|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
Research Article |

Physiologisch-chemisches Institut, University of Tübingen, 72076
Tübingen, Germany
* Present address: Howard Hughes Medical Institute, Department of Molecular,
Cell and Developmental Biology, University of California, Los Angeles, CA
90095-1662, USA
Author for correspondence (e-mail:
michael.duszenko{at}uni-tuebingen.de
)
Accepted 6 April 2002
| Summary |
|---|
|
|
|---|
The transamidase mechanism of GPI anchoring was studied in bloodstream forms of Trypanosoma brucei using media containing hydrazine or biotinylated hydrazine. In the presence of the latter nucleophile, part of the newly formed VSG was linked to this instead of the GPI anchor and was not transferred to the cell surface. VSG-hydrazine-biotin was detected by streptavidin in western blots and intracellularly in Golgi-like compartments.
Key words: Trypanosoma brucei, Transamidase, GPI membrane anchor, GPI8, Intracellular localization, Variant surface glycoprotein
| Introduction |
|---|
|
|
|---|
In earlier studies, expression of prepromini-placental alkaline phosphatase
(MiniPLAP) led to about 10% of protein being cleaved correctly but not
transferred to the GPI anchor (Maxwell et
al., 1995a
). On the basis of these results, a transamidase
reaction was supposed, using an activated intermediate of the enzyme, with the
carbonyl group of the amino acid at the
-site of the acceptor. This
activated intermediate accepted either the nucleophilic amino group of the
ethanolamine residue of GPI to form GPI-linked mature mini-PLAP or an abundant
nucleophile such as water to yield free mature mini-PLAP. Direct evidence for
a transamidase mechanism came from the observation that a microsomal enzyme
activity capable of removing the C-terminal GPI anchor signal was enhanced by
small nucleophilic amines (Maxwell et al.,
1995b
). Here the addition of hydrazine to microsomal membranes led
to mature miniPLAP that lacked both the C terminal pro-peptide and GPI. Using
a biotinylated derivative of hydrazine instead of hydrazine itself, the
released VSG could be precipitated with streptavidin-agarose, indicating that
the biotin moiety was covalently linked to the protein
(Sharma et al., 1999
). In
trypanosomes, the reaction was inhibited by sulfhydryl alkylating reagents,
suggesting that the transamidase contains a functionally important sulfhydryl
residue (Mayor et al., 1991
).
Transamidase-deficient cells are expected to accumulate complete GPI lipids as
well as precursor proteins. This phenotype is exhibited by the yeast mutants
gaa1 and gpi8 and a mammalian mutant cell line (class K)
(Mohney et al., 1994
;
Hamburger et al., 1995
;
Benghezal et al., 1995
;
Yu et al., 1997
;
Chen et al., 1996
).
GPI8 is an essential yeast gene. It encodes a putative type I
transmembrane ER protein with a large luminal domain and shows 27.5% identity
to jack bean asparaginyl endopeptidase (Abe
et al., 1993
). Homologies between this family and other cysteine
proteinases, such as caspases, pointed to C199 and H157 being potential active
site residues in the yeast protein. Indeed, Gpi8 alleles mutated at C199 or
H157 were nonfunctional, that is, they were unable to suppress the lethality
of gpi8 mutants (Meyer et al.,
2000
). The observed homology with proteases suggests that Gpi8 is
directly involved in the proteolytic removal of the GPI-anchoring signal. In
contrast to Gaa1, Gpi8 does not contain any known ER retrieval sequences such
as KKXX or KXKXX.
The yeast GAA1 gene encodes a 68 kDa protein containing a
cytosolic ER retrieval signal at the C-terminus, several membrane spanning
domains and a large luminal domain
(Hamburger et al., 1995
). As
shown in the same work, a gaa1 mutant was defective in the
post-translational attachment of GPI to proteins. Thus Gaa1 seems to be
required for the attachment of GPI to proteins. Since Gaa1 and Gpi8
co-precipitate, it seems likely that both enzymes together constitute the
functional transamidase (Ohishi et al.,
2000
). More recently, two new components have been reported: PIG-S
and PIG-T (Ohishi et al.,
2001
). They form a complex with Gaa1 and Gpi8, and PIG-S and PIG-T
knockout cells were defective in the transfer of GPI to proteins. Gpi16 (Yhr
188c) and Gpi17 (Ydr434w) are the orthologues of PIG-T and PIG-S in yeast.
Gpi16 is an essential N-glycosylated transmembrane protein, and its depletion
results in the accumulation of the complete GPI lipid CP2 and of unprocessed
GPI precursor proteins. Gpi8 and Gpi16p are unstable if either one of them is
depleted (Fraering et al.,
2001
).
In the work presented here, GPI8 from Trypanosoma brucei (TbGPI8) was cloned, and the recombinant protein (TbGpi8) was heterologously expressed in E. coli and used to generate specific antibodies in chicken. A readout assay was designed to document the in vivo activity of TbGpi8; briefly, T. brucei bloodforms were cultured in the presence of tunicamycin and exposed to biotinylated hydrazine to monitor processing of VSG. In addition, activity of the isolated enzyme was demonstrated in vitro using a synthetic substrate Acetyl-S-V-L-N-7-amino-4-methyl-coumarine (Ac-S-V-L-N-AMC), which yields a fluorogenic chromophor after cleavage, and the reaction mechanism was studied using small nucleophilic amines. Localization studies of TbGpi8 were performed using specific antibodies.
| Materials and Methods |
|---|
|
|
|---|
Cell culture
Bloodstream-form trypanosomes were cultivated at 37°C in a
water-saturated atmosphere containing 5% CO2. Cells were harvested
at a density of about 1-2x106 ml-1. For
glycosylation inhibition and anchor exchange, either 10 µg ml-1
tunicamycin and/or 0.5 mM hydrazine was added to culture media overnight
unless stated otherwise. Culture medium was minimum essential medium modified
by Duszenko et al. (Duszenko et al.,
1992
).
Preparation of trypanosomal lysates
Freshly isolated trypanosomes (7x109 per ml) were lysed in
ice-cold phosphate buffer (10 mM, pH 7.4) containing 2 mM DTT, 10 mM
2-aminopurine and 1 µM each of the protease inhibitors pepstatin,
leupeptine and chymostatin and immediately homogenized with a Dounce
homogenizer. Cell lysis was controlled by phase contrast microscopy and
stopped by addition of a 10-fold concentrated isotonic phosphate buffer (180
mM, pH 7.4) to one tenth of the volume after more than 90% of cells were
broken. The lysate was centrifuged at 12,000 g for 6 minutes
at 4°C to remove cell debris, mitochondrial membranes and nuclei. The
remaining lysate was immediately divided into aliquots and stored in liquid
nitrogen.
