|
|
![]() |
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
Research Article |
1 Laboratory of Virology, Institute for Disease Mechanism and Control, Nagoya
University School of Medicine, Tsurumai-cho 65, Showa-ku, Nagoya 466-8550,
Japan
2 Department of Environmental Biology, College of Bioscience and Biotechnology,
Chubu University, Matsumoto-cho 1200, Kasugai 487-8501, Japan
* Author for correspondence (e-mail: ynishiya{at}tsuru.med.nagoya-u.ac.jp )
Accepted 2 April 2002
| Summary |
|---|
|
|
|---|
Key words: HSV-2 UL14, Heat shock, Molecular chaperone, Hsp70, Luciferase activity
| Introduction |
|---|
|
|
|---|
The ubiquitous and abundant Hsp 70 chaperones, with their co-chaperones,
have been proposed to be required for the cotranslational folding of cytosolic
proteins (Langer et al., 1992
;
Hartl, 1996
;
Mayhew and Hartl, 1996
). Hsp
70 proteins rely on their ability to associate with short hydrophobic segments
of unfolded substrate polypeptides in an ATP-controlled fashion
(Rüdiger et al., 1997
;
Bukau and Horwich, 1998
). The
best in vitro evidence for a role of Hsp70 in folding of newly synthesized
polypeptides has been obtained for firefly luciferase translated in
reticulocyte lysates that are depleted of Hsp70 or its DnaJ co-chaperone,
Hsp40 (Frydman et al., 1994
).
Depletion results in a specific enzymatic activity of translated luciferase
that is decreased by 70%. Restoration of full enzymatic activity is possible
only when Hsp70 and Hsp40 are re-added before onset of translation, indicating
a cotranslational mode of action of Hsp70 and Hsp40 in the folding of firefly
luciferase in this cell-free system
(Frydman et al., 1994
). A
different class of chaperones, the TriC and GroEL chaperonins, is known to
assist the de novo folding of cytosolic proteins
(Horwich et al., 1993
;
Frydman and Hartl, 1996
;
Lewis et al., 1996
;
Ewalt et al., 1997
;
Farr et al., 1997
). For GroEL
of E. coli, a post-translational role in folding of a subset of 5-15%
of newly synthesized proteins has been shown
(Bochkareva et al., 1988
;
Horwich et al., 1993
;
Gaitanaris et al., 1994
;
Reid and Flynn, 1996
;
Ewalt et al., 1997
). There are
implications that Hsp70 chaperones and the chaperonins provide a protected
folding environment for nascent chains
(Frydman and Hartl, 1996
).
HSPs, particularly those of the Hsp70 family, are transcriptionally induced
by and associate with viral proteins. Infections with adenovirus
(Wu et al., 1986
), vaccinia
virus (Sedger and Ruby, 1994
),
cytomegalovirus (Colberg-Poley and
Santomenna, 1988
), simian virus 40 (SV40) and polyomavirus
(Khandijan and Türler,
1983
) induce mRNAs for Hsp70 family proteins. Because of the
diverse functions of Hsp70-like proteins and their increased expression and
association with viral proteins during viral infections, it is likely that
Hsp70 assists in aspects of virion assembly as a cellular chaperone protein
(Cripe et al., 1995
). An
HSV-encoded true late gene product, US11, has been shown to enhance survival
of cells to heat shock when it is overexpressed, although heat treatment did
not modify the intracellular distribution of the protein
(Diaz-Latoud et al., 1997
). It
seems practical for the virus to encode its own HSP or molecular
chaperone.
The herpes simplex virus (HSV) genome contains at least 74 different known
protein-coding genes (Dolan et al.,
1998
; McGeoch et al.,
1988
). The UL14 gene of HSV type 1 (HSV-1) and type 2 (HSV-2)
encodes a 32 kDa protein expressed late in infection that is a minor component
of the virion tegument (Wada et al.,
1999
; Cunningham et al.,
2000
), and the coding region overlaps that of UL13, which encodes
a protein kinase (Dolan et al.,
1998
; Daikoku et al.,
1997
). Most conserved residues are located in the nonoverlapping
region, and the overlapping region seems to encode a variable length
C-terminal domain that is poorly conserved in sequence. A UL14-deficient
mutant exhibits an extended growth cycle at low multiplicities of infection
and appears to be compromised in efficient transit of virus particles from the
infected cell. In mice injected intracranially, the 50% lethal dose of the
mutant was reduced more than 30,000-fold, suggesting that the protein
contributes to successful viral growth and thus to the sophistication of the
herpesvirus life cycle (Cunningham et al.,
2000
). The versatile localization of UL14 protein in singly
expressed cells and the ability to relocate viral proteins into the nucleus by
coexpression may be only a part of its intrinsic functions
(Yamauchi et al., 2001
). In
this study we suggest that HSV-2 UL14 protein has HSP-like functions.
