional heterogeneity of the hematopoietic
microenvironment: rare stromal elements maintain long-term repopulating stem
cells. Blood 87,4082
-4090.
Xu, M. J., Tsuji, K., Ueda, T., Mukouyama, Y. S., Hara, T.,
Yang, F. C., Ebihara, Y., Matsuoka, S., Manabe, A., Kikuchi, A. et al.
(1998). Stimulation of mouse and human primitive hematopoiesis by
murine embryonic aorta-gonad-mesonephros-derived stromal cell lines.
Blood 92,2032
-2040.
Yanai, N., Suzuki, M. and Obinata, M. (1991). Hepatocyte cell lines established from transgenic mice harboring temperature-sensitive SV 40 large T-antigen gene. Exp. Cell Res. 197,50 -56.[Medline]
Yoder, M. C., Papaioannou, V. E., Breitfeld, P. P. and Williams,
D. A. (1994). Murine yolk sac endoderm- and mesoderm-derived
cell lines support in vitro growth and differentiation of hematopoietic cells.
Blood 83,2436
-2443.
Yoder, M. C., King, B., Hiatt, K. and Williams, D. A.
(1995). Murine embryonic yolk sac cells promote in vitro
proliferation of bone marrow high proliferative potential colony-forming
cells. Blood 86,1322
-1330.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
C. Orelio, M. Peeters, E. Haak, K. van der Horn, and E. Dzierzak Interleukin-1 regulates hematopoietic progenitor and stem cells in the midgestation mouse fetal liver Haematologica, April 1, 2009; 94(4): 462 - 469. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Durand, C. Robin, K. Bollerot, M. H. Baron, K. Ottersbach, and E. Dzierzak Embryonic stromal clones reveal developmental regulators of definitive hematopoietic stem cells PNAS, December 26, 2007; 104(52): 20838 - 20843. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. A.J. Oostendorp, C. Robin, C. Steinhoff, S. Marz, R. Brauer, U. A. Nuber, E. A. Dzierzak, and C. Peschel Long-Term Maintenance of Hematopoietic Stem Cells Does Not Require Contact with Embryo-Derived Stromal Cells in Cocultures Stem Cells, June 1, 2005; 23(6): 842 - 851. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. C. Mendes, C. Robin, and E. Dzierzak Mesenchymal progenitor cells localize within hematopoietic sites throughout ontogeny Development, March 1, 2005; 132(5): 1127 - 1136. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Harvey and E. Dzierzak Cell-Cell Contact and Anatomical Compatibility in Stromal Cell-Mediated HSC Support During Development Stem Cells, May 1, 2004; 22(3): 253 - 258. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Nakayama, C.-y. E. Han, L. Cam, J. I. Lee, J. Pretorius, S. Fisher, R. Rosenfeld, S. Scully, R. Nishinakamura, D. Duryea, et al. A novel chordin-like BMP inhibitor, CHL2, expressed preferentially in chondrocytes of developing cartilage and osteoarthritic joint cartilage Development, January 1, 2004; 131(1): 229 - 240. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||