SDS/PAGE and western blotting analysis
For SDS-polyacrylamide gels a standard protocol
(Laemmli, 1970
) using 10%
running and 5% stacking gels was applied. Western blotting was performed using
a Semi-Dry Apparatus (Amersham, Braunschweig, Germany). Three filter papers
were placed on the anode plate, before the nitrocellulose membrane, the gel
and three additional filter papers were added. All the materials were soaked
in transfer buffer (48 mM Tris, 39 mM Glycin, 0.0038% SDS, 20% Methanol, pH
9.2) before use. The electro transfer was carried out by a constant electric
current of 5.5 mA cm-2 for 30 minutes. Biotin tag, VSG and sVSG
were examined by using streptavidin and antibodies specific for VSG and CRD.
Gpi8 was detected using anti-Gpi8 antibodies from chicken; control staining
was performed using IgY prepared from eggs of pre-immune chicken.
Immunocytochemistry of cells
1x107 trypanosomes were fixed in 1 ml formaldehyde in
HEPES buffered saline (2.5% formaldehyde, 0.1% glutaraldehyde, 0.85% NaCl, 25
mM HEPES, pH 7.3) for at least 1 hour. Cells were washed twice with cold HEPES
buffered saline and cold 1% BSA and resuspended in 400 µl 1% BSA. Cells
were permeabilized using 0.1% Triton X-100 and finally resuspended in 0.5 ml
PBS containing 1% BSA. 5 µl of this suspension was transferred to glass
slides and dried at 37°C for 3 hours or at room temperature overnight. The
slide with fixed cells was incubated for 15 minutes with 10 µl of the first
antibody in a wet box, washed for 5 minutes with distilled water and dried at
room temperature. It was then incubated for 15 minutes with FITC- or
TRITC-labeled second antibody and washed again for 5 minutes. For
counterstaining of the DNA, the slide was incubated with bisbenzimide for 15
minutes and again dried at room temperature. Slides were viewed and analyzed
using an Olympus BH2 fluorescent microscope and imaging software (Soft Imaging
System GmbH, Stuttgart, Germany).
Synthesis of Ac-S-V-L-N-AMC
Commercially available 7-amino-4-methylcoumarin (AMC) was coupled with
Fmoc-Asn(Trt)-OH using 1 equivalent of isobutylchloroformate in the presence
of 1 equivalent of N-ethyldiisopropylamine for 1 hour at -10°C and at room
temperature overnight thereafter. Following removal of the solvent (DMF), the
reaction mixture was dissolved in ethylacetate and washed three times each
with citric acid (2 M) and water. The product was dried over sodium sulfate
and precipitated by addition of petrolether. The Fmoc group was removed using
20% piperidine in DMF and stirring for 30 minutes. Acetyl-Ser(tBu)-OH was
synthesized by treatment of H-Ser(tBu)-OH with Ac2O/pyridine in
dichloromethane. Boc-Val-Leu-OH was synthesized using
Boc-Val-hydroxysuccinimid ester and leucine sodium salt in distilled water/DMF
overnight at room temperature. Removal of the Boc protection group was
achieved by stirring the reaction mixture for 1 hour at room temperature in
TFA:dichloromethane (1:1). The product H-Val-Leu-OH (TFA salt) was coupled
with Ac-Ser(tBu)-hydroxysuccinimidester in a mixture of DMF and water.
Finally, Ac-Ser(tBu)-Val-Leu-Asn(Trt)-AMC was produced by a mixed anhydrid
coupling reaction of Ac-Ser(tBu)-Val-Leu-OH and Asn(Trt)-AMC in the presence
of 1 equivalent of diisopropylethylamine and 1 equivalent of
isobutychloroformate as described above. The remaining protecting groups were
removed by addition of TFA for 1 hour at room temperature. The final product
was purified by semi-preparative HPLC using a TFA:acetonitril gradient on a
hydrophobic C18 column (Nucleosil 300, 5 µm; Machery and Nagel, Düren,
Germany). The product was pure as judged by analytical HPLC, and the structure
was confirmed using Maldi mass spectroscopy.
Enzyme assay using Ac-S-V-L-N-AMC
Ac-S-V-L-N-AMC (1 mM) was incubated with trypanosomal lysates (10% in 50 mM
citrate buffer, pH 5.5) at 30°C. To determine the pH optimum, the reaction
mixture was incubated overnight at 30°C in 50 mM citrate buffer at pH
values ranging from 2.5 to 6.5 or in 50 mM HEPES buffer at pH values ranging
from 5.5 to 9.5. Inhibition studies using sulfhydryl alkylating reagent were
performed in the presence of 1 mM pCMPSA at pH 5.5 All assays were performed
in the presence of protease inhibitors pepstatin, chymostatin and leupeptin (1
µM each).
Cloning of TbGPI8
Degenerated oligonucleotide primers were designed against highly conserved
regions on the basis of the sequences of the yeast and human genes by using
BLASTp algorithms
(www.ncbi.nlm.nih.gov
) (Altschul et al., 1997
) and
DNA sequences of T. brucei obtained by TIGR (TIGRDatabases;
www.tigr.org
). The 5'-sequence of TbGPI8 was amplified with Red Taq
polymerase (Sigma, Deisenhofen, Germany) using primers GPI8AS1
(CCACATCATCATIAGIGTITCIGCIATITC)/SLSE23 (CGCTATTATTAGAACAGTTTCTG) and cloned
into pBS KS+ (Stratagene, The Netherlands). The 3'-sequence
was amplified using primers GPI8SE3 (GGACTCGGAGTTCATGAGCTC)/OT203N
(CCCGGGT20VNN) and cloned into pBS KS+. cDNA from the
bloodstream form MITat 1.2 was used as template. After sequencing by GATC
(Konstanz, Germany), two specific primers GPI8SE1
(CGCAGAGGTTTCAAACAAGTGG)/GPI8AS2 (CTTTGTTGCACGTGACTACAATA) were used to
amplify the TbGPI8-ORF with Pfu polymerase (Stratagene, The
Netherlands) from bloodstream form MIT1.2 cDNA and cloned into pBS
KS+.
Expression of TbGpi8
To clone TbGPI8 into expression vectors, the plasmid pBS KS+ containing
TbGPI8 cDNA was used as the template. Plasmid pMAL-c2E (NEB, Schwalbach,
Germany) was used for the maltose-binding protein (MBP) fusion system to
heterologously express TbGpi8. TbGPI8 was amplified using primers GPSEMAL1
(GCAGCAGGTACCGGCGGAAGGCTTTCATGGTATG)/GPASMAL2
(GATATAGGTACCCTAGAACAAATCGTAACGTAACTCTAC), cut by KpnI (underlined) and
ligated into the KpnI site of pMAL-c2E. Thus TbGpi8 (which is devoid of the
putative N-terminal signal sequence) was placed at the C-terminus of MBP.