| Materials and Methods |
|---|
|
|
|---|
Plasmids
PCR primers (forward, F; reverse, R) designed to construct plasmids
expressing deletion mutants of the UL14 protein with incorporated restriction
enzyme sites were as follows. PcDNA3-UL14ND20 (F, GAGAAAGCTTTCATGGCCGAGGTGTAC,
HindIII); pcDNA3-UL14ND60 (F, GAATAAGCTTCGATGCTAAAGTCCC,
HindIII); pcDNA3-UL14ND120 (F, CAGGAAGCTTAGATGGAAGAGGCCG,
HindIII). The reverse primers for these plasmids were: C14R,
GACGGGATCCTCACTCGCCATCGGG, BamHI; PcDNA3-UL14 D(51-90) (F,
CGACGTGATATCCTAACCGCACACCGACGGTACCT, EcoRV; R,
GTGGGCGATATCGGCGGCCATAAAGGCGCCA, EcoRV); pcDNA3-UL14D(121-180) (F,
CGCGGCGATATCCCGGACGCCCAAGCGGCCC, EcoRV); R,
GCCGCCGATATCGAGCTGCTCCTCCTGGTC, EcoRV). Point mutations were
incorporated according to the instructions of QuikChange Site-Directed
Mutagenesis Kit (Stratagene). The primers constructed and the double stranded
DNA templates used were as follows. PcDNA3-UL14K51A (F,
GCCTTTATGGCCGCCGCGGCGGCCCACTTGGAAT; R, TTCCAAGTGGGCCGCCGCGGCGGCCATAAAGGC;
template, pcDNA3-UL14); pcDNA3-UL14R60A (F,
GGAATTGGAGGCGGCGCTAAAGTCCCGCGCGCGCTTAG; R,
CTAAGCGCGCGCGGGACTTTAGCGCCGCCTCCAATTCC; template, pcDNA3-UL14);
pcDNA3-UL14R(60,64)A (F, GCGGCGCTAAAGTCCGCCGCGCGCTTAGAGATG; R,
CATCTCTAAGCGCGCGGCGGACTTAGCGCCGC; template, pcDNA3-UL14R60A); pcDNA3-UL14PM3
was constructed with primers UL14K51F, R using pcDNA3-UL14R(60,64)A as
template. The nucleotide sequence of each product was verified by using the
sequence analyzer ABI PRISM 310 Genetic Analyzer (PE Biosystems). Other
plasmids mentioned in this study have been noted elsewhere
(Wada et al., 1999
;
Yamauchi et al., 2001
). The
luciferase-expressing plasmid pGL3-Promoter vector (referred to as pGL3-p in
the text) was obtained from Promega.
Antibodies
Anti-UL14 polyclonal Ab and mAb, and the anti-FLAG mAb have been described
previously (Wada et al., 1999
;
Yamauchi et al., 2001
).
Anti-Hsp70 rabbit polyclonal Ab was kindly provided by K. Ohtsuka (Chubu
University, Kasugai, Japan). Mouse anti-Hsp70/Hsc70 mAb was purchased from
MBL. Anti-nucleolin mAb was purchased from Transduction Laboratories,
anti-luciferase rabbit polyclonal Ab from Rockland, anti-PML mAb from MBL and
anti-NuMA mAb from Oncogene. The secondary antibodies used were fluorescein
isothiocyanate (FITC)-conjugated goat anti-rabbit IgG and tetramethylrhodamine
isothiocyanate (TRITC)-conjugated mouse anti-rabbit IgG (Sigma).
Chemicals, heat shock, ATP depletion and hyperosmotic shock
assays
MG132 was obtained from Sigma. All cells were grown to a monolayer on glass
coverslips in 35 mm dishes. For heat-shock assays, the dishes were sealed with
parafilm and heat shocked in a water bath heated to appropriate temperatures.
For recovery from heat shock, the dishes were removed from the bath and
incubated at 37°C for appropriate times. Leptomycin B was used at a final
concentration of 10 ng/ml. For ATP depletion assays, the medium was replaced
with an ATP depletion cocktail consisting of 10 mM of sodium azide and 10 mM
of 2-deoxy-D-glucose and incubated at 37°C for 5-10 hours. In order to
induce hyperosmotic shock, the medium was supplemented with sorbitol to a
final dilution of 1 M and incubated at 37°C for 5 hours. For fixation, the
glass coverslips were washed thoroughly in PBS and fixed in cold acetone for 5
minutes. The cells were washed extensively in PBS and left to dry and stored
in a -80°C freezer.
Immunofluorescence and immunoblotting
For indirect immunofluorescence, the primary antibodies were diluted in
PBS. Antibodies were used at dilutions as follows: anti-UL14 polyclonal Ab,
1/100-1/300; anti-UL14 mAb, 1/100; anti-Hsp70 rabbit polyclonal Ab, 1/80;
anti-Hsp70/Hsc70 mouse mAb, 1/10; anti-FLAG mAb, 1/100; anti-nucleolin mAb,
1/100; anti-PML mAb, 1/100; and anti-NuMA mAb, 1/100. After incubation at
37°C for 30 minutes, the coverslips were washed extensively in PBS then
treated with secondary antibodies that were all diluted at 1/150. After a
further 30 minute incubation, the coverslips were washed in PBS and mounted
using Perma Fluor (Immunon). Where appropriate, DNA was stained (after RNAase
treatment) using propidium iodide at a concentration of 1 µg/ml for 5
minutes after the secondary antibody incubations. Samples were examined with
Zeiss laser scanning microscope LSM510 or with the Bio-Rad MRC series confocal
imaging system. As primary antibodies for immunoblotting, anti-Hsp70 rabbit
polyclonal Ab was used at 1/5000, and anti-UL14 polyclonal Ab at 1/2000.
Antibody microinjection
Cells were grown to a monolayer on glass coverslips in 35 mm dishes. The
antibody was microinjected through a glass capillary into the cytoplasm of
cells. After incubation at 37°C for 2 hours, cells were heat shocked and
fixed as described, and detected by immunofluorescence.
Transfection of oligomers
Oligomers were obtained from Sigma genosys. Hsp70 antisense oligomer
(5'-CGCGGCTTTGGCCAT-3') was complementary to the initiation codon
and 4 downstream codons of human Hsp70 mRNA. The corresponding sense oligomer
(5'-ATGGCCAAAGCCGCG-3') and nonsense oligomer
(5'-CGGGTATGCTTCGCC-3') were used as controls
(Wei et al., 1995
). The
oligomers were diluted to 200 µM and stored at -20°C. For
cotransfection assays, oligomers were added to the transfection mixture to a
final concentration of 0.5 µM (Gibco BRL).
