|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
Research Article |
Genes and Development Research Group, Department of Biochemistry and Molecular Biology, University of Calgary, 3330 Hospital Drive NW, Calgary, Alberta, Canada, T2N 4N1
* Author for correspondence (e-mail: mains{at}ucalgary.ca )
Accepted 26 March 2002
| Summary |
|---|
|
|
|---|
Key words: Rho-binding kinase, Myosin phosphatase, Cytokinesis, Contraction, C. elegans
| Introduction |
|---|
|
|
|---|
Rho GTPases have been implicated in regulating the various stages of
cytokinesis in eukaryotes (Drechsel et al.,
1996
; Mackay and Hall,
1998
; Prokopenko et al.,
1999
; Jantsch-Plunger et al.,
2000
; Prokopenko et al.,
2000
; Glotzer,
2001
). For example, inhibiting Rho activity blocks cytokinesis in
both Xenopus and C. elegans embryos, suggesting that Rho is
required for furrow formation (Drechsel et
al., 1996
; Jantsch-Plunger et
al., 2000
). Similarly in Drosophila, furrow formation
fails in mutations of pebble, a Rho guanine exchange factor (GEF)
(Prokopenko et al., 1999
).
Rho-binding kinase (ROK) is a downstream Rho effector that is a candidate
for modulating myosin activity during furrow ingression. Non-muscle myosin
forms fibres at the onset of cytokinesis, which is concurrent with the
localization of active myosin light chain kinase (MLCK) to the cleavage furrow
(DeBiasio et al., 1996
;
Totsukawa et al., 1999
;
Poperechnaya et al., 2000
).
The regulatory non-muscle myosin light chain (rMLC) homologues (Drosophila
spaghetti-squash and C. elegans mlc-4), the non-muscle myosin
heavy chain homologue (C. elegans nmy-2) and the MLCK homologue
(Dictyostelium MLCK-A) are all required for cytokinesis
(Karess et al., 1991
;
Guo and Kemphues, 1996
;
Smith et al., 1996
;
Shelton et al., 1999
). In
smooth muscle and during stress fibre formation, contraction is induced by
MLCK phosphorylation of rMLC (Gallagher et
al., 1997
; Totsukawa et al.,
2000
; Somlyo and Somlyo,
2000
; Katoh et al.,
2001
). Myosin phosphatase blocks contraction by dephosphorylating
rMLC to counteract MLCK. Rho activates ROK, which then releases the brake to
contraction by phosphorylating and inhibiting the myosin phosphatase targeting
subunit (MYPT) (Kimura et al.,
1996
; Kawano et al.,
1999
; Somlyo and Somlyo,
2000
). ROK also directly phosphorylates rMLC in vitro
(Amano et al., 1996
), but it is
not clear if this occurs in all in vivo systems
(Sward et al., 2000
). In
Drosophila, planar cell polarity signaling activates ROK (Drok) to
regulate the actin cytoskeleton through the regulation of MLC
(Spaghettisquash) activity (Winter et al.,
2001
).
The precise roles that ROK and myosin phosphatase play during cytokinesis
are not clear. Injection of dominant-negative ROK constructs resulted in
multinuclear cells in Xenopus embryos and cultured mammalian cells
owing to failed glial fibrillary acid protein (GFAP) disassembly, which is
required for proper cell separation following cleavage
(Yasui et al., 1998
). However,
the use of ROK inhibitors in cultured mammalian cells instead indicated its
requirement for furrow contraction. Another ROK-related Rho effector,
citron-k, localized to the cleavage furrow and midbody in HeLa cells, and
transfection with dominant-negative constructs caused abnormal furrow
contractions (Madaule et al.,
1998
; Yasui et al.,
1998
; Kosako et al.,
1999
; Kosako et al.,
2000
). However, in vivo studies indicate that citron-k is not the
global regulator of cytokinesis and probably functions redundantly
(Di Cunto et al., 2000
). Myosin
phosphatase activity is downregulated following mitosis, but the physiological
relevance of this has not been shown
(Totsukawa et al., 1999
).
There is a need for determining ROK's role in cytokinesis using endogenous
loss-of-function mutations rather than transfected dominant-negative mutations
or chemical inhibitors (Madaule et al.,
1998
; Yasui et al.,
1998
; Kosako et al.,
1999
; Kosako et al.,
2000
), both of which could have effects on other (unknown)
proteins. Using endogenous let-502 and mel-11 mutations, we
previously described in vivo roles for the C. elegans ROK (LET-502)
and MYPT (MEL-11) in morphogenesis and spermathecal function, two different
contractile events in the worm (Wissmann
et al., 1997
; Wissmann et al.,
1999
; Piekny et al.,
2000
). In morphogenesis, LET-502 and MEL-11 together regulate the
actin-mediated epidermal cell shape changes that drive elongation of the
embryo (Wissmann et al., 1997
;
Piekny et al., 2000
). During
oocyte fertilization, LET-502 and MEL-11 each independently regulate the
contraction of different tissues within the spermatheca
(Wissmann et al., 1999
). Here
we use let-502 and mel-11 mutations to demonstrate in vivo
roles for both genes in another contractile event, cytokinesis. We show that
LET-502 and MEL-11 together control cytokinesis in a manner similar, but not
identical to, their regulation of epidermal cell shape changes during
morphogenesis. This suggests that LET-502 and MEL-11 are utilized at different
stages of the life cycle for various contractile events, but each event is
genetically and biochemically distinct.
| Materials and Methods |
|---|
|
|
|---|
Microscopy and immunofluorescence
Early embryos were dissected from gravid adult hermaphrodites. For
temperature-sensitive (ts) alleles, hermaphrodites were upshifted to
the non-permissive temperature for 1-2 hours prior to dissection. Embryos were
mounted on 3% agarose pads in M9 solution
(Sulston and Hodgkin, 1988
)
and examined by Nomarski optics on a Zeiss Axioplan microscope. Images were
photographed using either Techpan film (Kodak) developed at ASA 100 or using
videotape recording.
Early embryos were collected for staining by dissecting hermaphrodites on
polylysine-coated slides in M9 solution
(Sulston and Hodgkin, 1988
). A
coverslip was placed on each slide, and the embryos were frozen on dry ice for
a minimum of 30 minutes. The coverslips were removed and slides were placed in
-20°C MeOH for 15 minutes, followed by 5 minutes in -20°C acetone. For
actin staining only, freeze-cracked slides were placed in a 3.7% formaldehyde
solution (w/v) in 75% MeOH at room temperature for 10 minutes and then placed
in 100% MeOH at room temperature for 5 minutes
(Waddle et al., 1994
). Actin
staining could be performed only with the formaldehyde-based fixation
procedure; however, LET-502 and MEL-11 staining could be performed only with
the methanol fixation procedure. For all methods, the slides were then placed
directly into 1x phosphate-buffered saline (PBS) with 0.1% Triton X-100
(PBT) buffer for a minimum of 1 hour, then incubated with appropriate
dilutions of antisera in PBT with 20% normal goat or donkey serum (Jackson
Immunoresearch Laboratories). Mouse anti-actin monoclonal antibodies (Sigma)
were used at a 1:50 dilution, rabbit anti-NMY-2 polyclonal antibodies (K.