E. coli strain ER2566 was used to express the fusion protein MBP-TbGPI8. When the OD600 of the culture reached 0.5-0.8, protein expression was induced at 15°C overnight using 0.3 mM IPTG. Cells were spun down (5000 g for 10 minutes at 4°C), and cell pellets were stored at -20°C. After thawing, pellets from a 50 ml culture were resuspended in 5 ml ice-cold HEPES buffer (20 mM HEPES, 500 mM NaCl, 1 mM EDTA, pH 7.4) and disrupted by sonification in ice water. A clear cell extract was obtained by centrifugation at 12,000 g for 30 minutes.
An amylose resin column (2 ml) was equilibrated with 16 ml HEPES buffer, before 5 ml lysate was loaded onto the column and washed with 24 ml HEPES buffer. The fusion protein was eluted with HEPES buffer containing 10 mM maltose. The eluted material was dialyzed against 50 mM Tris-HCl (pH 8.0) and treated with enterokinase (20 µg MBP-TbGpi8 per 1 µg enterokinase) overnight at room temperature.
In vitro activity assay of TbGpi8
Trypanosomal lysates or recombinant TbGpi8 was mixed with
Ac-S-V-L-N-AMC and 10 mM hydrazine. The mixture was incubated at 30°C for
1 hour or overnight and analyzed by spectrofluorometry. (Excitation
wavelength: 360 nm; emission scan: 370-530 nm.)
Anti-TbGpi8 IgY
A chicken was immunized with isolated MBP-TbGpi8. After the first
immunization using 0.5 mg isolated protein and Freunds complete adjuvants, the
chicken was boostered twice with 0.25 mg protein in Freunds incomplete
adjuvants on day 28 and day 42 after the initial immunization. The increase of
antibody titer was controlled by ELISA tests.
Antibodies were prepared according to Polson et al.
(Polson et al., 1980
) and
Gassmann et al. (Gassmann et al.,
1990
). Briefly, three egg yolks were carefully separated from egg
whites, mixed with 25 ml phosphate buffer (1.8 g/l
Na2HPO4, 1.4 g/l KH2PO4, 5.8 g/l
NaCl, pH 7.2) and 75 ml PEG (7%) and incubated at 4°C for 30 minutes.
After centrifugation at 3000 g for 10 minutes at 4°C, the
supernatant was filtered through mull. PEG was added to the filtrate to a
final concentration of 12% and incubated at 4°C for 30 minutes. After
centrifugation at 3000 g for 10 minutes at 4°C, the pellet
was resuspended in 50 ml phosphate buffer and 50 ml 24% PEG and incubated at
4°C for 30 minutes. The mixture was centrifuged at 3000 g
for 10 minutes at 4°C, followed by resuspension of the pellet in 25 ml
phosphate buffer and 25 ml ethanol. After centrifugation at 3000
g for 10 minutes at 4°C the pellet was dissolved in 10 ml
phosphate buffer and centrifuged at 3000 g for 10 minutes at
4°C again. The supernatant was stored at -20°C.
10 ml isolated chicken antibodies were run through a 1 ml amylose column containing MBP. The flow-through without antibodies against MBP was pooled and put onto a second 1 ml amylose column containing the fusion protein MBP-TbGpi8. The column was washed with phosphate buffer thoroughly, and the flow-through was discarded. Specific antibodies against TbGpi8 were eluted with 100 mM glycine/HCl at pH 2.5 thereafter.
| Results |
|---|
|
|
|---|
|
Expression and purification of TbGpi8 in E. coli
The MBP fusion protein expression system was used to express
TbGpi8. E. coli strain 2566 containing TbGPI8 in
plasmid pMAL-c2E was induced overnight with 0.3 mM IPTG at 15°C. Cells
were sonicated using short pulses of 15 seconds, each for about 15 minutes,
then centrifuged. The supernatant was applied onto an amylose resin column and
purified. Following this affinity chromatography, the MBP-TbGpi8
fusion protein showed a single band on SDS-PAGE with an apparent molecular
mass of about 80 kDa (Fig. 2).
In this way, about 2 mg of MBP-TbGpi8 was isolated from a 50 ml
culture. To obtain pure TbGpi8, enterokinase cleavage was carried out
using a ratio of 1:50 (w/w) cleaving enzyme to fusion protein. The reaction
mixture was incubated overnight at room temperature and analysed by SDS-PAGE.
As shown in Fig. 3, several
protein bands appeared in addition to TbGpi8, MBP and enterokinase,
which were removed, however, by using an amylose resin column. To avoid
confusion with MBP (molecular weight: 42 kDa), the flow-through was run again
over an amylose column, and the flow-through of the second column was analysed
by SDS/PAGE (Fig. 3, lane 2).
Although the apparent molecular mass was higher (about 48 kDa) than calculated
from the amino acid sequence (35 kDa), we assume that this protein is mature
TbGpi8 because it contains no cleavage site for enterokinase. All
MBP-linked products were absent from the flow-though of the amylose resin
column but were easily eluted with maltose
(Fig. 3, lane 3); enterokinase
light chain, as used in our experiments, has a molecular weight of 26.5 kDa
and runs at an apparent molecular weight of 31 kDa on a SDS-PAGE (data
obtained from the manufacturer). We contribute the observed differences in the
apparent molecular weight of the recombinant TbGpi8 to a slightly
different folding pattern, rather then to a remaining part of MBP.
|
|
In vitro peptidase assay using an AMC-linked peptide as
substrate
The use of 7-amino-4-methyl-coumarin (AMC) fluorogenic peptide substrates
is a well established method for the determination of protease activity and
specificity (Zimmerman et al.,
1977
). The substrate is stable in solution and closely related to
natural peptide substrates. Specific cleavage of the `anilide' bond liberates
the fluorogenic AMC group, thus allowing the simple determination of cleavage
rates for individual proteases. The cleavage site for GPI attachment
(
-site) in VSG is, as far as is known so far, one of the following
amino acids: D, S or N (Cross,
1990
). We used the synthetic peptide Ac-S-V-L-N-AMC as a substrate
to test for a transamidase activity in trypanosomal lysates. The excitation
and emission maxima of amino-acid-conjugated AMC substrates are 350 nm and 400
nm, respectively. Cleavage of the substrate will release the free AMC residue
and results in a shift of the excitation and emission maxima to 340 nm and 440
nm, respectively. Hydrolysis of the substrate was monitored fluorometrically
with an excitation wavelength of 350 nm and an emission scan from 370 nm to
530 nm using a spectrofluorimeter. Ac-S-V-L-N-AMC was incubated in the
presence of 1 µM protease inhibitors (leupeptin, pepstatin and chymostatin)
at 30°C for 1 hour using 1 mM substrate in 50 mM citrate buffer at pH 5.5.
