|
|
![]() |
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
Research Article |
INSERM U362, Laboratoire Hématopoïèse et Cellules Souches, Institut Gustave Roussy, 39 rue Camille Desmoulins, Villejuif, France
* Author for correspondence (e-mail: millot{at}ijm.jussieu.fr )
Accepted 11 March 2002
| Summary |
|---|
|
|
|---|
Key words: Mpl, Threshold activation level, Proliferation, Survival, Signaling pathways
| Introduction |
|---|
|
|
|---|
The function of the Mpl/TPO system is well characterized. Numerous
experiments have shown that TPO stimulates proliferation and differentiation
of megakaryocytic progenitors in vitro and in vivo
(Debili et al., 1995b
;
Kaushansky et al., 1995
). More
recently, Mpl- and TPO-deficient mice were reported to exhibit a drastic
decrease in the number of platelets and cells of the megakaryocytic lineage
(Gurney et al., 1994
),
demonstrating a major role for Mpl activation in megakaryopoiesis and platelet
production. The Mpl/TPO system also acts on more primitive cells. Mpl- and
TPO-deficient mice showed a 50% reduction in the absolute number of all
myeloid-committed progenitors (Alexander et
al., 1996
). In vitro, TPO alone promotes survival of early
hematopoietic progenitors (Jacobsen et
al., 1996
; Borge et al.,
1997
; Matsunaga et al.,
1998
) and in combination with early-acting cytokines such as stem
cell factor (SCF), FLT3 ligand or interleukin 3 (IL-3) it greatly increases
the production of committed progenitors
(Ku et al., 1996
;
Ramsfjell et al., 1996
;
Ramsfjell et al., 1997
). These
data indicate that, in addition to its essential function for
megakaryopoiesis, Mpl activation is required to maintain and/or expand early
and committed myeloid progenitor cells.
Binding of TPO to the Mpl receptor leads to the phosphorylation and
activation of numerous signaling molecules, including those in the JAK/STAT
pathway, the MAPK pathway and the PI3K pathway
(Drachman et al., 1995
;
Sattler et al., 1997
;
Matsumura et al., 1998
). Their
involvement in cellular events such as survival, proliferation and
differentiation has been described but their precise role in TPO-mediated
biological responses is not fully understood.
In the present study, we show that signaling pathways activated by TPO produce distinct effects in Mpl-transduced BaF-3 cells, depending on the level of expression of Mpl on the cell surface. TPO mediates cell proliferation in cells expressing high levels of cell surface Mpl, whereas it mediates cell survival alone (without proliferation) in cells expressing low levels of the Mpl receptor. In addition, we defined the roles of Mpl signaling pathways in these different effects.
| Materials and Methods |
|---|
|
|
|---|
Cell lines
The murine cell line BaF-3 (Palacios
and Steinmetz, 1985
) and BaF3-Mpl clones were maintained in RPMI
1640 medium (Gibco, Paisley, UK) supplemented with 10% fetal calf serum (FCS,
Gibco) and 3% WEHI-3B-conditioned medium. NIH-3T3 and 293 EBNA (Invitrogen,
Groningen, The Netherlands) cell lines were cultured in DMEM medium (Gibco)
with 10% FCS.
Plasmid constructs
Full-length human c-DNA from pZen-MplP-SVNeo
(Goncalves et al., 1997
) was
used for constructions. To introduce the Flag epitope tag, a 115 bp
oligonucleotide duplex
5'-cgttaacatgttccatgtttcttttagatatatctttggaattcctccactgatccttgttctgctgcctgtcactagttctgattacaaagatgacgatgacaagccgtcttct-3'
/
5'-ctagagaagacggcttgtcatcgtcatctttgtaatcagaactagtgacaggcagcagaacaaggatcagtggaggaattccaaagatatatctaaaagaaacatggaacatgttaacgagct-3'
encoding the IL-7 leader (Park et al.,
1990
), the Flag sequences
(Brizzard et al., 1994
) and
BbsI restriction site were inserted into the
SacI/XbaI sites of the vector pBluescript II (Stratagene, La
Jolla, CA) to obtain the plasmid pSKFlag. To introduce the Mp1 coding sequence
in frame with the IL7 and Flag sequences, a part of the extracellular domain
of Mpl was amplified with a 0.1 µg of pZen-Mp1P-SVNeo with a sense primer
(5'-cctagaagacctcaagcaagatgtctccttg-3'), corresponding to the
BbsI restriction site, cohesive end on the pSKFlag after cutting with
BbsI, and Mpl sequence starting immediately after the leader coding
sequence, and an antisense primer (5'-gttccaccctctgctgtcag-3')
located downstream of HindIII site in the Mp1 cDNA. After cutting
with BbsI and HindIII, the PCR product was ligated into the
corresponding sites of the pSKFlag vector. A HindIII/XhoI
fragment from pZen-Mpl-SVNeo was inserted into the corresponding sites of this
plasmid in order to obtain the full-length Flag-Mpl cDNA. The fidelity of
inserts was confirmed by sequencing. Flag-Mpl cDNA was then subcloned into the
HpaI/XhoI sites of the murine stem cell virus-based
bicistronic retroviral vector MIGR-IRES-GFP (generous gift of J. P. Miller,
University of Pennsylvania, Philadelphia, PA) in which the original polylinker
(BglII, XhoI, HpaI and EcoRI) was replaced
by the sequence 5'-gatctagaattctgtcgacagttaactgcggccgcactcgag-3'
and the SalI site downstream of GFP was mutated by SalI
cutting, blunting by Klenow and religation.