Kemphues, Cornell University, Ithaca, NY) were used at a 1:50 dilution, rabbit
anti-CYK-1 polyclonal antibodies (B. Bowerman, University of Oregon, Eugene,
OR) were used at a 1:20 dilution, rabbit anti-rMLC phosphoserine-19 polyclonal
antibodies (M. Walsh, University of Calgary, Calgary, AB) were used at a 1:50
dilution, P-granules were stained with mouse OIC1D4 monoclonal antibodies (S.
Strome, Bloomington, IN) at a 1:1 dilution, rat anti-LET-502 polyclonal
antibodies (see below) were used at a 1:100 dilution and rabbit anti-MEL-11
polyclonal antibodies (see below) were used at a 1:50 dilution. All slides
were incubated with primary antibodies overnight at room temperature and
washed three times with PBT prior to adding the appropriate secondary
antibody. Anti-rat IgG conjugated to indocarbocyanine (Cy-3; Jackson
Immunoresearch Laboratories), anti-mouse IgG conjugated to fluorescein
isothiocyanate (FITC; Jackson Immunoresearch Laboratories) or Alexa 488
(Molecular Probes) and anti-rabbit IgG conjugated to cyanine (Cy-2; Jackson
Immunoresearch Laboratories) or Alexa 488 (Molecular Probes) were diluted
1:100 in PBT, and slides were incubated with the appropriate secondary
antibody at room temperature for one hour. Slides were washed three times with
PBT prior to being incubated with 1 µg/mL DAPI (Roche) for 10 minutes at
room temperature. After one wash with PBT, any remaining liquid was removed
with a kimwipe. A drop of Slowfade Light Antifade solution (Molecular Probes)
and a coverslip were added to each slide and sealed with nail polish. Some
images were photographed using a 35mm camera on a Zeiss AxioPlan fluorescence
microscope with a 63x oil objective (embryos) or a 40x objective
(gonads). Other images were collected for each fluorochrome as stacks of
12-15x 1 µm from a Leica DM-R fluorescence microscope using
either a 40x oil objective (embryos) or a 20x oil objective
(gonads) with an Optivar tube set at a distance of 2 and images were collected
with a Princeton Instruments 14-bit cooled charge-coupled device (CCD). The
collected stacks were digitally deconvoluted using the nearest neighbor
algorithm of Autoquant Autodeblur version 5.1 for Windows, and all images were
analyzed using similar parameters. These images were then individually
imported into Adobe Photoshop version 4.0 for Windows to add colour and merge
images.
RNA-mediated interference (RNAi)
Double-stranded RNA was generated for both let-502 and
mlc-4 as previously described
(Piekny et al., 2000
;
Shelton et al., 1999
). RNA for
the citron genes was made by oligo(dT)-primed synthesis (GibcoBRL)
followed by PCR of the pooled cDNA. The primers used were specific to W02B8.2:
the forward primer included the T3 promoter binding sequence 5'
AATTAACCCTCACTAAAGGGATGAACGAATCAATATATATAC 3' and the reverse primer
including the T7 promoter binding sequence 5'
TAATACGACTCACTATAGGGTTAGTTTTTGGATCTTTTCA 3'. Primers specific to F59A6.5
were: the forward primer, which included the T3 promoter binding sequence
5' AATTAACCCTCACTAAAGGGATGTGTGACTCTGTTTAC 3' and reverse primer
including the T7 promoter binding sequence 5'
TAATACGACTCACTATAGGGCCCACGAAGCAATCCAAG 3'. The PCR product was then used
for in vitro transcription (Megascript T3 and T7, Ambion). Concentrations of
500-1000 µg/ml dsRNA were used, diluted in
diethylpyrocarbonate-treated water. Wild-type, let-502(sb106) or
mel-11(it26) unc-4 L3 and L4 stage larvae were collected
(
100-200) and placed into microfuge tubes with 20-40 µl of dsRNA
solution and left overnight at 20°C. The soaked worms were then pipetted
onto fresh Escherichia coli seeded plates and allowed to recover for
12-24 hours. Worms of similar stages were then placed into groups of between
three and five on seeded plates and allowed to lay eggs overnight. Worms were
collected from plates with low hatching rates (0-15%) and dissected as
described above to observe their embryos. (Worms were soaked rather than
injected as let-502(sb106) hermaphrodites could not recover well from
injection and to allow for the collection of large numbers of embryos.)
LET-502, MEL-11 and rMLC phosphoserine-19 antisera
Rat polyclonal antibodies were raised against a HIS-LET-502 fusion using
the pQE30 vector and the QiaExpression kit (Qiagen) with 103 amino acids
corresponding to a region between the kinase domain and the coiled-coil region
(encoded by 309 bp from the start of exon 5, using the following primers:
forward 5' GGTGGATCCAAATCGGACGATGAC 3' and reverse 5'
GGGGTCGACTTCTCGGTTTTTCGA 3'). Antisera were affinity purified with a
GST-LET-502 fusion using the same LET-502 fragment as described above cloned
into the pGEX-3X vector and glutathione S-transferase (GST) expression system
(Pharmacia) coupled to a cyanogen-bromide-activated Sepharose column
(Pharmacia). Western blot analysis showed that the affinity-purified antiserum
recognized one band at
130 kDa (expected Mr 129 kDa)
with gravid adult hermaphrodite extracts solubilized with 1 M NaCl, implying
that a LET-502 isoform is preferentially associated with the cytoskeleton.
This band also was detected in 1x PBS extracts, suggesting that some
LET-502 isoforms are in the cytoplasm. Two other bands that differ in size by
only a few kDa (
130-140 kDa) were also seen in the 1x PBS extracts,
implying that several LET-502 isoforms exist (owing to alternative splicing)
and/or some of the isoforms are phosphorylated or partially degraded. All
bands were blocked by adding excess GST-LET-502 to the antisera. Decreased
immunostaining in the let-502 mutants further supported the
conclusion that the antisera are specific (see Results).
Rabbit polyclonal antibodies were raised against a GST-MEL-11 fusion
containing 64 amino acids from a portion 3' to the ankyrin repeats
(encoded by 192 bp from the start of exon 13, using forward primer 5'
CAGGATCCGCAGTCGTCCAACAGAAC 3' and reverse primer 5'
GCGAATTCCGGCAACCGATAAAT 3'). The antisera were affinity purified using a
cyanogen-bromide-activated Sepharose column coupled to the MEL-11 fragment
cleaved from the GST-MEL-11 protein. Western blot analysis showed that the
antisera recognize five bands in the
110-120 kDa size region (which is
consistent with the expected size range for the five splice variants described
by Wissmann et al., with extracts from gravid hermaphrodites in 1x PBS
(Wissman et al., 1999). Some of these bands were also visualized when
solubilized in 1 M NaCl, suggesting that some of the MEL-11 isoforms are
preferentially associated with the cytoskeleton, whereas others are in the
cytoplasm. Multiple MEL-11 isoforms exist because of alternative splicing, as
observed by Wissmann et al., but in addition it is likely that some MEL-11
isoforms are phosphorylated or degraded (Wissman et al., 1999). All bands were
blocked by incubating the antisera with excess GST-MEL-11 protein. Decreased
immunostaining in mel-11 mutants provide further evidence that the
antisera are specific (see Results).
