|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
Research Article |
1 Department of Vascular Biology, The Hope Heart Institute, Seattle, WA
98104-2046, USA
2 Departments of Biological Structure and Ophthalmology, University of
Washington, Seattle, WA, USA
* Author for correspondence (e-mail: hsage{at}hopeheart.org )
Accepted 23 April 2002
| Summary |
|---|
|
|
|---|
Key words: SPARC, Lens capsule, Basement membrane, Extracellular matrix, Epithelial cells, Fiber cells, Collagen IV, Cataract, Permeability
| Introduction |
|---|
|
|
|---|
SPARC, which is also termed osteonectin or BM-40, belongs to the
matricellular class of secreted glycoproteins (thrombospondins 1 and 2,
osteopontin, tenascins C and X) that function as modulators of cell-cell and
cell-matrix interactions. SPARC mediates these interactions by (1) binding to
extracellular matrix (ECM) proteins, (2) regulating ECM and growth factor
production/efficacy and/or 3) modulating matrix metalloproteinase expression
(Lane and Sage, 1994
;
Tremble et al., 1993
;
Yan and Sage, 1999
;
Sage, 1997
). Both
counteradhesive and antiproliferative properties in vitro have been attributed
to SPARC, which induces rounding of cultured cells and disassembly of focal
adhesions (Lane and Sage,
1990
; Murphy-Ullrich et al.,
1995
). SPARC participates in morphogenesis, tissue repair and
differentiation by virtue of its regulation of cell cycle, cell shape change,
migration, adhesion and ECM production
(Lane and Sage, 1994
;
Yan and Sage, 1999
).
Therefore, SPARC does not appear to serve a structural role in the ECM but is
a functional modulator of various activities attributed to
protein/proteoglycan networks (Sage and
Bornstein, 1991
; Bornstein,
1995
). Despite its expression as a consequence of development or
injury-related remodeling (Brekken and
Sage, 2001
), the production of SPARC in normal adult tissues is
rather limited. Interestingly, SPARC is expressed in lenticular epithelium in
both developing and adult mammals (Yan et
al., 1998
; Yan et al.,
2000
). The phenotype of early cataract formation in SPARC-null
mice indicates that SPARC participates significantly in the function and
homeostasis of the normal lens.
The lens is a cellular structure without blood vessels, lymphatics and
nerves. It is enclosed by an avascular thick capsule and is nourished by
diffusion from the aqueous humor through the lens capsule and epithelium. The
capsule, also called the lens basement membrane (BM), is a substantial,
acellular and structurally complex ECM, consisting of an orderly meshwork of
various glycoproteins and proteoglycans (for example, collagen type IV,
laminin, perlecan, nidogen, and fibronectin)
(Timpl and Dziadek, 1986
;
Bosman et al., 1989
;
Cammarata et al., 1986
). BM
produced by different cells has been correlated with functions such as
proliferation, differentiation, adhesion and permeability
(Yurchenco and Schittny,
1990
). Thus, the composition of the ECM can be expected to be of
particular importance for the maintenance of normal morphological and
functional properties of the lens. Other important functions of the lens
capsule that are dependent upon the organization of its constituent proteins
and proteoglycans are filtration and permeability
(Fisher, 1977
;
Lee et al., 1997
;
Winkler et al., 2001
). The
capsular ECM of the lens is not a static structure; rather, it is continually
produced and remodeled anteriorly by the lens epithelial cells and posteriorly
by newly differentiated fiber cells
(Johnson and Beebe, 1984
).
SPARC regulates the production of certain ECM proteins, in addition to its
interaction with collagens (Sasaki et al.,
1998
; Sage et al.,
1989
; Mayer et al.,
1991
; Maurer et al.,
1995
) and growth factors
(Raines et al., 1992
;
Kupprion et al., 1998
). In
this study we have asked whether SPARC plays a significant role in the
organization and deposition of ECM proteins in the lens capsule and in its
structural integrity.