Retroviral infection
The Flag-Mpl receptor construct cloned into the retroviral vector
MIGR-IRES-GFP enables the simultaneous expression of the receptor protein and
the green fluorescent protein (GFP), and allows the selection of infected
cells based on GFP expression using a fluorescence-activated cell sorter
(FACS). Transient MIGR-Flag-Mpl supernatant production was accomplished by
transfecting the 293 EBNA cell line that has an amphotropic host range. To
improve the stability of the retrovirus particles, we chose a vesicular
stomatitis virus G (VSV-G) pseudotyping technique. Briefly, 0.5 µg of each
MIGR-Flag-Mpl, VSV-G and gag-pol plasmids were co-transfected using EXGEN
reagent according to the manufacturer's recommendations (Euromedex,
Souffelweyersheim, France). Cells were washed at 24 hours and supernatants
were collected at 48 hours, filtered and frozen at -80°C. This strategy
regularly gives a transfection efficiency of 50% and a viral titer of
106 CFU/ml by monitoring the number of GFP-positive cells in the
NIH-3T3 cell line (data not shown).
Supernatants were used to infect BaF-3 cells. Cells were washed once and 105 cells were cultured for 48 hours in 6-well tissue culture plates (Falcon Grenoble, France) containing 2 ml of RPMI, 10% FCS, 6% WEHI-3B, 50% retroviral supernatant and 4 µg/ml of polybrene. After infection, cells were maintained in RPMI, 10% FCS, 3% WEHI-3B for 2 days. Highly GFP-positive cells were then cloned at one cell per well into 96-well tissue culture plates using a FACS Vantage flow cytometer (Becton Dickinson, San Jose, CA). These BaF3-Mpl clones were named Clone A, B, C... and were used as clones expressing high levels of Mpl receptor on their cell surface. To obtain clones expressing low levels of Mpl on their cell surface, a pool of faintly GFP-positive cells was also sorted and maintained in RPMI, 10% FCS, 3% WEHI-3B for 7 days. Cells were then labeled with anti-Flag and PE-goat anti-mouse antibodies as described below, and Flag-positive cells were cloned at one cell per well into 96-well tissue culture plates using the FACS Vantage flow cytometer. Thirty clones were randomly selected and named clone 1, 2, 3... 30. To increase Mpl expression in the low-level-expressing clones, clones 8, 16 and 28 were retransduced with the Mpl retroviral construct as described above for BaF-3 parental cells, and a pool of highly GFP- and Flag-positive cells were sorted. These three retransduced pools derived from clones 8, 16 and 28 were named clone 8+, 16+ and 28+. To avoid any alteration in the Mpl cell surface expression, aliquots of each clone were thawed every 3 weeks and during this lapse of time, receptor expression was regularly monitored by flow cytometric analysis.
Proliferation assays
Cells were washed three times and 2500 cells per well were plated into
96-well tissue culture plates (Falcon) containing RPMI, 10% FCS and the
indicated concentration of TPO or 5% WEHI-3B as a control. After incubation at
37°C for the indicated time, 10 µCi of [3H]thymidine
(specific activity 185 GBq/mmol; Amersham, Courtab
uf, France) was added
to each well and the cells further incubated for 4 hours at 37°C prior to
scintillation counting.
Cell stimulation
Cells were washed three times and resuspended at 4x106
cells/ml in RPMI alone. After a starvation of 3 hours at 37°C, cells were
left unstimulated or stimulated with 50 ng/ml of TPO for 15 minutes at
37°C. When used, inhibitors were added at the indicated concentration 30
minutes before TPO stimulation. For long-term stimulation, cells were washed
three times and directly resuspended at 2x106 cells/ml (for
western blots analysis) or 4x105 cells/ml (for apoptosis
analysis) in RPMI, 10% FCS with 10 ng/ml of TPO. When used, inhibitors were
added at the indicated concentration together with TPO. DMSO (Sigma) was used
as a control for the inhibitor studies at 1.4 µl/ml, which corresponded to
the maximum concentration of DMSO present during these experiments.
Flow cytometric analysis
A saturating concentration of antibodies was used for all labeling. Because
binding of M1 anti-Flag antibody is dependent on calcium, 1 mM of
CaCl2 was added to the buffer during all incubations and washes.
Cells (5x105/sample) were washed and incubated in PBS and
0.5% FCS for 10 minutes at 4°C with 8.4 µg/ml of mouse M1 anti-Flag
antibody or left unlabelled. After two washes, cells were labeled with 0.4
µg/ml of PE-conjugated goat anti-mouse antibody for 20 minutes at 4°C.