Polyclonal antibodies that specifically recognize rMLC (20 kDa light chain of myosin) phosphorylated at serine 19 were raised in rabbits by injection of a peptide (KKRPQRATS(P)NVFC) corresponding to residues 11-22 of the chicken light chain with a phosphoserine at position 19 and a C-terminal Cys coupled to KLH. Antibodies were purified from the IgG fraction by peptide affinity column chromatography and shown to be specific for rMLC phosphorylated at serine 19 by western blotting. The antibodies were generously donated by Michael P. Walsh (University of Calgary, AB) and his laboratory.
| Results |
|---|
|
|
|---|
Embryos from hermaphrodites mutant for mel-11(it26) showed ectopic
furrowing during both pseudocleavage (the incomplete cleavage that occurs
during pronuclear migration after fertilization) and during early cell
divisions (Fig. 1, compare
wild-type A-F with mutant G-L). mel-11(it26) is a
temperature-sensitive allele that behaves as a null at the restrictive
temperature. Cells in mel-11(it26) embryos initiated their nuclear
divisions and cleavage furrow ingressions at the correct time, but furrow
ingression was completed approximately twice as fast as in wild-type embryos
(Fig. 2). For example in the
mel-11(it26) embryo in Fig.
1T, the AB cell (the anterior blastomere) completed division prior
to the initiation of the division of the P1 cell (the posterior blastomere).
In wild-type embryos (Fig. 1S),
AB completed its cleavage only after cleavage was initiated in P1.
mel-11's maternal-effect lethality is rescued by mating to wild-type
males (Kemphues, 1988; Wissmann et al.,
1999
). Because the observed cytokinetic defects occur too early to
be rescued by a paternally contributed wild-type allele, mel-11's
maternal-effect lethality must primarily stem from defects in elongation
rather than cytokinesis.
|
|
let-502(sb106) embryos displayed phenotypes opposite to those seen in mel-11(it26), with embryos showing little or no pseudocleavage and slowed or failed cytokinesis (Fig. 1M-R). In let-502(sb106) embryos with successful first divisions, the AB cell furrow initiated at the correct time but ingressed at only half the wild-type speed (Fig. 2). For example, in the let-502(sb106) embryo in Fig. 1U, P1 completed its division prior to AB. In let-502(sb106) cells that failed to complete cytokinesis, furrows initiated at the correct time and ingressed slightly but then regressed (Fig. 1O,P). The ability of furrows to ingress even slightly could be because of residual LET-502 activity or may reflect the activity of a partially redundant pathway.
Failed cell divisions occur (apparently) at random in let-502(sb106) embryos, with many divisions being normal. Again, this could be the result of either residual LET-502 activity or a partially redundant pathway. We examined let-502(sb106) embryos treated with dsRNA (used for RNAi) as they presumably would have LET-502 levels depleted to a greater extent. Indeed, let-502(sb106RNAi) embryos had decreased embryonic viability (i.e. at 25°C, let-502(sb106) had 41% hatching and let-502(sb106RNAi) had 0%). However, divisions still failed at random with the number of successful cell divisions at 25°C as follows: six had no divisions, two had one division, four had two divisions, five had four divisions and the remaining 35 embryos all arrested prior to morphogenesis (probably indicating that at least one fatal division error occurred prior to that time). Therefore let-502(+) is required for the embryo to complete all of its cell divisions correctly but is not required for the successful completion of every cell division.
The above results suggest that let-502 and mel-11 have
antagonistic activities during cleavage furrow ingression. We predict that
mutations in let-502 and mel-11 should alleviate one
another's cleavage defects, as previously we had reported that both
let-502's early cleavage defects and elongation phenotype (which are
genetically separable) are suppressed by mel-11. At 25°C,
let-502(sb106) had 41% hatching, mel-11(sb55) had 25.2%
hatching and let-502(sb106); mel-11(sb55) had 90% hatching
(Wissmann et al., 1997
;
Piekny et al., 2000
). Indeed,
combining a hypomorphic let-502 allele, sb106 or
sb108 (the latter displays no cleavage defects) with
mel-11(it26) resulted in furrow ingression times near to wild-type
rates, with few failed divisions (Fig.
2).
In summary, let-502 mutants have slow furrow ingression, implying that LET-502(+) is required for contraction to proceed. In contrast, mel-11 mutants show faster furrow ingression and ectopic furrows, suggesting that MEL-11(+) acts as a brake to contraction and prevents furrow formation at inappropriate locations. The genetic interactions between let-502 and mel-11 imply that they influence each other's activities in the furrow. Together, LET-502 and MEL-11 regulate the rate or force of cleavage furrow contraction, which is essential for a high fidelity of successful cell divisions.
LET-502 and MEL-11 proteins are enriched in cleavage furrows
Our evidence indicates that let-502 and mel-11 regulate
cleavage furrow ingression. Therefore, we examined LET-502 and MEL-11
localization at furrows using immunofluorescence (IF) with antibodies raised
against each protein (see the Materials and Methods). In wild-type embryos,
LET-502 and MEL-11 both localized to cleavage furrows at early stages of
furrow ingression and remained there during later stages of ingression
(Fig. 3iA-F). Anti-MEL-11 also
faintly stained the central spindle during late anaphase, but this structure
was not noticeably altered in mel-11(it26) mutant embryos stained
with anti
-tubulin (data not shown).
|
We examined LET-502 and MEL-11 localization in mutant embryos to verify that their molecular and genetic phenotypes are consistent and to determine whether they are co-dependent on one another for their localization. Cytoplasmic LET-502 levels were decreased but not eliminated in let-502(sb106) embryos, consistent with the interpretation that let-502(sb106) is a hypomorph (Fig. 3iG,I). In let-502(sb106RNAi) embryos, LET-502 levels were depleted to a greater extent than in let-502(sb106) embryos, and indeed LET-502 was often undetectable (see Fig. 5F, Fig. 7D below). In addition, MEL-11's intensity at furrows appeared to weaken in let-502(sb106) embryos (Fig. 3iH). Although MEL-11 staining was severely depleted in mel-11(it26) embryos raised at the non-permissive temperature, LET-502 localization was unaffected (Fig. 3iJ-L). Therefore, LET-502 is not dependent on MEL-11 for its localization to cleavage furrows, but MEL-11 may be partially dependent on LET-502.
|
|
We used deconvolution microscopy to determine the extent of overlap between
LET-502 and MEL-11 at cleavage furrows. Initially we used wild-type embryos
(Fig. 3iiA-C); however, high
cytoplasmic LET-502 often obscured our visualization of LET-502 at the
cleavage furrow. Using the hypomorph let-502(sb106), which has
decreased LET-502 in the cytoplasm (see above), LET-502 clearly overlapped
with MEL-11 at the furrow (Fig.
3iiD-F). Embryos from hermaphrodites heterozygous for the
dominant-negative mutation let-502(ca201) gave similar patterns of
LET-502 and MEL-11 colocalization (Fig.