As shown in Fig. 4a, the
emission maxima changed from 400 nm to about 440 nm after addition of
trypanosomal lysates, suggesting that the lysates contained an active enzyme,
which catalyzed the cleavage of the anilide bond. Using trypanosomal lysates
adjusted to different pH values, the highest emission was seen at pH 5.5,
whereas a rapid decrease in activity was measured at more acidic or basic
condition: at pH 4.5 or pH 6.5 only about 10% of the enzyme activity remained
(Fig. 4b).
|
To further analyze whether a transamidase reaction is involved in
Ac-S-V-L-N-AMC cleavage, we used hydrazine and
p-chloro-mercuriphenyl-sulfonic acid (pCMPSA). A nucleophilic attack
by GPI, water or a nucleophile such as hydrazine is the final step of the
transamidation reaction (Udenfriend and
Kodukula, 1995
). In lysates containing 10 mM hydrazine, a
significantly higher emission was observed at
=440 nm than in samples
without hydrazine (Fig. 4c). As
shown previously, the GPI anchoring reaction in bloodstream-stage trypanosomes
is inhibited by the sulfhydryl alkylating reagent pCMPSA
(Mayor et al., 1991
;
Sharma et al., 2000
),
suggesting that a histidine and/or a cysteine residue is located at the active
site (Meyer et al., 2000
). We
have checked the effect of pCMPSA as well, and we found a strong inhibition of
AMC release (Fig. 4d).
At least two proteins participate in the transamidation reaction; these
include Gaa1 and Gpi8. Therefore, mutant yeast cells deficient in either Gaa1
or Gpi8 failed to express GPI-anchored proteins
(Benghezal et al., 1996
;
Hamburger et al., 1995
).
Assuming that trypanosome lysates contain the active transamidase complex,
addition of recombinant TbGpi8 should increase the endogenous Gpi8
concentration and thus enhance the activity of the enzyme complex
(Sharma et al., 2000
). To
check for this possibility, isolated TbGpi8 was incubated together
with trypanosome lysate and the synthetic peptide substrate Ac-S-V-L-N-AMC
overnight at 30°C in citrate buffer containing 10 mM hydrazine (see below)
and the protease inhibitors leupeptin, pepstatin and chymostatin (1 µM
each) at pH 5.5. Under these conditions, the cleavage capacity was
significantly elevated by the recombinant protein compared with the lysate
alone (Fig. 5a).
|
Since Gpi8 bears resemblance to several plant and invertebrate proteases,
it could have some proteolytic activity itself. On the basis of this
assumption, the transamidase activity of TbGpi8 was tested in the
absence of trypanosomal lysates. As before, when Ac-S-V-L-N-AMC was incubated
in the presence of recombinant TbGpi8, the AMC residue was cleaved
off, as shown by a significant increase in light absorption at
=440
nm. Interestingly, AMC was produced by the isolated TbGpi8 but not by
MBP-TbGpi8 (Fig. 5b). These results indicate that recombinant TbgGpi8 has a peptidase
activity itself and cleaves Acetyl-S-V-L-N-AMC at the P1 position, which
corresponds to the
position in VSG, leading to the removal of the
C-terminal peptide. When enterokinase was used instead of the isolated
TbGpi8, no release of AMC was monitored at the enterokinase cleavage
site, which is at K position in the DDDDK sequence (data not shown). In
addition, trypanosome lysates were incubated in the presence or absence of
Gpi8-specific antibodies to monitor whether the enzyme is inhibited. As shown
in Fig. 5c, enzyme activity is
reduced to a maximum of about 60%, but not completely blocked. We assume that
binding of the polyclonal antibody is not in the area of the active
centre.
Intracellular localization of TbGpi8 using isolated anti-TbGpi8
IgY
For technical reasons, MBP-TbGpi8 was used to produce antibodies
by immunisation of a hen. IgY was isolated from egg yolk by PEG precipitation.
Specific anti-TbGpi8 IgY was affinity purified using a MBP-amylose
column. The flow-through was applied to a MBP-TbGpi8-amylose column,
and bound antibodies were eluted at pH 2.5. The specific TbGpi8
antibodies isolated in this way were used for western blotting and
immunolocalization studies. Using affinity-purified anti-TbGpi8 IgY,
the protein was detected by SDS-PAGE and western blotting. As shown in
Fig. 6, the antibodies
specifically detected two bands showing apparent masses of 48 kDa and 45 kDa
in trypanosomal lysates. Since the apparent molecular mass calculated from the
protein sequence is 35 kDa, then Gpi8 must run, for unknown reasons, at a
higher molecular mass by the SDS-PAGE (compare with
Fig. 3). The Gpi8 sequence
shows one putative N-glycosylation site. Thus the 45 kDa may represent either
a non glycosylated protein or a protein non-specifically labeled by our
antibody.
|
For intracellular immunolocalization of TbGpi8, formaldehyde fixed cells were labeled with anti-TbGpi8 IgY, whereas the nucleus and kinetoplast were counterstained using bisbenzimide. The results are shown in Fig. 7. Labelling around the nucleus and in tubular and vesicular structures throughout the cell was visible. Colocalization studies using BiP-specific antibodies, kindly provided by J. D. Bangs (Wisconsin University), strongly indicates an ER-specific localization.
|
Anchor exchange mechanism in trypanosomes
Nonglycosylated VSG
Tunicamycin is a hydrophobic analogue of UDP-N-acetylglucosamine. It blocks
addition of N-acetylglucosamine to dolicholphosphate, that is, the first step
to form N-linked oligosaccharides. In order to produce non-glycosylated VSG
with a molecular weight that differs from that of the already processed `old'
VSG, cells were cultivated in the presence of 10 µg ml-1
tunicamycin. After 4 hours in culture and following separation of proteins by
SDS-PAGE, two additional VSG bands with distinctively lower molecular weights
from the mature VSG were detected on western blots using anti-VSG antibodies
(Fig. 8). Since glycosylation
of VSG was efficiently inhibited by tunicamycin, we used this method
throughout the following experiments. In order to detect different forms of
VSG, we used either trypanosome clone-specific antibodies (to detect the VSG
antigen type), CRD-specific antibodies [to detect the cross-reacting
determinant of the GPI anchor (Zamze et
al., 1988
)] or streptavidin HRP (to detect biotinylated VSG). In
this way, the various VSG forms could be distinguished
(Table 1).
|
|
Use of hydrazine and hydrazine-biotin as substitutes for GPI during
the transamidation reaction
The proposed mechanism of GPI transfer is a transamidation reaction that
involves formation of an activated carbonyl intermediate (enzyme-substrate
complex) with the ethanolamine moiety of the pre-assembled GPI unit serving as
a nucleophile. Hydrazine and hydroxylamine are well known nucleophilic
acceptors in transpeptidase (Tate and
Meister, 1974a
; Tate and
Meister, 1974b
) and transamidase
(Buchanan, 1973
) reactions.