Plasmid transfection and luciferase assays
For plasmid transfection, monolayers of cells seeded 24 hours earlier were
transfected with the Lipofectamine reagent (Gibco-BRL) according to the
instructions of the supplier. For luciferase assays, the Luciferase assay
system (Promega) was used. 24 hours after transfection of pGL3-promoter
containing mixtures, 35 mm dish cells were washed twice in PBS, harvested as
recommended by the supplier. Luciferase activity was measured for 10 seconds
with a TD-20/20 Luminometer (Turner Designs) with a 100:20 µl ratio mixture
of luciferase assay reagent and cell culture lysate.
| Results |
|---|
|
|
|---|
We constructed Vero and HEp-2 cell lines that constitutively expressed UL14 protein (14/Vero and 14/Hep-2) and detected the localization of UL14 protein by indirect immunofluorescence. Cells propagated at 37°C showed mainly cytoplasmic staining (Fig. 1B). We next treated the cells with 43°C heat shock for 30 minutes. Much to our surprise, UL14 protein showed predominant nuclear staining, which was observed with more contrast in 14/Vero cells (Fig. 1C). If UL14 was a shuttling protein that continuously moves between the nucleus and cytoplasm at 37°C, it could be that its nuclear accumulation by heat shock was due to the block of nuclear export. To rule out this possibility, 14HEp-2 cells were treated with the export inhibitor leptomycin B. UL14 protein still showed mainly cytoplasmic localization showing that nuclear accumulation was due to its import into the nucleus (data not shown). UL14 protein also colocalized with nucleolin in a double-staining experiment confirming its nucleolar accumulation (Fig. 1D-F). In addition, cells were double-stained for UL14 protein and DNA using propidium iodide after RNAase treatment. We found that UL14 protein was mostly distributed in nuclear space excluding DNA, in general, the nucleolus and the nuclear matrix (Fig. 1G-I).
|
Heating cells that were transfected with the UL14 gene (data not shown), or treating the cell lines with an ATP-depletion cocktail (consisting of sodium azide and 2-deoxy-D-glucose) also exhibited nuclear relocation of UL14 protein (Fig. 1J). Furthermore, hyperosmotic stress induced by 1 M sorbitol treatment retrieved similar, but non-identical, results (Fig. 1K). Strikingly, in M phase 14/Hep-2 cells, we found that UL14 protein localized markedly at centrosomes (Fig. 1L). In heat-shocked 14/Vero cells, UL14 protein colocalized with PML (Fig. 2A-C). In 14/Hep-2 cells, UL14 protein colocalized with the nuclear mitotic apparatus protein (NuMA) at 37°C (Fig. 2D-F). In M-phase cells after heat shock (Fig. 2G-I), the colocalization became extremely clear, suggesting that the UL14 protein associates with NuMA or centrosome after heat shock. PML colocalization was not seen in 14/Hep-2 cells after heat shock, but was observed after 5 hours of treatment with 20 µM of proteasome-inhibitor MG132 (data not shown).
|
These rapid changes in intracellular localization of UL14 protein were intriguing. We next analyzed the solubility of the protein when undergoing continuous heat stress. Exponentially growing 14/HEp-2 cells were heated to and maintained at 43°C for 3 hours. Cells were lysed in PBS containing 1% Triton X-100 and fractionated into soluble and insoluble fractions at appropriate time points and subjected to western blotting (Fig. 3A). The ratio of the insoluble fraction of UL14 protein increased greatly after 60 minutes of heat treatment. Also, the overall amount of the protein decreased in cells heated for a longer time.
|
Localization of UL14 protein and Hsp70 in heat-shocked 14/Vero and
14/Hep-2 cells
It is known that cellular HSPs such as Hsp70 return to the cytoplasm during
a recovery period at 37°C after heat shock at 43°C
(Hattori et al., 1993
). We
examined whether this was the case for UL14 protein localization. When the
temperature was maintained at 37°C after heat shock, UL14 protein began to
delocalize to the cytoplasm (data not shown). This phenomenon pointed out that
the localization of UL14 protein indeed was similar to that of Hsp70. To
understand the movement of UL14 protein, cells were heated at 43°C for 2
hours and recovered at 37°C for up to 23 hours. Cells were fixed at
certain time points, detected by immunofluorecence for UL14 protein, and
brightly stained nucleoli were counted as `positively-stained cells'. The
percentage of positive cells was plotted against time during and after
heating. Fig. 3B shows that
nucleoli-positive cells decreased during the recovery period and dropped to
10% at 5 hours.
Cells double-stained with UL14 protein and Hsp70 after heat shock showed that the proteins colocalized completely in the nucleus (Fig. 4A, A-C). To see if UL14 protein associated with Hsp70 for its transport, cells were microinjected with anti-Hsp70 polyclonal antibody prior to heat shock. After heat shock at 43°C for 30 minutes, the cells were fixed and detected for UL14 protein and the injected antibody. UL14 protein translocated to the nuclei and nucleoli in microinjected cells, indicating that this process did not depend on the function of Hsp70 (Fig. 4A, D-F). Staining these cells with an anti-Hsp70 monoclonal antibody showed that injection of the polyclonal antibody inhibited Hsp70 from entering the nucleolus after heat shock (data not shown), indicating that antibody-injection knocked out Hsp70 function. To compare the dynamics of UL14 protein and Hsp70 nucleolar localization upon heat shock, Vero and 14/Vero cells were heat-shocked at 43°C for 2 hours and allowed to recover at 37°C for up to 16 hours. Samples were fixed at several time points and detected for Hsp70 and UL14 protein nucleolar localization. The plots of the experiment show that positive nucleolar staining of UL14 protein and Hsp70 was observed almost simultaneously after a short period of heating in 14/Vero cells (Fig. 4B). During the recovery period at 37°C positive staining of Hsp70 decreased more rapidly in 14/Vero cells than in Vero cells. In comparison with 14/Vero cells, a time lapse of about 4 hours was observed in Vero cells before Hsp70 delocalized completely to the cytoplasm in all cells. The localization of UL14 protein in 14/Vero cells was similar to that of Hsp70 but delocalization from the nucleoli took more time than Hsp70. In addition, nucleolar staining of UL14 protein was much brighter than that of Hsp70 in early times of heat shock (data not shown). Cells were submitted to continuous heat shock at 43°C and assayed for Hsc70/Hsp70 protein by western blotting at 0, 10, 20, 30, 40, and 60 minutes (Fig. 4C). Hsp70 gradually increased over time in Vero cells whereas Hsp70 in 14/Vero cells decreased after 30 minutes of heat shock.
|
Delocalization of Hsp70 from the nucleus after heat shock (presumably upon
completion of recovery) is associated with cell survival while failure to
delocalize is associated with cell death
(Roti Roti et al., 1998
). In
addition, in heat-resistant and thermotolerant cells Hsp70 delocalization from
the nucleus occurs faster, while in heat-sensitive cells delocalization
occurrs slower than in cells of normal heat resistance
(Laszlo et al., 1993
). Our
result suggests that the expression of UL14 protein may contribute to cellular
recovery from heat shock.