3iiG-I). Kosako et al. found similar effects in cell culture
experiments where the presence of ROK inhibitors decreased levels of ROK in
the cytoplasm, more clearly revealing its presence at the furrow
(Kosako et al., 2000
).
We conclude that LET-502 and MEL-11 colocalize to ingressing cleavage furrows, implying that LET-502 and MEL-11 together regulate cleavage furrow ingression.
LET-502 and MEL-11 are not required to form cleavage furrows
The let-502 and mel-11 phenotypes suggest that they
regulate the rate of cleavage furrow ingression and are not involved in furrow
formation. LET-502 colocalized with NMY-2 myosin thick filaments at the
cleavage furrow (Fig. 4A-C),
implying that LET-502 (and by implication MEL-11) is associated with the
contractile ring. [We were not able to examine the localization of LET-502 and
MEL-11 with actin because of incompatible fixation requirements (see Materials
and Methods)]. LET-502's association with the thick filaments of the
contractile ring is consistent with LET-502 targeting either rMLC or MEL-11
(and MEL-11 targeting rMLC) to regulate its activity during furrow
contraction.
|
rho-1(RNAi) leads to failure of furrow formation in C.
elegans embryos (Jantsch-Plunger et
al., 2000
). Since LET-502/ROK is a Rho effector, we determined
whether LET-502 and MEL-11 also are involved in the initial formation of the
actomyosin ring. NMY-2 and actin retained their localization at the site of
furrow formation in all let-502(sb106) (n=16) and
let-502(sb106RNAi) (n=16) embryos examined at the one, two
and four cell stages (Fig.
4D-I), despite the fact that 33% of let-502(sb106)
embryos have visible cleavage defects at these times. NMY-2 and actin
similarly retained their location in mel-11(it26) embryos
(Fig. 4J-O; n=29).
Therefore, let-502 and mel-11 probably are not required to
properly localize components of the cleavage furrow to its site of formation.
Interestingly NMY-2 localized to the mitotic spindle during metaphase but
disappeared as the cell cycle progressed
(Fig. 4G,I).
In summary, LET-502 colocalizes with NMY-2 in the contractile ring, but LET-502 and MEL-11 are not required for initial furrow formation and probably are recruited to the furrow after the actomyosin ring is formed.
LET-502 and MEL-11 regulate cleavage furrow contraction by altering
the levels of active rMLC
The let-502 and mel-11 phenotypes imply that they
regulate the rate of cleavage furrow contraction, most probably by regulating
rMLC, which is activated by phosphorylation of serine 19 in higher eukaryotes
(which corresponds to serine 18 in C. elegans). We found that an
antibody raised against rMLC phosphoserine 19 in chickens (M. Walsh,
University of Calgary, personal communication) specifically crossreacted with
MLC-4 in C. elegans. Using this reagent, we observed that high
amounts of rMLC phosphoserine 19/18 were detectable in the cytoplasm and the
cortex and in the cleavage furrow of wild-type embryos, and rMLC phosphoserine
19/18 colocalized with LET-502 at all locations
(Fig. 5A). Furrow and
cytoplasmic rMLC phosphoserine 19/18 levels were elevated in
mel-11(it26) mutant embryos (Fig.
5B), whereas these levels were greatly decreased in
let-502(sb106) mutant embryos
(Fig. 5C). The antisera were
specific for the rMLC encoded by mlc-4
(Shelton et al., 1999
), which
is required for early C. elegans cleavages, since rMLC phosphoserine
19/18 was either non-detectable (Fig.
5D) or present a very low levels
(Fig. 5E) in
mlc-4(RNAi) embryos. In addition, the antisera recognized a single
band at the appropriate molecular weight on western blots (data not shown).
rMLC phosphoserine 19/18 levels were restored close to wild-type levels in
let-502(sb106RNAi) mel-11(it26) embryos
(Fig. 5F).
In summary, LET-502 appears to positively regulate contraction either by direct phosphorylation of MLC-4 or indirectly by inhibiting MLC-4 dephosphorylation by MEL-11. Probably, there is a threshold level of active rMLC required for successful cytokinesis, and cells that lack this level fail to undergo cleavage. The double mutants restored sufficient amounts of active rMLC in the furrow for successful cleavages to occur. This suggests that another kinase, other than LET-502/ROK, phosphorylates rMLC in these circumstances.
Where do LET-502 and MEL-11 fit into the cytokinetic pathway?
Our evidence suggests that LET-502 and MEL-11 regulate contraction of the
actomyosin ring after furrow formation but prior to the end of cleavage furrow
ingression. We performed molecular and genetic epistasis experiments and
placed LET-502 and MEL-11 in a pathway with respect to other proteins known to
be involved in furrow progression. We tested genes encoding MLC-4 (rMLC),
early and late CYK-1 (formin) activity and CYK-4 [Rho GTPase activating
protein (GAP)]. Early CYK-1 is required for actin polymerization and the
earliest stages of furrow formation (A. Severson and B. Bowerman, University
of Oregon, Eugene, personal communication). Actin polymerization then is
followed by or occurs in conjunction with the incorporation of NMY-2 and MLC-4
to form an actomyosin ring prior to furrow ingression
(Shelton et al., 1999
). Late
CYK-1 and CYK-4 are required for the final stages of furrow ingression and/or
termination (Swan et al.,
1998
; Jantsch-Plunger et al.,
2000
).
We examined LET-502 and MEL-11 localization in embryos defective for early cyk-1 function using embryos from cyk-1 heteroallelic hermaphrodites carrying a weak allele (showing late cytokinetic defects on its own) and a strong (sterile) allele (A. Severson and B. Bowerman, University of Oregon, Eugene, personal communication). LET-502 and MEL-11 failed to localize in this genetic background (Fig. 6A-C). Therefore, since early CYK-1 activity is involved in actin polymerization and contractile ring formation, we conclude that LET-502 and MEL-11 require a properly formed contractile ring for their localization.
|
As described earlier, MLC-4 is probably a substrate for MEL-11 and/or
LET-502 (Shelton et al., 1999
;
Piekny et al., 2000
), and
indeed LET-502 and MEL-11 failed to localize in mlc-4(RNAi) embryos
(Fig. 6D-F). It is likely that
LET-502 and MEL-11 are recruited to the furrow to act on MLC-4 as a target.
Consistent with both let-502 and mlc-4 acting during
cytokinesis, decreased activity of these genes enhance (exacerbate) one
another's defects. Weak mlc-4(RNAi) (using lower concentrations of
dsRNA) results in 43% hatching, while in let-502(sb106) embryos show
85% hatching at 20°C. If there were no genetic interactions between
let-502 and mlc-4, the predicted hatching rate would be
37%, but the observed value was 13%, implying that the genes are
genetically influencing the same process.
CYK-4 is a Rho GAP required for a late step in cytokinesis
(Jantsch-Plunger et al.,
2000
). We examined LET-502 and MEL-11 localization in
cyk-4 mutant embryos, which form furrows that ingress substantially
but then regress (Jantsch-Plunger et al.,
2000
). LET-502 and MEL-11 retained their location in
cyk-4 mutant embryos, implying that LET-502 and MEL-11 are not
dependent on CYK-4 (Fig. 6G-I).