They have also been shown to serve as alternative substrates for GPI using
engineered protein miniplacental alkaline phosphatase (promini-PLAP) and rough
microsomal membranes of HeLa cells
(Maxwell et al., 1995b
;
Ramalingam et al., 1996
).
According to the suggested mechanism for the GPI anchor exchange, the carbonyl
group of the so-called
amino acid of promini-PLAP
(Udenfriend and Kodukula,
1995
) or pro-VSG (Sharma et
al., 1999
) is activated by a sulfhydryl group within the active
center of the transamidase, resulting in formation of an enzyme-substrate
complex and cleavage of the amide bond between
and
+ 1. Thus a
nucleophilic attack of H2N-X will result in formation of
protein-NH-X and regeneration of the active site sulfhydryl residue. In our
case, use of hydrazine or hydrazine-biotin should lead to the formation of
VSG-NH-NH2 or VSG-NH-NH-biotin, which both should not be detected
by anti-CRD antibodies, owing to the lack of GPI anchor (see
Table 1). To discover whether
other nucleophiles could compete with the GPI anchor in vivo, trypanosomes
were cultivated in the presence of 10 mM hydrazine or 10 mM hydrazine-biotin
for 4 hours. After SDS-PAGE and western blotting, the same blot was
subsequently analysed using anti-MITat 1.2 antibodies, anti-CRD antibodies and
streptavidin-HRP (Fig. 8). If
trypanosomes were cultivated in the absence of hydrazine or hydrazine-biotin,
non-glycosylated VSG was readily labeled with anti-CRD antibodies, whereas VSG
produced in the presence of hydrazine or hydrazine-biotin was not
(Fig. 8). Our data show that
hydrazine and hydrazine-biotin could enter the cells, function as nucleophiles
in the transamidation reaction and form hydrazine derivatives of VSG. All of
these results are consistent with the putative anchor exchange mechanism, as
mentioned above.
Immunofluorescence of hydrazine-treated trypanosomes
In earlier experiments, hydrazine was used at a concentration of 10 mM
(Chen et al., 1996
;
Sharma et al., 1999
). However,
since trypanosomes treated with 10 mM hydrazine survived for only 5 to 6 hours
under cultivation conditions, the following experiments have been performed in
the presence of 0.5 mM hydrazine, which parasites survived in for at least 44
hours. In trypanosomes, the intracellular transport and export of VSG is
critically dependent on the presence of the GPI anchor
(Bangs et al., 1996
;
Bangs et al., 1997
). In
addition, McDowell et al. have also investigated the role of the GPI anchor in
forward secretory trafficking using African trypanosomes
(McDowell et al., 1998
). Here
soluble GPI-minus forms of VSG, in which the C-terminal peptide was deleted,
were transported with a five-fold reduction in their kinetics, and
immunofluorescent localization studies have indicated that the GPI-minus VSG
accumulates within the ER. To determine the location of VSG-hydrazine, we
performed immunofluorescence assays on cultivated bloodstream forms. After
cultivation for 44 hours in the presence of 0.5 mM hydrazine, cells were fixed
with formaldehyde and stained with clone-specific antibodies (anti-MITat 1.2
antibodies); counterstaining was performed using bisbenzimide to stain the
nucleus and the kinetoplast. As shown in
Fig. 9, VSG was equally
distributed on the cell surface, whereas vesicles within the cells could not
be detected in the absence of hydrazine (panel a). In contrast, in
hydrazine-treated cells (panel b) intensively stained vesicles were observed
between the nucleus and kinetoplast, whereas cell surface staining was
relatively minor. This result is readily explained by the assumption that,
consistent with the results obtained by western blotting, hydrazine served as
a substitute for GPI, leading to VSG-hydrazine. Obviously, this VSG-hydrazine
accumulated within cellular compartments, which stained much brighter than the
cell surface, although the surface coat was still intact as judged by electron
microscopy (data not shown).
|
| Discussion |
|---|
|
|
|---|
In some cases, the GPI anchor acts as a signal to target proteins to the
apical site of the plasma membrane
(Lisanti et al., 1989
;
Lisanti et al., 1990
); but it
may also function in the export of proteins from the ER. Normally, VSG is
transported along the classical intracellular route for glycoproteins and is
delivered to the flagellar pocket, where it is integrated into the surface
coat (Duszenko et al., 1988
).
Disruption of GPI attachment, either in cell lines deficient in formation of
the GPI precursor or in cell lines mutated in the C-terminal signal sequence,
show retention of otherwise GPI-anchored proteins within the ER (Moran et al.,
1992; Field et al., 1994
).
McDowell et al. have investigated the transport of VSG minus GPI (McDowell,
1998). Their studies indicate that GPI-minus VSG accumulates within the ER.
This delayed forward transport is not caused by a failure to fold or assemble
in the absence of the GPI anchor. Instead, the GPI structure seems to act in a
positive manner to mediate efficient forward transport of some, and perhaps
all, GPI-anchored proteins in the early secretory pathway of trypanosomes
(McDowell et al., 1998
).
Therefore, in our experiments, if the GPI anchor was replaced by a small
nucleophile, similar results were expected. Immunolocalization of VSG showed,
however, that VSG-hydrazine accumulates in several extensively stained
vesicular structures exclusively located between the nucleus and kinetoplast
and do not stay in the tubular structures of ER as suggested from experiments
using VSG minus GPI (McDowell et al.,
1998
). However, VSG minus GPI was synthesized as VSG minus the
C-terminus within the ER and not further transported. In our experiments, VSG
was synthesized as pro-VSG in the ER containing the hydrophobic C-terminal
peptide as a possible membrane anchor before hydrazine was added instead of
GPI. Obviously, transport of hydrazine-VSG is different from transport of
mature GPI-VSG or VSG minus GPI.