There is a homology between the substrate-binding domain of Hsp70 and
an N-terminal region of HSV UL14
In the course of this research, we were curious whether UL14 had inherited
a heat-shock-protein-like sequence from the natural host and so we searched
for homologous amino acid sequences between UL14 and several heat shock
proteins such as the small HSPs, Hsp60, Hsp70 and Hsp90. Interestingly, HSV
UL14 protein possessed an amino acid sequence that was homologous to a part of
the peptide-binding domain conserved in the Hsp70 family
(Fig. 5A). The homologous
domain of HSV-2 UL14 protein is a stretch of 39 amino acids starting from the
Ala49. In particular, 9 out of 15 amino acids [(60)
R-L-X-S-R-X(2)-L-E-X-M-X-Q-X-A (74)] in a stretch beginning at the Arg60 of
HSV-2 UL14 protein shared homologies with the
-helical domain of Hsp70
located at the C-terminal end of the substrate recognition domain. These
sequences were conserved only in HSV-1 and -2 among
-herpesviruses,
indicating the possibility that only HSV inherited the sequences. It also
seemed possible that the amino acids were important for the HSP-like
properties of UL14 protein. We decided to look into these amino acids for
their association with the function of UL14 protein.
|
Arg60 and Arg64 are important for nuclear relocation of VP26 and UL14
protein in cotransfected cells
In our previous study we showed that deletion of 80 N-terminal residues of
UL14 protein greatly decreased the population of cells in which nuclear
translocation of VP26 was observed
(Yamauchi et al., 2001
). To
inspect this in further detail, we constructed a number of UL14 mutant
protein-expressing plasmids (Table
1). Point mutations were carried out for three basic residues
(Lys51, Arg60 and Arg64) that were conserved between the HSV UL14 protein and
the Hsp70 family.
|
Pre-existing and newly constructed plasmids were cotransfected with pFLAG-UL35, a plasmid that expresses a version of VP26 tagged with a FLAG at its C-terminus. Twenty-four hours later, cells were fixed and double-stained for UL14 protein and VP26. In each cotransfection assay, at least 150 double-stained cells were quantified for strong nuclear fluorescence of VP26 in order to compare the translocational properties of the UL14 mutant proteins.
Fig. 5B shows that UL14ND40 was able to translocate VP26 in 50% of cells, whereas UL14ND60 translocated VP26 in only about 10% of cells. UL14ND120 has only about half as many amino acids as the wild-type protein and showed almost no translocational ability. UL14K51A showed almost equal translocational ability compared with wild-type protein, whereas UL14R60A exhibited 26% efficiency in translocation of VP26. UL14R(60,64)A, a double point-mutated UL14 protein (Arg60 and -64 converted to Ala), relocated VP26 into the nucleus only in about 10% of cells; the same efficiency as a mutant protein that lacked 60 N-terminal residues. Fig. 5C-E shows cells expressing UL14R(60,64)A and VP26-FLAG. Interestingly, UL14D(121-180), which lacked 60 amino acids in a region non-homologous to Hsp70 exhibited almost no difference in translocation abilities compared with wild-type UL14 protein. In contrast, UL14D(51-90), which lacked 40 residues in the homologous region, showed considerable defect in the translocational ability (25% effeiciency). These results supported the idea that the Hsp70-homologous region of UL14 protein was important for its translocational function of VP26 in coexpressing cells.
Transiently- and constitutively-expressed UL14 protein can enhance
the activity of newly-synthesized firefly luciferase
In the absence of viral proteins, UL14 protein could increase the activity
of firefly luciferase. The folding of newly synthesized luciferase in an in
vitro assay depends to a great extent (70%) on the chaperones Hsp70 and Hsp40
(Frydman at al., 1994
).
Therefore, if, when overexpressed, UL14 protein could increase luciferase
activity, then it is probably a molecular chaperone-like protein, or perhaps a
cochaperone-like protein of cellular HSPs.
HEp-2 cells were transfected with a luciferase-expressing vector pGL3-p and with a control vector pcDNA3 or pcDNA3-UL14 and assayed for luciferase activity 24 hours later. When luciferase activity was moderate in cells transfected with the control vector, cells expressing UL14 protein had higher (140-170%) relative luciferase activity (data not shown). When control cells showed low levels of luciferase activity to begin with, UL14 protein's existence increased luciferase activity even more. This was found to be dose-dependent, for when the transfected pcDNA3-UL14 was increased to fourfold the initial dose, luciferase activity rose to nearly 14-fold (Fig. 6A). We presumed that this resulted from a higher efficiency in folding, meaning a larger number of luciferase molecules being folded to their native state, thus yielding higher activity. Apparently, low levels of luciferase activity in control cells resulted from insufficient folding of newly synthesized luciferase by cellular chaperones such as Hsp70. In such a case, we thought it was possible for UL14 protein to enhance the relative activity of luciferase. On the other hand, high luciferase activity in control cells suggested that folding by cellular chaperones had taken place sufficiently. Therefore, a smaller margin was allowed in the increase of luciferase activity in the presence of UL14 protein.
|
To evaluate the amount of proteins expressed in these assays, identical samples were used in a western blot to detect expression levels of luciferase and UL14 protein. As shown in Fig. 6A and B, amounts of expressed luciferase were almost the same contrary to the difference in relative activity. This suggested that overexpression of the UL14 protein did not affect the level of expression of luciferase but did enhance the folding of newly synthesized luciferase substrates. We next compared the activity of luciferase expressed on its own in HEp-2 and 14/HEp-2 cells or in Vero and 14/Vero cells. The experiment retrieved similar results (Fig. 6B). Both 14/HEp-2 and 14/Vero cells exhibited higher levels of luciferase activity compared with the parent cell lines: in the former, activity was as high as 160%, and the latter, 500%. Once again, the total amount of luciferase was constant.