Cells were then washed once and analysed for fluorescence with a FACScan flow
cytometer (Becton Dickinson). For apoptosis analysis, 4x105
cells were collected from stimulated cultures (see above), washed once and
labeled overnight in 400 µl of citrate buffer containing 25 µg/ml PI, 50
µg/ml RNase (Merck, Darmstadt, Germany) and 0.1% Nonidet P40 (Sigma), in
the dark at 4°C. Percentages of apoptotic cells, corresponding to cells
with sub-cell cycle PI incorporation, were determined by flow cytometry using
a FACSort (Becton Dickinson).
Western blot analysis
Cell stimulation was blocked by washing cells with 50 ml of cold
1xPBS. Total cell lysates were obtained by incubating 108
cells/ml in a hypertonic buffer containing 1/100 Triton X-100, 20 mM Hepes pH
7.9, 350 mM NaCl, 10 mM KCl, 1 mM EDTA pH 8, 20% glycerol, 1/25 Complete
Protease Inhibitors (Boehringer Mannheim, Germany) and 1 mM
Na2SO4. Lysates were incubated for 30 minutes at
4°C, centrifuged at 13,000 g for 6 minutes at 4°C,
then supernatants were stored at -80°C until used. Protein concentration
was determined using the Bio-Rad DC Protein colorimetric assay (Hercules, CA).
Unless specified, 60 µg of protein per sample was used and further analysed
as described (Rosa Santos et al.,
2000
).
| Results |
|---|
|
|
|---|
|
Clones A and C exhibited a proliferative response to TPO (Fig. 1B) but only clone 14, which expressed an equivalent level of Mpl on the cell surface, was able to give a similar result. Although expressing significant levels of Mpl on their cell surface, [3H]thymidine incorporation by clones 16, 8 and 28 after TPO treatment was low and not significantly different from that of BaF-3 parental cells, even when the TPO concentration exceeded 100 ng/ml (data not shown). This result indicated that a threshold level of activated Mpl was necessary for TPO-mediated proliferation of BaF-3 cells. When signaling pathway activities were studied, phosphorylation levels of STAT5, ERK and AKT were found to be very similar for clones 14, A and C after 15 minutes of TPO stimulation (Fig. 1C). These signaling pathways were also activated in clones 16, 8 and 28, but at a lower level than that observed for clones 14, A and C. These results therefore suggested that proliferation of Mpl-transduced BaF-3 cells requires a threshold activation level of Mpl signaling pathways.
Overexpression of Mpl in low-Mpl-expressing clones restores
TPO-induced cell proliferation
To confirm that insufficient Mpl cell surface expression was responsible
for the absence of TPO-mediated proliferation, clones 16, 8 and 28 were
retransduced with the Mpl retroviral construct and, for each clone, the most
Flag-positive cells were sorted. These three Mpl-overexpressing clones were
named clone 16+, 8+ and 28+ (Table
1). After 48 hours of TPO stimulation, a proliferative response
similar to that of clone 14 was observed for clones 16+, 8+ and 28+, in
contrast to the absence of [3H]thymidine incorporation by parental
clones 16, 8 and 28 (Fig. 2A;
Fig. 1B). This indicated that
the low Mpl expression on the cell surface was responsible for the absence of
TPO-mediated proliferation of clone 16, 8 and 28. Study of signaling pathways
demonstrated that the phosphorylation levels of STAT5, ERK and AKT were
significantly increased after 15 minutes of TPO stimulation for clones 16+, 8+
and 28+ compared with parental clones 16, 8 and 28, and in fact were similar
to the phosphorylation levels observed in clone 14
(Fig. 2B;
Fig. 1C). This suggested that a
threshold activation level of Mpl signaling pathways was necessary for
TPO-mediated proliferation of Mpl-transduced BaF-3 cells.
|
|
TPO induces a survival effect in low-Mpl-expressing clones
The anti-apoptotic effect of TPO was examined by quantifying the sub-G1
peak after propidium iodide incorporation. As expected, parental BaF-3 cells
exhibited an identical pattern of time-dependent appearance of apoptotic cells
when either cytokine-deprived or stimulated with TPO
(Fig. 3). In contrast, 10 ng/ml
of TPO fully inhibited apoptosis of clone 14
(Fig. 3) and clone A (data not
shown), even after 34 hours of stimulation, whereas more than 80% of the cells
were in the sub-G1 peak after 34 hours of cytokine deprivation. At this
concentration, a clear anti-apoptotic effect of TPO was also observed in
clones with low levels of Mpl expression. Therefore, although insufficient for
TPO-induced cell proliferation, the level of Mpl cell surface expression of
clones 16, 8 and 28 was sufficient to provide TPO-mediated cell survival.