In our experiments, Ac-S-V-L-N-AMC was cleaved in trypanosomal lysates,
leading to the release of the fluorogenic AMC residue. About 30 families of
peptidases are dependent on a cysteine residue at the active center
(Rawlings and Barrett, 1994
).
Most protozoa produce cysteine endopeptidases during at least one stage of
their life cycle. Most of them are members of the papain superfamily. These
are predominantly lysosomal enzymes, which do not show substrate specificity
for asparaginyl residues but have a preference for bulky hydrophobic residues
at the P1 position such as valine and phenylalanine
(Harris et al., 2000
). In
trypanosomal lysates the enzyme reaction was optimal at pH 5.5, the pH optimum
of the transamidase reaction, and was activated by 10 mM hydrazine, a well
known nucleophilic acceptor in transamidase and transpeptidase reactions
(Tate and Meister, 1974a
;
Tate and Meister, 1974b
).
Cleavage activity was completely inhibited by 1 mM pCMPSA, a sulfhydryl
alkylating reagent and increased by addition of recombinant TbGpi8.
Although we cannot completely rule out the possibility that other proteases
led to the observed cleavage of Ac-S-V-L-N-AMC in trypanosomal lysates, we
suppose that this reaction is performed by the trypanosomal transamidase,
which has a high homology to other known Gpi8 proteins and C13 cysteine
peptidases such as legumain (Chen et al.,
1997
).
To gain a better understanding of the properties of TbGpi8, the
respective cDNA was cloned, and the protein was heterologously expressed and
characterized. As compared with Gpi8 genes from other species,
TbGpi8 shows a high sequence and size homology to LmGpi8. In
addition, sequence and hydrophobicity analysis indicated a conventional
N-terminal signal sequence for ER translocation and a possible N-glycosylation
site on N25, which is close to the most probable cleavage site for the signal
peptidase (von Heijne,
1986
).
Like LmGpi8, TbGpi8 lacks a C-terminal hydrophobic
domain, which was found in yeast and human Gpi8 and may serve as a
transmembrane helix (Benghezal et al.,
1996
). However, this transmembrane domain seems not to be
necessary for protein function, since a Gpi8 mutant from man, which lacks the
transmembrane domain, retained its activity to complement class K mutant cells
(Ohishi et al., 2000
). Hilley
et al. suggested that attachment of L. mexicana Gpi8 to the ER
membrane may require one or more integral membrane proteins to be part of the
transamidase complex (Hilley et al.,
2000
). A possible candidate is Gaa1. The exact role of this
protein was not elucidated yet, but it had been demonstrated that Gaa1 and
Gpi8 form a protein complex (Ohishi et
al., 2000
). In human and yeast cells, Gaa1 is a luminal oriented
ER glycoprotein containing several transmembrane domains
(Hamburger et al., 1995
). As
shown by Ohishi et al., GAA1 knockout cells were defective in the
formation of carbonyl intermediates between precursor proteins and the
transamidase (Ohishi et al.,
2000
). Using the BLAST program and TIGR-Database we have also
found a TbGAA1 gene that shows a high homology with hGAA1
and ScGAA1 and contains several possible transmembrane domains (data
not shown). This protein is not yet cloned and needs to be further
characterized.
As judged from our experiments, cellular localization using specific
antibodies shows that TbGpi8 is mainly localized within the ER
compartment. This was expected, because GPI addition is a quasi
co-translational process occurring immediately after VSG translation
(Bangs et al., 1985
;
Ferguson et al., 1986
).
Although TbGpi8 contains no ER retrieval motif (KDEL or KKXX), it
seems likely that Gpi8 forms an active enzyme complex with Gaa1 and is thus
kept within the ER and cis-Golgi complex
(Lotti et al., 1999
).
Interestingly, intracellular staining of TbGpi8 with specific
antibodies was much brighter after cells had been exposed to hydrazine. This
observation indicates that TbGpi8 is induced by increasing amounts of
preformed GPI precursor or of non-GPI anchored VSG.
Gpi8 shares significant homology with a family of previously characterized
asparaginyl endopeptidases known as legumains
(Benghezal et al., 1996
;
Ishii, 1994
). These enzymes
have been categorized as the C13 family of cysteine peptidases, which also
contains the GPI linked protein transamidase
(Riezman and Conzelmann,
1998
). It seems likely that the trypanosomal transamidase contains
the classical catalytic dyad residues cysteine and histidine, which mediate
its activity. It has been shown that GPI linked protein transamidase activity
is susceptible to sulfydryl alkylating agents, implying that the protein has
an essential cysteine (Sharma et al.,
1999
). Our study of TbGpi8 in trypanosomal lysates also
showed an efficient inhibition of the transamidase activity by pCMPSA. Using
TbGpi8 numbering, two cysteines (C76 and C192) and two histidines
(H45 and H150) are conserved among trypanosomal, leishmanial, yeast and human
Gpi8. Both histidine residues are also conserved in legumains, whereas only
one of the cysteine residues is conserved across all C13 family members (C192,
TbGpi8 numbering). This residue is thus the prime candidate for the
active site cysteine. Meyer et al. proved that C199 and H157 in
ScGpi8 are the active site residues
(Meyer et al., 2000
). In
TbGpi8, it is most likely that the two corresponding residues, C192
and H150, constitute the active site. The detected enzyme activity of the
recombinant TbGpi8 suggests that the enzyme is in its mature form,
despite its different apparent molecular mass.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Abe, Y., Shirane, K., Yokosawa, H., Matsushita, H., Mitta, M.,
Kato, I. and Ishii, S. (1993). Asparaginyl endopeptidase of
jack bean seeds. Purification, characterization and high utility in protein
sequence analysis. J. Biol. Chem.
268,3525
-3529.
Altschul, S. F., Madden, T. L., Schaffer, A. A., Zhang, J.,
Zhang, Z., Miller, W. and Lipman, D. J. (1997). Gapped BLAST
and PSI-BLAST: a new generation of protein database search programs.
Nucleic Acids Res. 25,3389
-3402.
Bangs, J. D., Hereld, D., Krakow, J. L., Hart, G. W. and
Englund, P. T. (1985). Rapid processing of the carboxy
terminus of a trypanosome variant surface glycoprotein. Proc. Natl.
Acad. Sci. USA 82,3207
-3211.
Bangs, J. D., Brouch, E. M., Ransom, D. M. and Roggy, J. L.
(1996). A soluble secretory reporter system in Trypanosoma
brucei. Studies on endoplasmic reticulum targeting. J. Biol.
Chem. 271,18387
-18393.
Bangs, J. D., Ransom, D. M., McDowell, M. A. and Brouch, E. M. (1997). Expression of bloodstream variant surface glycoproteins in procyclic stage Trypanosoma brucei: role of GPI anchors in secretion. EMBO J. 16,4285 -4294.[Medline]
Benghezal, M., Lipke, P. N. and Conzelmann, A.