The existence of UL14 protein compensates for a part of the loss of
Hsp70 chaperone function induced by transfection of antisense oligomers
In the experiments above, we could only estimate how much luciferase was
actually folded properly by Hsp70, for this itself seemed to depend on the
vital activity of the cell culture. In order to examine the enhancement of
luciferase activity by UL14 protein in a cell culture system, which is reduced
in functional cellular Hsp70, we introduced an antisense oligonucleotide
(5'-CGCGGCTTTGGCCAT-3') that is complementary to the initiation
codon and four downstream codons of the human Hsp70 mRNA, which therefore
inhibit the synthesis of Hsp70 when taken into the cell. As controls, the
corresponding sense oligomer (5'-ATGGCCAAAGCCGCG-3') and nonsense
oligomer (5'-CGGGTATGCTTCGCC-3') were used
(Wei et al., 1995
).
In preliminary experiments, we transfected HEp-2 cells with 0.1 µg pGL3-p alone, or with 0.1 µg pGL3-p and 0.5 µM of sense/antisense oligomer. Twenty-four hours later, the activity of luciferase in antisense-oligomer-transfected cells was significantly lower than that in cells transfected with the sense oligomer. There was no difference between sense- and nonsense-oligomer-transfected cells (data not shown). This outcome suggested that luciferase activity was hindered in antisense-treated cells due to a blockage of Hsp70 synthesis resulting in a lower folding efficiency of newly produced luciferase molecules. Judging from this, we decided to use the same method to observe the effects of constitutive UL14 protein expression on luciferase activity in antisense-treated 14/HEp-2 cells.
Exponentially growing HEp-2 and 14/HEp-2 cells were transfected with 0.1 µg pGL3-p and 0.5 µM of sense/antisense oligomer, or HEp-2 cells were transfected with 0.5 µM of antisense oligomer, 0.1 µg pGL3-p and 0.25 µg pCDNA3-UL14, -UL14R(60,64)A, or -UL14D(51-90), and luciferase activity was measured 24 hours later. In antisense-transfected HEp-2 cells, the activity of luciferase was decreased to about 40% of control (sense oligomer-treated) cells. However, in antisense-transfected 14/HEp-2 cells, activity was only restrained to 60% of control cells. In addition, HEp-2 cells coexpressing luciferase with UL14 wt protein showed higher activity than those expressing UL14 mutant proteins (Fig. 6C). This implied that the loss of chaperone activity induced by antisense oligomers is most compensated when these cells were overexpressed with the full-length UL14 protein.
| Discussion |
|---|
|
|
|---|
Our trials resulted in the rapid nuclear and nucleolar translocation of UL14 protein after a brief (<30 minutes) heat shock at 43°C, which could be reversed in a matter of hours when cells were recovered at 37°C. These results were symbolic of an HSP-like feature of UL14 protein. Moreover, UL14 protein localized in nuclei in ATP-depleted and hyperosmotic-shocked cells, further suggesting that the protein functioned as a stress protein in reaction to the surrounding environment. In these cases, UL14 protein localized in DNA-excluding areas of the nucleus (the nucleoli and nuclear matrix) as shown by double staining with propidium iodide.
After a 30 minute heat shock in 14/Vero cells, UL14 protein colocalized
with PML or ND10. ND10 are dynamic structures that are disrupted during
mitosis and respond to environmental stimuli including interferon treatment,
heat-shock, treatment with heavy metals, and viral infection
(Maul et al., 1995
;
Stuurman et al., 1997
;
Stuurman et al., 1992
). PML
and Sp100 are components of ND10 whose proteasome-dependent degradation is
induced by HSV-1 regulatory protein Vmw110
(Everett et al., 1999b
). ND10
proteins are recruited to replication compartments in HSV-1 infected cells and
ND10 or sites in the cell close to ND10 play an important role in the
establishment of a productive infection
(Maul et al., 1993
;
Burkham et al., 1998
).
In heat-shocked 14/HEp-2 cells, UL14 protein localized at the centromeres
of M phase cells and colocalized completely with NuMA. The centrosome,
consisting of centrioles and pericentriolar material, is the most common
organizer of microtubules in mammalian cells
(Archer and Solomon, 1994
;
Schatten, 1994
). Vmw110 is
known to interact with centromeres in mitotic and interphase cells in a way
similar to its interaction with ND10
(Everett et al., 1999a
). Hsp70
protects the centrosome during heat shock
(Liang and MacRae, 1997
) and,
with Hsp27, centrosomes become associated with and co-isolate with the nuclear
matrix following heat shock (vanderWaal et
al., 1996
). The kinetics of the nuclear localization and
delocalization of Hsp70 are constant with it having a protective role for the
nuclear matrix (RotiRoti et al.,
1998
). It is possible that the translocation of UL14 protein to
the nuclear matrix, ND10 and centromeres is a result of its functions in
protecting vital compartments of the cell from heat denaturation.
HSPs, otherwise known as molecular chaperones or stress proteins, are
constitutively expressed at normal growth temperatures and have basic and
indispensable functions in the life cycle of the cell; most are acidic
proteins. Hsp40 and Hsp70 are localized mainly in the cytoplasm at normal
growth temperatures and translocate into the nuclei and nucleoli upon heat
shock. The isoelectric point of UL14 protein is 5.33 and that of Hsp70 is 5.36
(Genetyx Mac), displaying another similarity between the proteins.
Interestingly, these proteins return to the cytoplasm during a recovery period
after heat shock, although the mechanism is unclear
(Ohtsuka and Hata, 2000
).