However, let-502 and cyk-4 do interact genetically: at
15°C, let-502(sb106 or sb108) cyk-4(t1689) animals were
sterile owing to germline proliferation defects (see next section).
cyk-4 also was epistatic to mel-11, with embryos displaying
the cyk-4 phenotype (arresting at the one cell stage).
CYK-1's late role in cytokinesis may be to stabilize ingressed cleavage
furrows until they can be disassembled, since weak cyk-1 mutations
result in embryos that form cleavage furrows that ingress substantially but
then regress (Swan et al.,
1998
). LET-502 and MEL-11 distributions were not altered in weak
cyk-1 mutant embryos, suggesting that LET-502 and MEL-11 are not
dependent on late CYK-1 function (Fig.
6J-L). A CYK-1 antibody was used for the reciprocal experiment to
determine whether LET-502 and MEL-11 are required to localize CYK-1 for its
late role. CYK-1 colocalized with LET-502 in wild-type embryos
(Fig. 7A-C), and it was still
present at furrows in let-502(sb106RNAi) embryos, although at less
intense levels than in wild-type embryos
(Fig. 7D-F). Therefore, CYK-1's
late role in cytokinesis may be partly dependent on LET-502. Genetically,
cyk-1 and let-502 mutants strongly enhanced one another: at
20°C let-502(sb106 or sb108) cyk-1(t1568 or
t1611 or or36) animals were sterile owing to germline
proliferation defects (see next section). CYK-1's location at furrows was not
altered in mel-11(it26) embryos
(Fig. 7G-I), but cyk-1
also was epistatic to mel-11, with embryos displaying the
cyk-1 phenotype (arresting at the one cell stage). Therefore, CYK-1
is not dependent on MEL-11, consistent with `normal', albeit rapid, furrow
ingression in mel-11.
Function of let-502 in oocyte cellularization
The C. elegans hermaphrodite gonad contains mitotically
proliferating nuclei within a syncytium
(Fig. 8i). These nuclei
progress through meiosis and become fully cellularized into oocytes as they
move through the gonad in a distal to proximal direction (relative to the
vulva) (Kimble and Ward,
1988
). Membranes invaginate into the cytoplasm around each nucleus
in the distal mitotic region but do not fully enclose the nuclei. The
membranes eventually pinch off to cellularize nuclei into separate oocytes,
which may occur by a mechanism similar to cytokinesis.
|
Genes that are required for cytokinesis, such as mlc-4 and
cyk-1, also affect oocyte formation within the hermaphrodite gonad,
and mutations result in varying levels of sterility
(Swan et al., 1998
;
Shelton et al., 1999
) (A.
Severson and B. Bowerman, University of Oregon, Eugene, personal
communication). This effect raises the question as to whether let-502
regulates oocyte cellularization, which would be similar to its role in
cytokinesis. let-502(sb106) hermaphrodites laid eggs of noticeably
variable sizes in comparison to the uniform range seen in wildtypes. Some
embryos (although not obviously polyploid) were more than twice the normal
length, whereas others were smaller than the wildtype
(Fig. 8ii). This variation was
also reflected in the size of oocytes within the gonad where the most mature
oocyte was not always the largest (as is seen in wildtype), indicating that
the membranes are probably not forming at proper distances from one another
(data not shown). Some oocytes were multinuclear, indicating a failure to
cellularize properly. Embryo sizes were normal in mel-11 mutants, and
mel-11 mutants suppressed the size defect of let-502 mutants
(data not shown).
LET-502's role in cellularization is consistent with its localization in the gonad, where LET-502 and MEL-11 colocalized at the membrane invaginations surrounding each nucleus within the mitotically dividing syncitium (Fig. 8iiiA-F). The membrane invaginations still formed in let-502(sb106) gonad arms; however, the gonad arms were much thinner, and some of the membrane invaginations appeared to be disrupted, with some surrounding multiple nuclei (Fig. 8iiiG-L). In addition, LET-502 localized to oocyte cell boundaries as they became cellularized in a pattern similar to the MEL-11 and NMY-2 distribution (Fig. 8ivM-Q). rMLC phosphoserine 19/18 also localized to oocyte cell boundaries (data not shown). Therefore, LET-502's expression pattern within the gonad combined with its phenotype is consistent with let-502 being involved in oocyte cellularization. Despite the lack of an obvious gonad phenotype in mel-11 mutants, MEL-11 was present at cell boundaries, suggesting that mel-11 may also play a non-essential in oocyte formation.
LET-502 and MEL-11 are not required for early embryonic polarity
Rho GTPases (Rho and Cdc42) and non-muscle myosin (NMY-2 and MLC-4) are
also involved in cell polarity (Guo and
Kemphues, 1996
; Shelton et
al., 1999
; Prokopenko et al.,
2000
; Kay and Hunter,
2001
). However, let-502 and mel-11 mutant
embryos did not appear to have any polarity defects, that is, the asymmetrical
events of pronuclear fusion, placement of the mitotic spindle and segregation
of P granules all were normal in their cellular position, structure and timing
(A.P., unpublished).
| Discussion |
|---|
|
|
|---|
To define further the roles of let-502 and mel-11 during furrow contraction, we examined the molecular epistasis between let-502, mel-11 and other gene products known to regulate cytokinesis in C. elegans. We propose that let-502 and mel-11 function downstream of actin, myosin and early formin (CYK-1) activity to regulate cytokinesis (Fig. 9). Actin and myosin (NMY-2) retain their localization at furrows in the absence of LET-502 and MEL-11, and LET-502 and MEL-11 localize to furrows only after ingression is initiated. In addition, LET-502 and MEL-11 no longer localize in embryos mutant for early cyk-1 function. CYK-1/formin may regulate actin polymerization and functions early during contractile ring assembly (A. Severson and B. Bowerman, University of Oregon, Eugene, personal communication). Actin and NMY-2 are then incorporated into the contractile ring, followed by recruitment of LET-502 and MEL-11.
|
The likely target of LET-502/ROK and MEL-11/MYPT is MLC-4/rMLC, whose
phosphorylation triggers contraction in smooth muscle and stress fibre
formation (Amano et al., 1996
;
Kimura et al., 1996
;
Kawano et al., 1999
;
Somlyo and Somlyo, 2000
;
Sward et al., 2000
). In higher
eukaryotes, ROK induces contraction by either activating rMLC by direct
phosphorylation (Amano et al.,
1996
) (see also Sward et al.,
2000
) or indirectly by downregulating MYPT, which itself inhibits
rMLC by dephosphorylation (Kimura et al.,
1996
; Kawano et al.,
1999
). Similarly, our previous genetic studies showed that MLC-4
is probably a target of LET-502 and MEL-11 during morphogenesis, the
contractile event that drives elongation
(Piekny et al., 2000
). In this
report we have shown that levels of phosphorylated (active) rMLC are dependent
on LET-502 and MEL-11 and that LET-502 and MEL-11 localizations are disrupted
when MLC-4 is removed. Therefore, we propose that LET-502 and MEL-11 regulate
cytokinesis in a manner similar to their homologues in smooth muscle
contraction and stress fibre formation in higher eukaryotes. LET-502 and
MEL-11 regulate MLC-4/rMLC activity to control contraction. The balance of
LET-502 and MEL-11 is crucial; when this balance is disrupted, as in the
single mutants, cleavage fails to occur properly.