However, this effect was transient, as it did not permanently protect cells
from apoptosis but delayed its appearance. Indeed, compared with
cytokine-deprived cells, the TPO-induced survival effect was maximal at 15
hours for clone 16 (73% versus 36% of apoptotic cells, respectively, a
decrease of 37%), at 21 hours for clone 8 (a decrease of 40%) and at 24 hours
for clone 28 (a decrease of 72%).
|
The influence of TPO concentration was also studied (Fig. 4). A TPO concentration of between 10 pg/ml and 1 ng/ml was required for both proliferation and survival events in clones 14 and A. In contrast, clones 16, 8 and 28 responded to increasing TPO concentrations by yielding reduced numbers of apoptotic cells, but without a significant change in [3H]thymidine incorporation. Therefore, TPO mediated distinct effects in Mpl-transduced BaF-3 cells, depending on a threshold level of activated Mpl: TPO induced proliferation at high levels of cell surface expression of Mpl, but survival alone without a proliferative effect at low levels of Mpl expression. The survival effect remained transient in low-Mpl-expressing clones, even when TPO concentrations exceeded 100 ng/ml (data not shown).
|
Study of Mpl signaling pathways indicated that ERK and AKT were still activated after 9 hours of TPO stimulation in clones 16, 8 and 28, but to a lesser extent than in clone 14 and A (Fig. 5A). However, phosphorylation of STAT5 was clearly observed in clones 14 and A, but was at the limit of detection in clone 28 and not detectable in clones 8 and 16.
|
Cytokines suppress apoptosis by regulating expression of bcl-2 family
members. STAT5 regulates the expression of the anti-apoptotic protein
Bcl-XL and the pro-apoptotic signaling protein BAD is inactived
after phosphorylation by AKT (del Peso et
al., 1997
; Dumon et al.,
1999
). In our clones, the expression level of Bcl-XL
did not correlate with the phosphorylation level of Mpl signaling pathways.
After 3 hours of TPO stimulation, the expression level was slightly decreased
in clone 14 and A, compared with clone 16, 8 and 28, and was similar between
clones after 9 hours of TPO stimulation
(Fig. 5B). This suggests that
the TPO-mediated survival effect observed in Mpl-expressing clones did not
depend on the expression level of Bcl-XL. In contrast, TPO-induced
phosphorylation of BAD in clones 16, 8 and 28 after 3 hours of stimulation,
compared with unstimulated cells (Fig.
5B). This result indicated that the activation level of signaling
pathways in clones with low levels of Mpl expression, was sufficient to
inactivate BAD. Moreover, the phosphorylation level of BAD decreased markedly
in clones 8 and 28 after 9 hours of TPO stimulation, and was at the limit of
detection in clone 16, whereas it was still observed in clones 14 and A. This
result indicated that BAD was transiently inactivated by TPO in clones with
low levels of Mpl expression and this phenomenon correlated with the transient
nature of the alternative TPO-mediated survival effect.
Analyses of Mpl signaling pathways involved in the TPO-mediated
proliferative and survival effect
Inhibition of ERK activation with 50 µM of the MEK inhibitor PD98059
resulted in a more than twofold decrease of TPO-mediated proliferation in
clone A (3642±359 cpm of [3H]thymidine incorporation, versus
10,213±453 cpm with TPO alone; Fig.
6A) and clone 14 (3765±388 cpm versus 7981±243 cpm,
data not shown). A similar effect was obtained with 10 µM of the P13K
inhibitor LY294002 (3423±117 cpm for clone A,
Fig. 6A; and 2639±163
for clone 14, data not shown). These results indicated that the activation
level of both MAPK p42/44 and P13K pathways was a determining factor for the
TPO-mediated proliferation of Mpl-transduced BaF-3 cells.
|
The P13K inhibitor LY294002 at a concentration of 10 µM fully abolished phosphorylation of AKT after TPO stimulation but did not abolish ERK or STAT5 actively (Fig. 6B). At this concentration, the transient survival effect of clone 28 after 22 hours of TPO stimulation (Fig. 6C) was decreased twofold with 80% apoptotic cells, versus 44% with solvent alone (DMSO). This result indicated that the PI3K inhibitor strongly inhibited the TPO-mediated survival effect, since the percentage of dead cells increased to approximately the same level as that observed without TPO stimulation (99%). The same result was obtained with clone 8 (69% apoptotic cells with LY294002, 35% with DMSO alone and 89% without TPO stimulation; data not shown). In combination, these results indicated that the activation level of the PI3K pathway was a determining factor for the alternative TPO-mediated survival effect. However, 10 µM of LY294002 did not affect the TPO-mediated survival of clones A and 14 (Fig. 6C, and data not shown), even though activity was totally abolished in clone A (Fig. 6B) and although TPO-mediated proliferation was partially inhibited by LY294002 in clone A (Fig. 6A) and clone 14 (data not shown). These results therefore indicated that activation of the PI3K pathway was not essential for survival when Mpl-transduced BaF-3 cells proliferate in response to TPO.