Hsp70 binds to and releases polypeptides concomitant with ATP binding and
hydrolysis, and possesses two distinct domains. The N-terminal 44 kDa domain
of DnaK (the Hsp70 homologue) is highly conserved among all DnaK members,
while the C-terminal 27 kDa domain is more variable and mediates substrate
binding. The crystal structure of the substrate-binding domain of DnaK
(residues 389-607) comprises a ß-structured polypeptide-binding site and
a latch-like subdomain of five
-helices at the C-terminal end of the
protein (Flaherty et al.,
1990
; Zhu et al.,
1996
). Although the
-helical subdomain is not in direct
contact with the bound peptide it is thought to work like a lid that
facilitates access to the substrate-binding site
(Beissinger and Buchner,
1998
).
We found a homology between HSV UL14 proteins and the Hsp70 family
proteins. The domain with the most homology is located in the N-terminal part
(residues 60-74) of HSV-2 UL14 protein and the C-terminal part (residues
509-522) of the 18 kDa peptide-binding domain of human Hsp70. The 18 kDa
peptide-binding domain (residues 384-543) contains two four-stranded
antiparallel ß-sheets and a single
-helix
(Kiang and Tsokos, 1998
). The
homology is located in the centre of the
-helix. The
-helix of
Hsp70 is a nine amino acid stretch [(511) S-K-E-D-I-E-R-M-V (519)], and the
homology with UL14 is [(63) S-R-X-X-L-E-X-M-X (71)]. Thus five out of nine
residues are homologous; the Lys of Hsp70 and the Arg of UL14 may be of
particular importance for chaperone function of both proteins. Wang et al.
indicated that the Hsc70 peptide-binding domain appears to be very stable and
relatively independent of the rest of the molecule
(Wang et al., 1993
). The
binding site may be located on the
-helix, because the potent
immunosuppressor 15-deoxy-spergualin, a synthetic antitumor agent known to
bind to Hsc70, could be carried by such a site. In this report, Arg60 and -64
of the HSV-2 UL14 protein, which are included in the sequence (60) R-L-K-S-R
(64), were shown to be important for the relocation of the HSV-2 UL14 protein
itself and VP26 into the nucleus of coexpressing cells. This sequence is
located at the N-terminal side of the
-helix of the peptide-binding
domain of Hsp70. In terms of homological sequences, we have also searched for
other molecular chaperones. There seemed to be a number of matches in the
amino acid alignments with the chaperonin Hsp60, and Hsp27. Unfortunately,
these matches were not as convincing as the homology of UL14 protein with
Hsp70. Nevertheless, it is worth noting that the matches were found in the
N-terminal area in the vicinity of the Hsp70-homologous region of UL14
protein. The small HSP and
-crystallin family consists of 12-43 kDa
proteins that assemble into multimeric structures and contain a conserved
C-terminal region termed the
-crystallin domain
(Fink, 1999
). Alhough the
molecular mass of UL14 is 32 kDa, there was no conserved sequence in the
C-terminus relative to such a domain.
When cells were subjected to ATP depletion, Hsp70 was shifted towards its
aggregated forms in a manner similar to that observed after heat treatment
(Angelidis, 1999). The nuclear aggregation and translocation of UL14 protein
upon ATP-depletion was very similar to this. Although UL14 protein does not
have an ATPase domain, according to sequence analysis, its change in
intracellular localization suggests involvement of an ATP-dependent mechanism.
UL14 protein translocated to the nucleus also by hyperosmotic shock. Although
immunofluorecence showed that the nuclear staining-patterns differed in
heat-shocked, ATP-depleted or osmotic-shocked cells, the protein clearly
exhibits stress-induced changes. It was shown that Hsp33 chaperone function is
regulated at the post-translational level by the redox conditions that
distinguish it from all other known molecular chaperones
(Jakob et al., 1999
). It will
be of considerable interest to research the regulation mechanism of UL14
protein in HSV-infected cells.
Finally, the increase in luciferase activity in the presence of UL14
protein, whether in a transiently- or constitutively-expressed state,
suggested that the protein positively affected the folding of newly
synthesized luciferase substrates. Higher luciferase activity was achieved by
increasing the enzymatic activity of luciferase and not by a change in
expressed amounts of luciferase. It is known that the enzymatic activity of
luciferase during recovery from thermal inactivation is highly dependent on
chaperone activity, and overexpression of Hsp70 alone is sufficient to enhance
reactivation of heat-denatured luciferase activity during recovery at 37°C
(Michels et al., 1997
). During
recovery from heat denaturation at 45°C, the level of luciferase activity
in UL14-protein-expressing cell lines was no greater than that in
non-expressing cells (data not shown). Although UL14 protein may contribute to
thermotolerance of the cell, it was not used in the folding process after heat
denaturation. A possible explanation is that UL14 protein becomes
predominantly nuclear upon heat shock and is slower than Hsp70 in returning to
the cytosol upon recovery. This means that the protein is not in contact with
luciferase substrates in the cytoplasm for at least a few hours, unlike Hsp70,
which can localize in the cytoplasm even after heat shock. Overall, we
conclude that UL14 protein is an HSP-like protein.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Angelidis, C. E., Lazaridis, I. and Pagoulatos, G. N. (1999). Aggregation of hsp70 and hsc70 in vivo is distinct and temperature-dependent and their chaperone function is directly related to non-aggregated forms. Eur. J. Biochem. 259,505 -512.[Medline]
Archer, J. and Solomon, F. (1994). Deconstructing the microtubule-organizing center. Cell 76,589 -591.[Medline]
Beissinger, M. and Buchner, J. (1998). How chaperones fold proteins. Biol. Chem. 379,245 -259.
Bochkareva, E. S., Lissin, N. M. and Girshovich, A. S. (1988). Transient association of newly synthesized unfolded proteins with the heat shock GroEL protein. Nature 336,254 -257.[Medline]
Bukau, B. and Horwich, A. L. (1998). The Hsp70 and Hsp60 chaperone machines. Cell 92,351 -366.[Medline]
Burkham, J., Coen, D. M. and Weller, S. K.