Furrow ingression is terminated through the downregulation of Rho by
CYK-4/Rho GAP when the contractile ring contacts the central spindle
(Jantsch-Plunger et al.,
2000
). Consistent with this, LET-502 and MEL-11 retain their
localization in cyk-4 mutant embryos, which have furrows that ingress
extensively but then regress. Therefore, CYK-4 may function after LET-502.
CYK-1/formin also functions late in cleavage, possibly by regulating the
stability of the ingressed furrow until it can be disassembled
(Swan et al., 1998
). LET-502
and MEL-11 are still localized to furrows in embryos mutant for late
cyk-1 function. LET-502 could be involved in regulating CYK-1's
localization for its late function, as CYK-1 localization is partially
disrupted in let-502 mutant embryos.
A caveat in our work is that the mutations and RNAi may not completely eliminate LET-502 activity in early embryos. LET-502 is involved in oocyte cellularization, and completely depleting LET-502 might prevent proper oocyte partitioning, precluding the examination the role of LET-502 during the subsequent mitotic cleavages. Therefore, low levels of LET-502 sufficient for oocyte formation could be present in the embryos and also may be responsible for the cleavage furrows we sometimes observed in those embryos. However, we favour the possibility that residual oocyte formation and the sometimes normal mitotic cleavages may reflect the existence of a parallel pathway that can regulate cleavage furrow contraction in the absence of let-502.
In both cytokinesis and morphogenesis, simultaneous loss of mel-11
and let-502 resembles wildtype
(Wissmann et al., 1997
;
Wissmann et al., 1999
;
Piekny et al., 2000
). This
suggests that redundant pathways regulate contraction in the absence of both
let-502 and mel-11. During elongation, this redundant
pathway includes fem-2 [PP2c phosphatase
(Pilgrim et al., 1995
;
Chin-Sang and Spence, 1996
;
Piekny et al., 2000
]; however,
genetic experiments indicate that fem-2 is not involved in the
redundant pathway during cytokinesis (P.M., unpublished). In higher
eukaryotes, the ROK-related kinase, citron-k, is involved in cytokinesis
(Madaule et al., 1998
). The
C. elegans citron-like genes (F59A6.5 and W02B8.2) do not encode
kinase domains, and RNAi to either gene in wild-type or
let-502(sb106) worms has no effect on cytokinesis (A.P.,
unpublished). Future work will be needed to uncover the elements of the
cytokinetic pathway acting in parallel to let-502 and
mel-11.
C. elegans ROK (LET-502) and MYPT (MEL-11) are used repeatedly for
different contractile events in the worm. They regulate morphogenesis, the
process whereby actin-mediated contractions within epidermal cells cause the
cells to change shape to drive elongation of the embryo
(Priess and Hirsh, 1986
;
Wissmann et al., 1997
;
Piekny et al., 2000
). In
let-502 mutants, the epidermal cells fail to contract, whereas in
mel-11 mutants, the epidermal cells hypercontract. let-502
and mel-11 mutants suppress one another's defects, implying that they
function together (and antagonistically) to regulate the cell shape changes
(Wissmann et al., 1997
;
Piekny et al., 2000
).
let-502 and mel-11 also regulate contraction of the
spermatheca, an organ used for oocyte fertilization
(Wissmann et al., 1999
), and
weak alleles of either gene cause sterility owing to failed oocyte
fertilization. However, unlike elongation, let-502 and
mel-11 mutants are not able to suppress one another's sterility and
indeed are expressed in different regions of the spermatheca
(Wissmann et al., 1999
). In
the present work, we describe the role of let-502 and mel-11
in another contractile event, cytokinesis. As in morphogenesis,
let-502 and mel-11 function together to regulate cleavage
furrow ingression. However, genes involved in cytokinesis, such as cyk-1,
nmy-2 and cyk-4 have no apparent role in morphogenesis
(Swan et al., 1998
;
Guo and Kemphues, 1996
;
Janstch-Plunger et al., 2000
),
whereas genes involved in morphogenesis, such as fem-2, unc-73 and
mig-2 do not appear to function in cytokinesis
(Pilgrim et al., 1995
;
Steven et al., 1998
;
Zipkin et al., 1997
;
Wissmann et al., 1999
;
Piekny et al., 2000
) (P.M.,
unpublished). Therefore, let-502 and mel-11 act in concert
with different genes during elongation and cytokinesis, suggesting that the
`contractile cassette' functions with different genes in different
tissues.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Amano, M., Ito, M., Kimura, K., Fukata, Y., Chihara, K., Nakano,
T., Matsuura, Y. and Kaibuchi, K. (1996). Phosphorylation and
activation of Myosin by Rho-associated kinase (Rho-kinase). J.
Biol. Chem. 271,20246
-20249.
Brenner, S. (1974). The genetics of
Caenorhabditis elegans. Genetics
77, 71-94.
Chin-Sang, I. and Spence, A. M. (1996).
Caenorhabditis elegans sex-determining protein FEM-2 is a protein
phosphatase that promotes male development and interacts directly with FEM-3.
Genes Dev. 10,2314
-2325.
DeBiasio, R. L., LaRocca, G. M., Post, P. L. and Taylor, D. L. (1996). Myosin II transport, organization, and phosphorylation: evidence for cortical flow/solation-contraction coupling during cytokinesis and cell locomotion. Mol. Biol. Cell 7,1259 -1282.[Abstract]
Di Cunto, F., Imarisio, S., Hirsch, E., Broccoli, V., Bulfone, A., Migheli, A., Atzori, C., Turco, E., Triolo, R., Dotto, G. P. et al. (2000). Defective neurogenesis in citron kinase knockout mice by altered cytokinesis and massive apoptosis. Neuron 28,115 -127.[Medline]
Drechsel, D. N., Hyman, A. A., Hall, A. and Glotzer, M. (1996). A requirement for Rho and Cdc42 during cytokinesis in Xenopus embryos. Curr. Biol. 7, 12-23.
Edgley, M., Baillie, D. L., Riddle, D. L. and Rose, A. M. (1995). Genetic balancers. In Caenorhabditis elegans: Modern Biological Analysis of an Organism (ed. H. F. Epstein and D. C. Shakes), pp. 147-184. San Diego: Academic Press.
Field, C., Li, R. and Oegema, K. (1999). Cytokinesis in eukaryotes: a mechanistic comparison. Curr. Opin. Cell Biol. 11,68 -80.[Medline]
Gallagher, P. J., Herring, B. P. and Stull, J. T. (1997). Myosin light chain kinases. J. Muscle Res. Cell Motil. 18,1 -16.[Medline]
Glotzer, M. (2001). Animal cell cytokinesis. Annu. Rev. Cell Dev. Biol. 17,351 -386.[Medline]
Guo, S. and Kemphues, K. J. (1996). A non-muscle myosin required for embryonic polarity in Caenorhabditis elegans. Nature 382,455 -458.[Medline]
Hodgkin, J. (1997). Appendix 1: Genetics. In C. elegans II (ed. D. L. Riddle, T., Blumenthal, B. J. Meyer, and J. R. Priess), pp. 881-1047. Cold Spring Harbor: Cold Spring Harbor Laboratory Press.