Inhibition of ERK activation by 50 µM of the MEK inhibitor PD98059 (Fig. 6B) did not affect the TPO-mediated survival of clone 28 (44% apoptotic cells; Fig. 6C) and clone 8 (36%; data not shown). Also, it did not inhibit the TPO-mediated survival of clone A and 14 (Fig. 6C, and data not shown), despite a level of inhibition of TPO-mediated proliferation similar to that obtained with 10 µM of LY294002. This result indicated that the MAPK p42/44 pathway was not involved in the TPO-mediated survival of Mpl-transduced BaF-3 cells, despite long-term activation of ERK in clones with low levels of Mpl expression.
| Discussion |
|---|
|
|
|---|
The PI3K and MAPK p42/44 pathways have been reported to be involved in
TPO-mediated proliferation of BaF-3 cells
(Dorsch et al., 1997
;
Rojnuckarin et al., 1999
;
Geddis et al., 2001
). In the
present study, we show that the activation level of MAPK p42/44 and PI3K was
higher in the proliferative effect than in the cell survival effect. Moreover,
the inhibitors LY294002 and PD98059 impaired TPO-mediated proliferation of
BaF-3 cells. Together, our results suggest that the TPO-mediated proliferation
of BaF-3 cells requires a threshold stimulation level of both PI3K and MAPK
p42/44 pathways that depends on the cell surface density of Mpl. Several
studies in other systems reported the cooperation of these pathways in the
proliferation event (Craddock et al.,
2001
; Pozios et al.,
2001
; Zubilewicz et al.,
2001
). It has also been reported that constitutively active forms
of the p110 catalytic subunit of PI3K leads to oncogenic transformation
without significant activation of ERK, indicating that activation of the MAPK
p42/44 pathway is not essential for cell growth
(Aoki et al., 2000
).
Conversely, constitutively active forms of MEK lead to factor-independent
proliferation, suggesting that activation of MAPK p42/44 is sufficient for
triggering cell growth (Mansour et al.,
1994
; Seger et al.,
1994
). These findings suggest that cell-cycle entry could be
governed by stimulation of signaling pathways involved in proliferation, but
that the nature of the activated signaling pathway is not a determining
factor. Additionally, we cannot exclude that the activation level of STAT5 is
involved in the triggering of the TPO-mediated proliferative effect in our
system, which would require further detailed studies.
Our results also indicate that the cell survival effect is associated with
weak but sustained activation of the PI3K pathway, and inactivation of BAD.
Use of the LY294002 inhibitor demonstrated a major contribution of PI3K
activation in this effect. Majka et al. have recently reported that the
PI3K/AKT pathway is involved in the TPO-mediated inhibition of apoptosis in
megakaryoblasts (Majka et al.,
2000
), a finding that is consistent with our results. However, our
results demonstrate that inhibition of the PI3K/AKT pathway does not affect
cell survival when cells are actively proliferating in response to TPO. This
result suggests that, in the proliferative effect, the activation level of
other Mpl signaling pathways is sufficient to compensate for the inhibition of
AKT and to prevent apoptosis. Such an effect has already been reported in
BaF-3 cells, whereby the simultaneous inhibition of the PI3K/AKT pathway by
LY294002 and of STAT5 by a dominant-negative isoform, is necessary for
reducing IL-3-dependent survival. LY294002 inhibited the phosphorylation of
BAD and the dominant-negative isoform of STAT5 affected the Bcl-XL
expression (Rosa Santos et al.,
2000
). Here we show that the Bcl-XL expression is not
increased when BaF-3 cells proliferate in response to TPO. This suggests that,
in this case, another mechanism compensates for the inhibition of AKT and for
survival of proliferating cells. The JAK2 inhibitor AG490 at a concentration
of 25 µM strongly affected the proliferation of clone A and decreased the
transient survival effect of clone 8 and 28 after TPO stimulation (data not
shown). However, neither phosphorylation of STAT5, nor phosphorylation of ERK
and AKT after TPO stimulation was affected by AG490 at this concentration in
clones A and 28 (data not shown). Therefore, we were not able to conclude on
the involvement of STAT5 in the TPO-mediated proliferative and survival
effect. This would require further analysis. We also demonstrate a weak but
sustained activation of ERKs in the cellular survival effect in the absence of
proliferation. However, the PD98059 inhibitor did not affect the
anti-apoptotic effect mediated by TPO in BaF-3 cells. Similar results were
reported in megakaryoblast (Fichelson et
al., 1999
; Majka et al.,
2000
), indicating that MAPK p42/44 pathway activation is not
essential for the TPO-mediated survival event.
Taken together, our results underscore the importance of quantitative
differences in receptor activation in the generation of qualitatively
different biological responses (reviewed by
Zandstra et al., 2000
). The
biological responses mediated by the Mpl receptor are dependent on the
activity of downstream signaling pathways being sustained over a threshold
level: PI3K and MAPK p42/44 activity for the proliferative effect, and PI3K
activity for the cell survival effect in the absence of proliferation,
although a different mechanism is involved in cell survival when cells are
actively proliferating. In our system, the cell survival effect in the absence
of proliferation is transient. We were unable to maintain permanent survival
of BaF-3 cells expressing low levels of Mpl in the absence of a proliferative
response to TPO. This result suggests that proliferation and permanent
survival are linked effects in our system.