(1998). ND10 protein PML is recruited to Herpes simplex virus
type 1 prereplicative sites and replication compartments in the presence of
viral DNA polymerase. J. Virol.
72,10100
-10107.
Colberg-Poley, A. M. and Santomenna, L. D. (1988). Selective induction of chromosomal gene expression by human cytomegalovirus. Virology 166,217 -228.[Medline]
Cripe, T. P., Delos, S. E., Estes, P. A. and Garcea, R. L. (1995). In vivo and in vitro association of hsc70 with polyomavirus capsid proteins. J. Virol. 69,7807 -7813.[Abstract]
Cunningham, C., Davison, A. J., MacLean, A. R., Taus, N. S. and
Baines, J. D. (2000). Herpes simplex virus type 1 gene UL14:
phenotype of a null mutant and identification of the encoded protein.
J. Virol. 74,33
-41.
Daikoku, T., Shibata, S., Goshima, F., Oshima, S., Tsurumi, T., Yamada, H., Yamashita, Y. and Nishiyama, Y. (1997). Purification and characterization of the protein kinase encoded by the UL13 gene of herpes simplex virus type 2. Virology 235, 82-93.[Medline]
Diaz-Latoud, C., Diaz, J.-J., Fabre-Jonca, N., Kindbeiter, K., Madjar, J.-J. and Arrigo, A.-P. (1997). Herpes simplex virus Us11 protein enhances recovery of protein synthesis and survival in heat shock treated HeLa cells. Cell Stress Chaperones 2, 119-131.[Medline]
Dolan, A., Jamieson, F. E., Cunningham, C., Barnett, B. C. and
McGeoch, D. J. (1998). The genome sequence of herpes simplex
virus type 2. J. Virol.
72,2010
-2021.
Everett, R. D., Earnshaw, W. C., Findlay, J. and Lomonte, P. (1999a). Specific destruction of kinetochore protein CENP-C and disruption of cell division by herpes simplex virus immediate-early protein Vmw110. EMBO J. 18,1526 -1538.[Medline]
Everett, R. D., Earnshaw, W. C., Pluta, A. F., Sternsdorf, T., Ainsztein, A. M., Carmena, M., Ruchaud, S., Hsu, W.-L. and Orr, A. (1999b). A dynamic connection between centromeres and ND10 proteins. J. Cell Sci. 112,3443 -3454.[Abstract]
Ewalt, K. L., Hendrick, J. P., Houry, W. A. and Hartl, F. U. (1997). In vivo observation of polypeptide flux through the bacterial chaperonin system. Cell 90,491 -500.[Medline]
Farr, G. W., Scharl, E. C., Schumacher, R. J., Sondek, S. and Horwich, A. L. (1997). Chaperonin-mediated folding in the eukaryotic cytosol proceeds through rounds of release of native and nonnative forms. Cell 89,927 -937.[Medline]
Fink, A. L. Chaperone-mediated protein folding.
(1999). Physiol. Rev.
79,425
-449.
Flaherty, K. M., DeLuca-Flaherty, C. and McKay, D. B. (1990). Three dimensional structure of the ATPase fragment of a 70K heat shock congnate protein. Nature 346,623 -628.[Medline]
Frydman, J. and Hartl, F. U. (1996). Principles of chaperone-associated protein folding: differences between in vitro and in vivo mechanism. Science 272,1497 -1502.[Abstract]
Frydman, J., Nimmesgern, E., Ohtsuka, K. and Hartl, F. U. (1994). Folding of nascent polypeptide chains in a high molecular mass assembly with molecular chaperones. Nature 370,111 -117.[Medline]
Gaitanaris, G. A., Vysokanov, A., Hung, S.-C., Gottesman, M. E. and Gragerov, A. (1994). Successive action of Escherichia coli chaperones in vivo. Mol. Microbiol. 14,861 -869.[Medline]
Hartl, F. U. (1996). Molecular chaperones in cellular protein folding. Nature 381,571 -580.[Medline]
Hattori, H., Kaneda, T., Lokeshwar. B., Laszio, A. and Ohtsuka, K. (1993). A stress-inducible 40 kDa protein (hsp40): purification by modified two-dimensional gel electrophoresis and co-localization with hsc70(p73) in heat-shocked HeLa cells. J. Cell Sci. 104,629 -638.[Abstract]
Hendrick, J. P. and Hartl, F. U. (1993). Molecular chaperone functions of heat-shock proteins. Annu. Rev. Biochem. 62,349 -384.[Medline]
Horwich, A. L., Brooks Low, K., Fenton, W. A., Hirshfield, I. N. and Furtak, K. (1993). Folding in vivo of bacterial cytoplasmic proteins: role of GroEL. Cell 74,909 -917.[Medline]
Jakob, U. and Buchner, J. (1994). Assisting spontaneity: the role of HSP90 and small HSPs as molecular chaperones. Trends Biochem. Sci. 19,205 -211.[Medline]
Jakob, U., Muse, W., Eser, M. and Bardwell, J. C. A. (1999). Chaperone activity with a redox switch. Cell 96,341 -352.[Medline]
Khandijan, E. W. and Türler, H. (1983).
Simian virus 40 and polyoma virus induce synthesis of heat shock proteins in
permissive cells. Mol. Cell. Biol.
3, 1-8.
Kiang, J. G. and Tsokos, G. C. (1998). Heat shock protein 70 kDa: molecular biology, biochemistry and physiology. Pharmacol. Ther. 80,183 -201.[Medline]
Langer, T., Lu, C., Echols, H., Flanagan, L., Hayer, M. K. and Hartl, F. U. (1992). Successive action of DnaK, DnaJ and GroEL along the pathway of chaperone-mediated protein folding. Nature 356,683 -689.[Medline]
Laszlo, A., Davidson, T., Hu, A., Landry, J. and Bedford, J. (1993). Putative determinants of the cellular response to hyperthermia. Int. J. Radiat. Biol. 63,569 -581.[Medline]
Lewis, S. A., Tian, G., Vainberg, I. E. and Cowan, N. J.