Hodgkin, J., Edgley, M., Riddle, D. L. and Albertson, D. G. (1988). Genetics. In The Nematode Caenorhabditis elegans (ed. W. B. Wood), pp. 491-586. Cold Spring Harbor: Cold Spring Harbor Laboratory Press.
Jantsch-Plunger, V., Gonczy, P., Romano, A., Schnabel, H.,
Hamill, D., Schnabel, R., Hyman, A. A. and Glotzer, M.
(2000). CYK-4: A Rho family GTPase activating protein (GAP)
required for central spindle formation and cytokinesis. J. Cell
Biol. 149,1391
-1404.
Karess, R. E., Chang, X. J., Edwards, K. A., Kulkarni, S., Aguilera, I. and Kiehart, D. P. (1991). The regulatory light chain of nonmuscle Myosin is encoded by spaghetti-squash, a gene required for cytokinesis in Drosophila. Cell 65,1177 -1189.[Medline]
Katoh, K., Kano, Y., Amano, M., Onishi, H., Kaibuchi, K. and K.
Fujiwara, K. (2001). Rho-Kinase-mediated contraction of
isolated stress fibers. J. Cell Biol.
153,569
-583.
Kawano, Y., Fukata, Y., Oshiro, N., Amano, M., Nakamura, T.,
Ito, M., Matsumura, F., Inagaki, M. and Kaibuchi, K. (1999).
Phosphorylation of myosin-binding subunit (MBS) of myosin phosphatase by
Rho-kinase in vivo. J. Cell Biol.
147,1023
-1037.
Kay, A. J. and Hunter, C. P. (2001). CDC-42 regulates PAR protein localization and function to control cellular and embryonic polarity in C. elegans. Curr. Biol. 11,474 -481.[Medline]
Kemphues, K. J., Kusch, M. and Wolf, N. (1988).
Maternal-effect lethal mutations on linkage group II of Caenorhabditis
elegans. Genetics 120,977
-986.
Kimble, J. and Ward, S. (1988). Germline development. In The Nematode Caenorhabditis elegans (ed. W. B. Wood), pp. 191-214. Cold Spring Harbor: Cold Spring Harbor Laboratory Press.
Kimura, K., Ito, M., Amano, M., Chihara, K., Fukata, Y., Nakafuku, M., Yamamori, B., Feng, J., Nakano, T., Okawa, K. et al. (1996). Regulation of myosin phosphatase by Rho and Rho-associated kinase (Rho-kinase). Science 273,245 -248.[Abstract]
Kosako, H., Goto, H., Yanagida, M., Matsuzawa, K., Fujita, M., Tomono, Y., Okigaki, T., Odai, H., Kaibuchi, K. and Inagaki, M. (1999). Specific accumulation of Rho-associated kinase at the cleavage furrow during cytokinesis: cleavage furrow-specific phosphorylation of intermediate filaments. Oncogene 18,2783 -2788.[Medline]
Kosako, H., Yoshida, T., Matsumura, F., Ishizaki, T., Narumiya, S. and Inagaki, M. (2000). Rho-kinase/ROCK is involved in cytokinesis through the phosphorylation of myosin light chain and not ezrin/radixin/moesin proteins at the cleavage furrow. Oncogene 19,6059 -6064.[Medline]
Mackay, D. J. G. and Hall, A. (1998). Rho
GTPases. J. Biol. Chem.
273,20685
-20688.
Madaule, P., Eda, M., Watanabe, N., Fujisawa, K., Matsuoka, T., Bito, H., Ishizaki, T. and Narumiya, S. (1998). Role of citron kinase as a target of the small GTPase Rho in cytokinesis. Nature 394,491 -494.[Medline]
Piekny, A. J., Wissmann, A. and Mains, P. E.
(2000). Embryonic morphogenesis in Caenorhabditis
elegans integrates the activity of LET-502 Rho-binding kinase, MEL-11
myosin phosphatase, DAF-2 insulin receptor and FEM-2 PP2c phosphatase.
Genetics 156,1671
-1689.
Pilgrim, D., McGregor, A., Jackle, P., Johnson, T. and Hansen, D. (1995). The Caenhorabditis elegans sex-determining gene fem-2 encodes a putative protein phosphatase. Mol. Biol. Cell 6,1159 -1171.[Abstract]
Poperechnaya, A., Varlamova, O., Lin, P., Stull, J. T. and
Bresnick, A. R. (2000). Localization and activity of myosin
light chain kinase isoforms during the cell cycle. J. Cell
Biol. 151,697
-707.
Priess, J. R. and Hirsh, D. I. (1986). Caenorhabditis elegans morphogenesis: the role of the cytoskeleton in elongation of the embryo. Dev. Biol. 117,156 -173.[Medline]
Prokopenko, S. N., Brumby, A., O'Keefe, L., Prior, L., He, Y.,
Saint, R. and Bellen, H. J. (1999). A putative exchange
factor for Rho1 GTPase is required for initiation of cytokinesis in
Drosophila. Genes. Dev.
13,2301
-2314.
Prokopenko, S. N., Saint, R. and Bellen, H. J.
(2000). Untying the Gordian knot of cytokinesis: role of small G
proteins and their regulators. J. Cell Biol.
148,843
-848.
Raich, W. B., Moran, A. N., Rothman, J. H. and Hardin, J.
(1998). Cytokinesis and midzone microtubule organization in
Caenorhabditis elegans require the kinesin-like protein ZEN-4.
Mol. Biol. Cell 9,2037
-2049.
Robinson, D. N. and Spudich, J. A. (2000). Towards a molecular understanding of cytokinesis. Trends Cell Biol. 10,228 -236.[Medline]
Shelton, C. A., Carter, J. C., Ellis, G. C. and Bowerman, B. (1999). The nonmuscle myosin regulatory light chain gene mlc-4 is required for cytokinesis, anterior-posterior polarity, and body morphology during Caenorhabditis elegans embryogenesis. J. Cell Biol. 146,439 -451.[Medline]
Smith, J. L., Silveira, L. A. and Spudich, J. A.
(1996). Myosin light chain kinase (MLCK) gene disruption in
Dictyostelium: A role for MLCK-A in cytokinesis and evidence for
multiple MLCKs. Proc. Natl. Acad. Sci. USA
93,12321
-12326.
Somlyo, A. P. and Somlyo, A. V. (2000). Signal
transduction by G-proteins, Rho-kinase and protein phosphatase to smooth
muscle and non-muscle myosin II. J. Physiol.
522,177
-185.
Steven, R., Kubiseski, T. J., Zheng, H., Kulkarni, S., Mancillas, J., Ruiz Morales, A., Hogue, C. W., Pawson, T. and Culotti, J. (1998). UNC-73 activates the Rac GTPase is required for cell and growth cone migrations in C. elegans. Cell 92,785 -795.[Medline]
Sulston, J. and Hodgkin, J. (1988). Methods. In The Nematode Caenorhabditis elegans (ed. W. B. Wood), pp. 587-606. Cold Spring Harbor: Cold Spring Harbor Laboratory Press.