A threshold level of activity of signaling pathways has already been
reported in the case of TPO-mediated differentiation involving the MAPK p42/44
pathway (Rouyez et al., 1997
;
Matsumura et al., 1998
;
Rojnuckarin et al., 1999
).
This effect of MAPK p42/44 could not be evaluated in our system because BaF-3
cells do not differentiate in response to TPO, even in the presence of an
overactive form of ERK2 (Rojnuckarin et
al., 1999
). Thus, it is possible that our results do not
accurately reflect the proliferative and cell survival mechanisms that operate
in primary megakaryocytic cells. Nevertheless, our system could highlight the
way by which TPO alone acts as a survival factor of early hematopoietic
progenitors and, in synergy with other cytokines, as a proliferative factor of
these cells. Further studies using primary hematopoietic cells will be
required to validate this hypothesis.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Alexander, W. S., Roberts, A. W., Nicola, N. A., Li, R. and
Metcalf, D. (1996). Deficiencies in progenitor cells of
multiple hematopoietic lineages and defective megakaryocytopoiesis in mice
lacking the thrombopoietic receptor c-Mpl. Blood
87,2162
-2170.
Aoki, M., Schetter, C., Himly, M., Batista, O., Chang, H. W. and
Vogt, P. K. (2000). The catalytic subunit of phosphoinositide
3-kinase: requirements for oncogenicity. J. Biol.
Chem. 275,6267
-6275.
Borge, O. J., Ramsfjell, V., Cui, L. and Jacobsen, S. E.
(1997). Ability of early acting cytokines to directly promote
survival and suppress apoptosis of human primitive CD34+CD38- bone marrow
cells with multilineage potential at the single-cell level: key role of
thrombopoietin. Blood
90,2282
-2292.
Brizzard, B. L., Chubet, R. G. and Vizard, D. L. (1994). Immunoaffinity purification of FLAG epitope-tagged bacterial alkaline phosphatase using a novel monoclonal antibody and peptide elution. Biotechniques 16,730 -735.[Medline]
Craddock, B. L., Hobbs, J., Edmead, C. E. and Welham, M. J.
(2001). Phosphoinositide 3-kinase-dependent regulation of
IL-3-induced proliferation:involvement of mitogen-activated protein kinases,
SHP2 and Gab2. J. Biol. Chem.
276,24274
-24283.
Debili, N., Wendling, F., Cosman, D., Titeux, M., Florindo, C.,
Dusanter-Fourt, I., Schooley, K., Methia, N., Charon, M., Nador, R. et al.
(1995a). The Mpl receptor is expressed in the megakaryocytic
lineage from late progenitors to platelets. Blood
85,391
-401.
Debili, N., Wendling, F., Katz, A., Guichard, J., Breton-Gorius,
J., Hunt, P. and Vainchenker, W. (1995b). The Mpl-ligand or
thrombopoietin or megakaryocyte growth and differentiative factor has both
direct proliferative and differentiative activities on human megakaryocyte
progenitors. Blood 86,2516
-2525.
del Peso, L., Gonzalez-Garcia, M., Page, C., Herrera, R. and
Nunez, G. (1997). Interleukin-3-induced phosphorylation of
BAD through the protein kinase Akt. Science
278,687
-689.
de Sauvage, F. J., Hass, P. E., Spencer, S. D., Malloy, B. E., Gurney, A. L., Spencer, S. A., Darbonne, W. C., Henzel, W. J., Wong, S. C., Kuang, W. J. et al. (1994). Stimulation of megakaryocytopoiesis and thrombopoiesis by the c-Mpl ligand. Nature 369,533 -538.[Medline]
Dorsch, M., Fan, P. D., Danial, N. N., Rothman, P. B. and Goff,
S. P. (1997). The thrombopoietin receptor can mediate
proliferation without activation of the Jak-STAT pathway. J. Exp.
Med. 186,1947
-1955.
Drachman, J. G., Griffin, J. D. and Kaushansky, K.
(1995). The c-Mpl ligand (thrombopoietin) stimulates tyrosine
phosphorylation of Jak2, Shc and c-Mpl. J. Biol. Chem.
270,4979
-4982.
Dumon, S., Santos, S. C., Debierre-Grockiego, F., Gouilleux-Gruart, V., Cocault, L., Boucheron, C., Mollat, P., Gisselbrecht, S. and Gouilleux, F. (1999). IL-3 dependent regulation of Bcl-xL gene expression by STAT5 in a bone marrow derived cell line. Oncogene 18,4191 -4199.[Medline]
Fichelson, S., Freyssinier, J. M., Picard, F., Fontenay-Roupie,
M., Guesnu, M., Cherai, M., Gisselbrecht, S. and Porteu, F.
(1999). Megakaryocyte growth and development factor-induced
proliferation and differentiation are regulated by the mitogen-activated
protein kinase pathway in primitive cord blood hematopoietic progenitors.
Blood 94,1601
-1613.
Geddis, A. E., Fox, N. E. and Kaushansky, K.
(2001). Phosphatidylinositol 3-kinase is necessary but not
sufficient for thrombopoietin- induced proliferation in engineered Mpl-bearing
cell lines as well as in primary megakaryocytic progenitors. J.