(1995). Identification of six complementation classes involved in
the biosynthesis of glycosylphosphatidylinositol anchors in Saccharomyces
cerevisiae. J. Cell Biol.
130,1333
-1344.
Benghezal, M., Benachour, A., Rusconi, S., Aebi, M. and Conzelmann, A. (1996). Yeast Gpi8p is essential for GPI anchor attachment onto proteins. EMBO J. 15,6575 -6583.[Medline]
Buchanan, J. M. (1973). The aminotransferases. Adv. Enzymol. Relat. Areas. Mol. Biol. 39, 91-183.[Medline]
Chen, R., Udenfriend, S., Prince, G. M., Maxwell, S. E.,
Ramalingam, S., Gerber, L. D., Knez, J. and Medof, M. E.
(1996). A defect in glycosylphosphatidylinositol (GPI)
transamidase activity in mutant K cells is responsible for their inability to
display GPI surface proteins. Proc. Natl. Acad. Sci.
USA 93,2280
-2284.
Chen, J. M., Dando, P. M., Rawlings, N. D., Brown, M. A., Young,
N. E., Stevens, R. A., Hewitt, E., Watts, C. and Barrett, A. J.
(1997). Cloning, isolation, and characterization of mammalian
legumain, an asparaginyl endopeptidase. J. Biol. Chem.
272,8090
-8098.
Cross, G. A. M. (1990). Glycolipid anchoring of plasma membrane proteins. Annu. Rev. Cell Biol. 6, 1-39.
Cross, G. A., Wirtz, L. E. and Navarro, M. (1998). Regulation of VSG expression site transcription and switching in Trypanosoma brucei. Mol. Biochem. Parasitol. 91,77 -91.[Medline]
Duszenko, M., Ivanov, I. E., Ferguson, M. A. J., Plesken, H. and
Cross, G. A. M. (1988). Intracellular transport of a variant
surface glycoprotein in Trypanosoma brucei. J. Cell
Biol. 106,77
-86.
Duszenko, M., Mühlstädt, K. and Broder, A. (1992). Cysteine is an essential growth factor for Trypanosoma brucei bloodstream forms. Mol. Biochem. Parasitol. 50,269 -274.[Medline]
Ferguson, M. A. J., Duszenko, M., Lamont, G. S., Overath, P. and Cross, G. A. M. (1986). Biosynthesis of Trypanosoma brucei variant surface glycoproteins: N-glycosylation and addition of a phosphatidylinositol membrane anchor. J. Biol. Chem. 26,356 -362.
Field, M. C., Moran, P., Li, W., Keller, G. A. and Caras, I.
W. (1994). Retention and degradation of proteins containing
an uncleaved glycosylphosphatidylinositol signal. J. Biol.
Chem. 269,10830
-10837.
Fraering, P., Imhof, I., Meyer, U., Strub, J. M., van
Dorsselaer, A., Vionnet, C. and Conzelmann, A. (2001). The
GPI transamidase complex of Saccharomyces cerevisiae contains Gaa1p,
Gpi8p, and Gpi16p. Mol. Biol. Cell
12,3295
-3306.
Gassmann, M., Thömmes, P., Weiser, T. and Hübscher, U. (1990). Efficient production of chicken egg yolk antibodies against a conserved mammalian protein. FASEB J. 4,2528 -2532.[Abstract]
Hamburger, D., Egerton, M. and Riezman, H.
(1995). Yeast Gaa1p is required for attachment of a completed GPI
anchor onto proteins. J. Cell Biol.
129,629
-639.
Harris, J. L., Backes, B. J., Leonetti, F., Mahrus, S., Ellman,
J. A. and Craik, C. S. (2000). Rapid and general profiling of
protease specificity by using combinatorial fluorogenic substrate libraries.
Proc. Natl. Acad. Sci. USA
97,7754
-7759.
Hilley, J. D., Zawadzki, J. L., McConville, M. J., Coombs, G. H.
and Mottram, J. C. (2000). Leishmania mexicana
mutants lacking glycosylphosphatidylinositol (GPI):protein transamidase
provide insights into the biosynthesis and functions of GPI-anchored proteins.
Mol. Biol. Cell. 11,1183
-1195.
Ishii, S. (1994). Legumain: asparaginyl endopeptidase. Methods Enzymol. 244,604 -615.[Medline]
Laemmli, U. K. (1970). Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227,680 -685.[Medline]
Lisanti, M. P., Caras, I. W., Davitz, M. A. and
Rodriguez-Boulan, E. (1989). A glycophospholipid membrane
anchor acts as an apical targeting signal in polarized epithelial cells.
J. Cell. Biol. 109,2145
-2156.
Lisanti, M. P., Caras, I. W., Gilbert, T., Hanzel, D. and
Rodriguez-Boulan, E. (1990). Vectorial apical delivery and
slow endocytosis of a glycolipid-anchored fusion protein in transfected MDCK
cells. Proc. Natl. Acad. Sci. USA
87,7419
-7423.
Lotti, L. V., Mottola, G., Torrisi, M. R. and Bonatti, S.
(1999). A different intracellular distribution of a single
reporter protein is determined at steady state by KKXX or KDEL retrieval
signals. J. Biol. Chem.
274,10413
-10420.
Maxwell, S. E., Ramalingam, S., Gerber, L. D. and Udenfriend,
S. (1995a). Cleavage without anchor addition accompanies the
processing of a nascent protein to its glycosylphosphatidylinositol-anchored
form. Proc. Natl. Acad. Sci. USA
92,1550
-1554.
Maxwell, S. E., Ramalingam, S., Gerber, L. D., Brink, L. and
Udenfriend, S. (1995b). An active carbonyl formed during
glycosylphsophatidylinositol addition to a protein is evidence of catalysis by
a transamidase. J. Biol. Chem.
270,19576
-19582.
Mayor, S., Menon, A. K. and Cross, G. A.
(1991). Transfer of glycosylphosphatidylinositol membrane anchors
to polypeptide acceptors in a cell-free system. J. Cell
Biol. 114,61
-67.
McDowell, M. A., Ransom, D. M. and Bangs, J. D. (1998). Glycosylphosphatidyl-inositol-dependent secretory transport in Trypanosoma brucei. Biochem. J. 335,681 -689.