(1996). Chaperonin-mediated folding of actin and tubulin.
J. Cell Biol. 132,1
-4.
Liang, P. and MacRae, T. H. (1997). Molecular chaperones and the cytoskeleton. J. Cell Sci. 110,1431 -1440.[Abstract]
Maul, G. G., Guldner, H. H. and Spivack, J. G.
(1993). Modification of discrete nuclear domains induced by
herpes simplex virus type 1 immediate early gene 1 product (ICP0).
J. Gen. Virol. 74,2679
-2690.
Maul, G. G., Yu, E., Ishov, A. M. and Epstein, A. L. (1995). Nuclear domain 10 (ND10) associated proteins are also present in nuclear bodies and redistribute to hundreds of nuclear sites after stress. J. Cell. Biochem. 59,498 -513.[Medline]
Mayhew, M. and Hartl, F. U. (1996). Molecular chaperone proteins. In Escherichia coli and Salmonella typhimurium Cellular and Molecular Biology (ed. F. C. Neidhardt), pp.922 -937. Washington DC: ASM Press.
McGeoch, D. J., Dalrymple, M. A., Davison, A. J., Dolan, A.,
Frame, M. C., McNab, D., Perry, L. J., Scott, J. E. and Taylor, P.
(1988). The complete DNA sequence of the long unique region in
the genome of herpes simplex virus type 1. J. Gen.
Virol. 69,1531
-1574.
Michels, A. A., Kanon, B., Konings, A. W. T., Ohtsuka, K.,
Bensaude, O. and Kampinga, H. H. (1997). Hsp70 and Hsp40
chaperone activities in the cytoplasm and the nucleus of mammalian cells.
J. Biol. Chem. 272,33283
-33289.
Ohtsuka, K. and Hata, M. (2000). Molecular chaperone function of mammalian Hsp70 and Hsp40-a review. Int. J. Hyperthermia 16,231 -245.[Medline]
Reid, B. G. and Flynn, G. C. (1996). GroEL
binds to and unfolds rhodanese posttranslationally. J. Biol.
Chem. 271,7212
-7217.
Roti Roti, J. L., Kampinga, H. H., Malyapa, R. S., Wright, W. D., vanderWaal, R. P. and Xu, M. (1998). Nuclear matrix as a target for hyperthermic killing of cancer cells. Cell Stress Chaperones 3,245 -255.[Medline]
Rüdiger, S., Buchberger, A. and Bukau, B. (1997). Principles governing the interaction of Hsp70 chaperones with substrates. Nat. Struct. Biol. 4, 342-349.[Medline]
Sedger, L. and Ruby, J. (1994). Heat shock
response to vaccinia virus infection. J Virol.
68,4685
-4689.
Schatten, G. (1994). The centrosome and its mode of inheritance: the reduction of the centrosome during gametogenesis and its restoration during fertilization. Dev. Biol. 165,299 -335.[Medline]
Stuurman, N., de Graaf, A., Floore, A., Josso, A., Humbel, B.,
de Jong, L. and van Driel. (1992). A monoclonal antibody
recognizing nuclear matrix-associated nuclear bodies. J. Cell
Sci. 101,773
-784.
Stuurman, N., Floore, A., Middelkoop, R., van Driel, R. and de Jong, L. (1997). OML shuttles between nuclear bodies and the cytoplasm. Cell. Mol. Biol. Lett. 2, 137-150.
VanderWaal, R., Thampy, G., Wright, W. D. and RotiRoti, J. L. (1996). Heat-induced modifications in the association of specific proteins with the nuclear matrix. Radiat. Res. 145,746 -753.[Medline]
Wada, K., Goshima, F., Takakuwa, H., Yamada, H., Daikoku, T. and
Nishiyama, Y. (1999). Identification and characterization of
the UL14 gene product of herpes simplex virus type 2. J. Gen.
Virol. 80,2423
-2431.
Wang, T. F., Chang, J. H. and Wang, C. (1993).
Identification of the peptide binding domain of hsc70-18kilodalton fragment
located immediately after the ATPase domain is sufficient for high affinity
binding. J. Biol. Chem.
268,26049
-26051.
Wei, Y.-q., Zhao, X., Kariya, Y., Teshigawara, K. and Uchida, A. (1995). Inhibition of proliferation and induction of apoptosis by abrogation of heat-shock protein (HSP) 70 expression in tumor cells. Cancer Immunol. Immunother. 40, 73-78.[Medline]
Wu, B. J., Hurst, H. C., Jones, N. C. and Morimoto, R. I.
(1986). The E1A 13S product of adenoviru 5 activates
transcription of the cellular human HSP70 gene. Mol. Cell.
Biol. 6,2994
-2999.
Yamauchi, Y., Wada, K., Goshima, F., Takakuwa, H., Daikoku, T.,
Yamada, M. and Nishiyama, Y. (2001). The UL14 protein of
herpes siplex virus type 2 translocates the minor capsid protein VP26 and the
DNA cleavage and packaging UL33 potein into the nucleus of coexpressing cells.
J. Gen. Virol. 82,321
-330.
Zhu, X., Zhao, X., Burkholder, W. F., Gragerov, A., Ogata, C. M., Gottesman, M. E. and Hendrickson, W. A. (1996). Structural analysis of substrate binding by the molecular chaperone DnaK. Science 272,1606 -1614.[Abstract]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
Y. Yamauchi, K. Kiriyama, N. Kubota, H. Kimura, J. Usukura, and Y. Nishiyama The UL14 Tegument Protein of Herpes Simplex Virus Type 1 Is Required for Efficient Nuclear Transport of the Alpha Transinducing Factor VP16 and Viral Capsids J. Virol., February 1, 2008; 82(3): 1094 - 1106. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Mills, M. Rozanov, A. Lomsadze, T. Tatusova, and M. Borodovsky Improving gene annotation of complete viral genomes Nucleic Acids Res., December 1, 2003; 31(23): 7041 - 7055. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||