Biol. Chem. 276,34473
-34479.
Goncalves, F., Lacout, C., Villeval, J. L., Wendling, F.,
Vainchenker, W. and Dumenil, D. (1997). Thrombopoietin does
not induce lineage-restricted commitment of Mpl-R expressing pluripotent
progenitors but permits their complete erythroid and megakaryocytic
differentiation. Blood
89,3544
-3553.
Gurney, A. L., Carver-Moore, K., de Sauvage, F. J. and Moore, M.
W. (1994). Thrombocytopenia in c-mpl-deficient mice.
Science 265,1445
-1447.
Jacobsen, S. E., Borge, O. J., Ramsfjell, V., Cui, L., Cardier, J. E., Veiby, O. P., Murphy, M. J. and Lok, S. (1996). Thrombopoietin, a direct stimulator of viability and multilineage growth of primitive bone marrow progenitor cells. Stem Cells 14 Suppl. 1,173 -180.
Kaushansky, K., Broudy, V. C., Lin, N., Jorgensen, M. J.,
McCarty, J., Fox, N., Zucker-Franklin, D. and Lofton-Day, C.
(1995). Thrombopoietin, the Mpl ligand, is essential for full
megakaryocyte development. Proc. Natl. Acad. Sci. USA
92,3234
-3238.
Ku, H., Yonemura, Y., Kaushansky, K. and Ogawa, M.
(1996). Thrombopoietin, the ligand for the Mpl receptor,
synergizes with steel factor and other early acting cytokines in supporting
proliferation of primitive hematopoietic progenitors of mice.
Blood 87,4544
-4551.
Lok, S., Kaushansky, K., Holly, R. D., Kuijper, J. L., Lofton-Day, C. E., Oort, P. J., Grant, F. J., Heipel, M. D., Burkhead, S. K., Kramer, J. M. et al. (1994). Cloning and expression of murine thrombopoietin cDNA and stimulation of platelet production in vivo. Nature 369,565 -568.[Medline]
Majka, M., Janowska-Wieczorek, A., Ratajczak, J., Kowalska, M.
A., Vilaire, G., Pan, Z. K., Honczarenko, M., Marquez, L. A., Poncz, M. and
Ratajczak, M. Z. (2000). Stromal-derived factor 1 and
thrombopoietin regulate distinct aspects of human megakaryopoiesis.
Blood 96,4142
-4151.
Mansour, S. J., Matten, W. T., Hermann, A. S., Candia, J. M.,
Rong, S., Fukasawa, K., Vande Woude, G. F. and Ahn, N. G.
(1994). Transformation of mammalian cells by constitutively
active MAP kinase kinase. Science
265,966
-970.
Matsumura, I., Nakajima, K., Wakao, H., Hattori, S., Hashimoto,
K., Sugahara, H., Kato, T., Miyazaki, H., Hirano, T. and Kanakura, Y.
(1998). Involvement of prolonged ras activation in
thrombopoietin-induced megakaryocytic differentiation of a human
factor-dependent hematopoietic cell line. Mol. Cell.
Biol. 18,4282
-4290.
Matsunaga, T., Kato, T., Miyazaki, H. and Ogawa, M.
(1998). Thrombopoietin promotes the survival of murine
hematopoietic long-term reconstituting cells: comparison with the effects of
FLT3/FLK-2 ligand and interleukin-6. Blood
92,452
-461.
Palacios, R. and Steinmetz, M. (1985). IL-3-dependent mouse clones that express B-220 surface antigen, contain Ig genes in germ-line configuration, and generate B lymphocytes in vivo. Cell 41,727 -734.[Medline]
Park, L. S., Friend, D. J., Schmierer, A. E., Dower, S. K. and
Namen, A. E. (1990). Murine interleukin 7 (IL-7) receptor.
Characterization on an IL-7-dependent cell line. J. Exp.
Med. 171,1073
-1089.
Pozios, K. C., Ding, J., Degger, B., Upton, Z. and Duan, C.
(2001). IGFs stimulate zebrafish cell proliferation by activating
MAP kinase and PI3-kinase-signaling pathways. Am. J. Physiol.
Regul. Integr. Comp. Physiol. 280,R1230
-R1239.
Ramsfjell, V., Borge, O. J., Cui, L. and Jacobsen, S. E. (1997). Thrombopoietin directly and potently stimulates multilineage growth and progenitor cell expansion from primitive (CD34+ CD38-) human bone marrow progenitor cells: distinct and key interactions with the ligands for c-kit and flt3, and inhibitory effects of TGF-beta and TNF-alpha. J. Immunol. 158,5169 -5177.[Abstract]
Ramsfjell, V., Borge, O. J., Veiby, O. P., Cardier, J., Murphy,
M. J., Lyman, S. D., Lok, S. and Jacobsen, S. E. (1996).
Thrombopoietin, but not erythropoietin, directly stimulates multilineage
growth of primitive murine bone marrow progenitor cells in synergy with early
acting cytokines: distinct interactions with the ligands for c-kit and FLT3.
Blood 88,4481
-4492.