Meyer, U., Benghezal, M., Imhof, I. and Conzelmann, A. (2000). Active site determination of Gpi8p, a caspase-related enzyme required for glycosylphosphatidylinositol anchor addition to proteins. Biochemistry 39,3461 -3471.[Medline]
Mohney, R. P., Knez, J. J., Ravi, L., Sevlever, D., Rosenberry,
T. L., Hirose, S. and Medof, M. E. (1994). Glycoinositol
phospholipid anchor-defective K562 mutants with biochemical lesions distinct
from those in Thy-1-murine lymphoma mutants. J. Biol.
Chem. 269,6536
-6542.
Moran, P. and Caras, I. W. (1992). Proteins
containing an uncleaved signal for glycophosphatidylinositol membrane anchor
attachment are retained in a post-ER compartment. J. Cell
Biol. 119,763
-772.
Ohishi, K., Inoue, N., Maeda, Y., Takeda, J., Riezman, H. and
Kinoshita, T. (2000). Gaa1p and Gpi8p are components of a
glycosylphosphatidylinositol (GPI) transamidase that mediates attachment of
GPI to proteins. Mol. Biol. Cell.
11,1523
-1533.
Ohishi, K., Inoue, N. and Kinoshita, T. (2001). PIG-S and PIG-T, essential for GPI anchor attachment to proteins, form a complex with GAA1 and GPI8. EMBO J. 20,4088 -4098.[Medline]
Polson, A., Wechmar, A. and van Regenmortel, M. H. V. (1980). Isolation of viral IgY antibodies from egg yolk of immunizised hens. Immun. Commun. 2, 475-493.
Ramalingam, S., Maxwell, S. E., Medof, M. E., Chen, R., Gerber,
L. D. and Udenfriend, S. (1996). COOH-terminal processing of
nascent polypeptides by the glycosylphosphatidylinositol transamidase in the
presence of hydrazine is governed by the same parameters as
glycosylphosphatidylinositol addition. Proc. Natl. Acad. Sci.
USA 93,7528
-7533.
Rawlings, N. D. and Barrett, A. J. (1994). Families of cysteine peptidases. Methods Enzymol. 244,461 -486.[Medline]
Riezman, H. and Conzelmann, A. (1998). Glycosylphosphatidylinositol:protein transamidase. In Handbook of Proteolytic Enzymes (eds A. J. Barrett, N. D. Rawlings and J. F. Woessner), pp. 756-759. London: Academic Press.
Sharma, D. K., Vidugiriene, J., Bangs, J. D. and Menon, A.
K. (1999). A cell-free assay for glycosylphosphatidylinositol
anchoring in African trypanosomes. Demonstration of a transamidation reaction
mechanism. J. Biol. Chem.
274,16479
-16486.
Sharma, D. K., Hilley, J. D., Bangs, J. D., Coombs, G. H., Mottram, J. C. and Menon, A. K. (2000). Soluble GPI8 restores glycosylphosphatidylinositol anchoring in a trypanosome cell-free system depleted of lumenal endoplasmic reticulum proteins. Biochem. J. 351,717 -722.
Tate, S. S. and Meister, A. (1974a).
Interaction of gamma-glutamyl transpeptidase with amino acids, dipeptides, and
derivatives and analogs of glutathione. J. Biol. Chem.
249,7593
-7602.
Tate, S. S. and Meister, A. (1974b).
Stimulation of the hydrolytic activity and decrease of the transpeptidase
activity of gamma-glutamyl transpeptidase by maleate; identity of a rat kidney
maleate-stimulated glutaminase and gamma-glutamyl transpeptidase.
Proc. Natl. Acad. Sci. USA
71,3329
-3333.
Udenfriend, S. and Kodukula, K. (1995). How glycosylphosphatidylinositol-anchored membrane proteins are made. Annu. Rev. Biochem. 64,563 -591.[Medline]
Vidugiriene J, Vainauskas, S., Johnson, A. E. and Menon, A. K. (2001). Endoplasmic reticulum proteins involved in glycosylphosphatidylinositol-anchor attachment: photocrosslinking studies in a cell-free system. Eur. J. Biochem. 268,2290 -2300.[Medline]
von Heijne, G. (1986). A new method for
predicting signal sequence cleavage sites. Nucleic Acids
Res. 14,4683
-4690.
Yu, J., Nagarajan, S., Knez, J. J., Udenfriend, S., Chen, R. and
Medof, M. E. (1997). The affected gene underlying the class K
glycosylphosphatidylinositol (GPI) surface protein defect codes for the GPI
transamidase. Proc. Natl. Acad. Sci. USA
94,12580
-12585.
Zamze, S. E., Ferguson, M. A. J., Collins, R., Dwek, R. A. and Rademacher, T. W. (1988). Characterization of the cross-reacting determinant (CRD) of the glycosyl-phosphatidylinositol membrane anchor of Trypanosoma brucei variant surface glycoprotein. Eur. J. Biochem. 176,527 -534.[Medline]
Zimmerman, M., Ashe, B., Yurewicz, E. C. and Patel, G. (1977). Sensitive assays for trypsin, elastase, and chymotrypsin using new fluorogenic substrates. Anal. Biochem. 78, 47-51.[Medline]
This article has been cited by other articles:
![]() |
P. Orlean and A. K. Menon Thematic review series: Lipid Posttranslational Modifications. GPI anchoring of protein in yeast and mammalian cells, or: how we learned to stop worrying and love glycophospholipids J. Lipid Res., May 1, 2007; 48(5): 993 - 1011. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Zheng, R. K. Tweten, and K. Mensa-Wilmot Intracellular Glycosylphosphatidylinositols Accumulate on Endosomes: Toxicity of Alpha-Toxin to Leishmania major Eukaryot. Cell, March 1, 2005; 4(3): 556 - 566. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Nagamune, K. Ohishi, H. Ashida, Y. Hong, J. Hino, K. Kangawa, N. Inoue, Y. Maeda, and T. Kinoshita GPI transamidase of Trypanosoma brucei has two previously uncharacterized (trypanosomatid transamidase 1 and 2) and three common subunits PNAS, September 16, 2003; 100(19): 10682 - 10687. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Hong, K. Ohishi, J. Y. Kang, S. Tanaka, N. Inoue, J.-i. Nishimura, Y. Maeda, and T. Kinoshita Human PIG-U and Yeast Cdc91p Are the Fifth Subunit of GPI Transamidase That Attaches GPI-Anchors to Proteins Mol. Biol. Cell, May 1, 2003; 14(5): 1780 - 1789. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Ohishi, K. Nagamune, Y. Maeda, and T. Kinoshita Two Subunits of Glycosylphosphatidylinositol Transamidase, GPI8 and PIG-T, Form a Functionally Important Intermolecular Disulfide Bridge J. Biol. Chem., April 11, 2003; 278(16): 13959 - 13967. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||