Swan, K. A., Severson, A. F., Carter, J. C., Martin, P. R., Schnabel, H., Schnabel, R. and Bowerman, B. (1998). cyk-1: a C. elegans FH gene required for a late step in embryonic cytokinesis. J. Cell Sci. 111,2017 -2027.[Abstract]
Sward, K., Dreja, K., Susnjar, M., Hellstrand, P., Hartshorne,
D. J. and Walsh, M. P. (2000). Inhibition of Rho-associated
kinase blocks agonist-induced Ca2+ sensitization of myosin
phosphorylation and force in guinea-pig ileum. J.
Physiol. 522,33
-49.
Totsukawa, G., Yamakita, Y., Yamashiro, S., Hosoya, H.,
Hartshorne, D. J. and Matsumura, F. (1999). Activation of
myosin phosphatase targeting subunit by mitosis-specific phosphorylation.
J. Cell Biol. 144,735
-744.
Totsukawa, G., Yamakita, Y., Yamashiro, S., Hartshorne, D. J.,
Sasaki, Y. and Matsumura, F. (2000). Distinct roles of ROCK
(Rho-kinase) and MLCK in spatial regulation of MLC phosphorylation for
assembly of stress fibers and focal adhesions in 3T3 fibroblasts.
J. Cell Biol. 150,797
-806.
Waddle, J. A., Cooper, J. A. and Waterston, R. H. (1994). Transient localized accumulation of actin in Caenorhabditis elegans blastomeres with oriented asymmetric divisions. Development 120,2317 -2328.[Abstract]
Winter, C. G., Wang, B., Ballew, A., Royou, A., Karess, R., Axelrod, J. D. and Luo, L. (2001). Drosophila Rho-associated kinase (Drok) links Frizzled-mediated Planar cell polarity signaling to the actin cytoskeleton. Cell 105, 81-91.[Medline]
Wissmann, A., Ingles, J., McGhee, J. D. and Mains, P. E.
(1997). Caenorhabditis elegans LET-502 is related to
Rho-binding kinases and human myotonic dystrophy kinase and interacts
genetically with a homolog of the regulatory subunit of smooth muscle myosin
phosphatase to affect cell shape. Genes Dev.
11,409
-422.
Wissmann, A., Ingles, J. and Mains, P. E. (1999). The Caenorhabditis elegans mel-11 myosin phosphatase regulatory subunit affects tissue contraction in the somatic gonad and the embryonic epidermis and genetically interacts with the Rac signaling pathway. Dev. Biol. 209,111 -127.[Medline]
Yasui, Y., Amano, M., Nagata, K., Inagaki, N., Nakamura, H.,
Saya, H., Kaibuchi, K. and Inagaki, M. (1998). Roles of
Rho-associated kinase phosphorylation sites impair cytokinetic segregation of
glial filaments. J. Cell Biol.
143,1249
-1258.
Zipkin, I. D., Kindt, R. M. and Kenyon, C. J. (1997). Role of a new Rho family member in cell migration and axon guidance in C. elegans. Cell 90,883 -894.[Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
C. Gally, F. Wissler, H. Zahreddine, S. Quintin, F. Landmann, and M. Labouesse Myosin II regulation during C. elegans embryonic elongation: LET-502/ROCK, MRCK-1 and PAK-1, three kinases with different roles Development, September 15, 2009; 136(18): 3109 - 3119. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Nadarajan, J. A. Govindan, M. McGovern, E. J. A. Hubbard, and D. Greenstein MSP and GLP-1/Notch signaling coordinately regulate actomyosin-dependent cytoplasmic streaming and oocyte growth in C. elegans Development, July 1, 2009; 136(13): 2223 - 2234. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Kanada, A. Nagasaki, and T. Q.P. Uyeda Novel Functions of Ect2 in Polar Lamellipodia Formation and Polarity Maintenance during "Contractile Ring-Independent" Cytokinesis in Adherent Cells Mol. Biol. Cell, January 1, 2008; 19(1): 8 - 16. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Deng, D. Xia, B. Fang, and H. Zhang The Flightless I Homolog, fli-1, Regulates Anterior/Posterior Polarity, Asymmetric Cell Division and Ovulation During Caenorhabditis elegans Development Genetics, October 1, 2007; 177(2): 847 - 860. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Schmutz, J. Stevens, and A. Spang Functions of the novel RhoGAP proteins RGA-3 and RGA-4 in the germ line and in the early embryo of C. elegans Development, October 1, 2007; 134(19): 3495 - 3505. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. B. Goulding, J. C. Canman, E. N. Senning, A. H. Marcus, and B. Bowerman Control of nuclear centration in the C. elegans zygote by receptor-independent G{alpha} signaling and myosin II J. Cell Biol., September 24, 2007; 178(7): 1177 - 1191. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Garcia, Z. Ucurum, R. Bucher, D. I. Svergun, T. Huber, A. Lustig, P. V. Konarev, M. Marino, and O. Mayans Molecular insights into the self-assembly mechanism of dystrophia myotonica kinase FASEB J, June 1, 2006; 20(8): 1142 - 1151. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. E. Dawes-Hoang, K. M. Parmar, A. E. Christiansen, C. B. Phelps, A. H. Brand, and E. F. Wieschaus folded gastrulation, cell shape change and the control of myosin localization Development, September 15, 2005; 132(18): 4165 - 4178. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Wang, A. Spang, M. A. Sullivan, J. Hryhorenko, and F. K. Hagen The Terminal Phase of Cytokinesis in the Caenorhabditis elegans Early Embryo Requires Protein Glycosylation Mol. Biol. Cell, September 1, 2005; 16(9): 4202 - 4213. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. P. D'Avino, M. S. Savoian, and D. M. Glover Cleavage furrow formation and ingression during animal cytokinesis: a microtubule legacy J. Cell Sci., April 15, 2005; 118(8): 1549 - 1558. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Glotzer The Molecular Requirements for Cytokinesis Science, March 18, 2005; 307(5716): 1735 - 1739. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. E. M. A. van Herpen, R. J. A. Oude Ophuis, M. Wijers, M. B. Bennink, F. A. J. van de Loo, J. Fransen, B. Wieringa, and D. G. Wansink Divergent Mitochondrial and Endoplasmic Reticulum Association of DMPK Splice Isoforms Depends on Unique Sequence Arrangements in Tail Anchors Mol. Cell. Biol., February 15, 2005; 25(4): 1402 - 1414. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. P. D'Avino, M. S. Savoian, and D. M. Glover Mutations in sticky lead to defective organization of the contractile ring during cytokinesis and are enhanced by Rho and suppressed by Rac J. Cell Biol., July 5, 2004; 166(1): 61 - 71. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. CEULEMANS and M. BOLLEN Functional Diversity of Protein Phosphatase-1, a Cellular Economizer and Reset Button Physiol Rev, January 1, 2004; 84(1): 1 - 39. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Piekny, J.-L. F. Johnson, G. D. Cham, and P. E. Mains The Caenorhabditis elegans nonmuscle myosin genes nmy-1 and nmy-2 function as redundant components of the let-502/Rho-binding kinase and mel-11/myosin phosphatase pathway during embryonic morphogenesis Development, December 1, 2003; 130(23): 5695 - 5704. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||