Rojnuckarin, P., Drachman, J. G. and Kaushansky, K.
(1999). Thrombopoietin-induced activation of the
mitogen-activated protein kinase (MAPK) pathway in normal megakaryocytes: role
in endomitosis. Blood
94,1273
-1282.
Rosa Santos, S. C., Dumon, S., Mayeux, P., Gisselbrecht, S. and Gouilleux, F. (2000). Cooperation between STAT5 and phosphatidylinositol 3-kinase in the IL-3-dependent survival of a bone marrow derived cell line. Oncogene 19,1164 -1172.[Medline]
Rouyez, M. C., Boucheron, C., Gisselbrecht, S., Dusanter-Fourt, I. and Porteu, F. (1997). Control of thrombopoietin-induced megakaryocytic differentiation by the mitogen-activated protein kinase pathway. Mol. Cell. Biol. 17,4991 -5000.[Abstract]
Sattler, M., Salgia, R., Durstin, M. A., Prasad, K. V. and Griffin, J. D. (1997). Thrombopoietin induces activation of the phosphatidylinositol-3' kinase pathway and formation of a complex containing p85PI3K and the protooncoprotein p120CBL. J. Cell Physiol. 171,28 -33.[Medline]
Seger, R., Seger, D., Reszka, A. A., Munar, E. S.,
Eldar-Finkelman, H., Dobrowolska, G., Jensen, A. M., Campbell, J. S., Fischer,
E. H. and Krebs, E. G. (1994). Overexpression of
mitogen-activated protein kinase kinase (MAPKK) and its mutants in NIH 3T3
cells. Evidence that MAPKK involvement in cellular proliferation is regulated
by phosphorylation of serine residues in its kinase subdomains VII and VIII.
J. Biol. Chem. 269,25699
-25709.
Solar, G. P., Kerr, W. G., Zeigler, F. C., Hess, D., Donahue,
C., de Sauvage, F. J. and Eaton, D. L. (1998). Role of c-mpl
in early hematopoiesis. Blood
92, 4-10.
Wendling, F., Maraskovsky, E., Debili, N., Florindo, C., Teepe, M., Titeux, M., Methia, N., Breton-Gorius, J., Cosman, D. and Vainchenker, W. (1994). cMpl ligand is a humoral regulator of megakaryocytopoiesis. Nature 369,571 -574.[Medline]
Zandstra, P. W., Lauffenburger, D. A. and Eaves, C. J.
(2000). A ligand-receptor signaling threshold model of stem cell
differentiation control: a biologically conserved mechanism applicable to
hematopoiesis. Blood 96,1215
-1222.
Zubilewicz, A., Hecquet, C., Jeanny, J., Soubrane, G., Courtois,
Y. and Mascarelli, F. (2001). Proliferation of CECs requires
dual signaling through both MAPK/ERK and PI 3-K/Akt pathways.
Invest. Ophthalmol. Vis. Sci.
42,488
-496.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
X. Huang, H. Sakamoto, and M. Ogawa Thrombopoietin controls proliferation of embryonic multipotent hematopoietic progenitors Genes Cells, July 1, 2009; 14(7): 851 - 860. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Simon, E. Dondi, A. Chaix, P. de Sepulveda, T. J. Kubiseski, N. Varin-Blank, and L. Velazquez Lnk adaptor protein down-regulates specific Kit-induced signaling pathways in primary mast cells Blood, November 15, 2008; 112(10): 4039 - 4047. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. S. Hitchcock, M. M. Chen, J. R. King, and K. Kaushansky YRRL motifs in the cytoplasmic domain of the thrombopoietin receptor regulate receptor internalization and degradation Blood, September 15, 2008; 112(6): 2222 - 2231. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Gery, S. Gueller, K. Chumakova, N. Kawamata, L. Liu, and H. P. Koeffler Adaptor protein Lnk negatively regulates the mutant MPL, MPLW515L associated with myeloproliferative disorders Blood, November 1, 2007; 110(9): 3360 - 3364. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. K. Frankel, G. P. Cosgrove, S.-I. Cha, C. D. Cool, M. W. Wynes, B. L. Edelman, K. K. Brown, and D. W. H. Riches TNF-{alpha} Sensitizes Normal and Fibrotic Human Lung Fibroblasts to Fas-Induced Apoptosis Am. J. Respir. Cell Mol. Biol., March 1, 2006; 34(3): 293 - 304. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. G. Heller, A. C. Glembotsky, M. J. Gandhi, C. L. Cummings, C. J. Pirola, R. F. Marta, L. I. Kornblihtt, J. G. Drachman, and F. C. Molinas Low Mpl receptor expression in a pedigree with familial platelet disorder with predisposition to acute myelogenous leukemia and a novel AML1 mutation Blood, June 15, 2005; 105(12): 4664 - 4670. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-M. Paulus, N. Debili, F. Larbret, J. Levin, and W. Vainchenker Thrombopoietin responsiveness reflects the number of doublings undergone by megakaryocyte progenitors Blood, October 15, 2004; 104(8): 2291 - 2298. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||