This report demonstrates alterations in the structure of the lens capsule, increased dye or radioactive tracer penetration through the capsule and swelling of the lens fiber cells in lenses from mice with a targeted disruption of the SPARC gene. The absence of SPARC disturbed the normal relationship between the capsular ECM and the underlying cells. We propose that damaged capsular integrity contributes significantly to cataractogenesis in SPARC-null mice and that cell-matrix interactions that are sensitive to the presence (or diminution) of SPARC are a major component of cataractogenesis. The SPARC-null mouse appears to be an opportune model for understanding the role of SPARC in the modulation of ECM organization and function.
| Materials and Methods |
|---|
|
|
|---|
Slit lamp examination
Lenses of both wt and mutant mice were examined and photographed by
slit-lamp photomicroscopy (Nikon FS-2). The pupils of unanesthetized mice were
dilated with 0.1% Mydriacyl tropicanide ophthalmic solution and 10%
phenylephrine hydrochloride ophthalmic solution (1:1 by volume). Slit views
were taken at a 30° angle to the optic axis with a Nikon electronic flash
power supply at a maximum setting.
BrdU delivery, histology, immunohistochemistry and EM
Pregnant mice were given 100 µg BrdU (5-bromo-2'-deoxyuridine;
Sigma, St Louis, MO) suspended in phosphate-buffered saline (PBS) by
intraperitoneal injection. One hour after the injection, embryonic eyes were
collected. Postnatal mice younger than 2 months of age and weighing less than
20 g were injected with 500 µg BrdU. The eyeballs were collected 2 hours
after injection. For mice older than 2 months and weighing more than 20 g,
BrdU was loaded into an osmotic minipump (Alza, Palo Alto, CA) implanted under
the skin behind the interscapular space. BrdU was delivered at a rate of 2
µg/g body weight per hour for 1 week to ensure an identical amount infused
per unit of body weight (Li et al.,
1997
). The collected eyeballs were fixed immediately in 10%
neutral buffered formalin (0.1 M sodium phosphate, pH 7.4), dehydrated through
a series of ethanol concentrations and embedded in paraffin. Serial 5 µm
thick paraffin sections were cut medially and through the optic nerve head.
Immunostaining with anti-BrdU antibody was performed as described previously
(Li et al., 1997
).
BrdU incorporation into lens epithelium was assessed by microscopy. Nine sections of each lens per animal were analyzed, and an average value was determined. Three to six animals were studied for each time point. All counts were performed without knowing the identity of the animals. Wild-type and transgenic mice were compared within the same age group. Significant differences were determined by Student's paired t-test for comparison of two sample means.
Lenses from embryos and postnatal mice were prepared by fixation with
methyl Carnoy's solution (60% methanol, 30% chloroform and 10% glacial acidic
acid) for 4 hours. The eyeballs were dehydrated in a solution of ethanol and
were embedded in paraffin for staining with hematoxylin and eosin and for
immunofluorescence (anti-mouse collagen IV(
1/
2) IgG,
Collaborative Biomedical Research, Bedford, MA). For reaction with the
anti-MIP26 antibody, the eyeballs were fixed with 4% paraformaldehyde for 20
minutes, washed with PBS and soaked for 4 hours in 30% sucrose in PBS. Frozen
sections were processed and exposed to anti-MIP (major intrinsic protein) IgG,
followed by a secondary antibody conjugated with fluorescein isothiocyanate.
For electron microscopy (EM), lenses were fixed in 2.5% glutaradehyde in 0.1M
sodium cacodylate buffer and were processed and photographed as described
(Wight et al., 1997
;
Norose et al., 2000
).
Detection of lens proteins and mRNA
Before sodium dodecyl sulfate-polyacrylamide gel electrophoresis
(SDS-PAGE), each lens nucleus was separated from the cortex. The cortex was
extracted with 0.1 M NaCl. The supernatant produced represents the total
cortical water-soluble proteins. The insoluble pellet was extracted further
with 8 M urea; this supernatant represents the urea-soluble proteins in the
cortex, and the final insoluble pellet was termed the urea-insoluble pellet.
The same procedure was performed on the lens nucleus, with the resulting three
fractions described above. All samples were dissolved in sample buffer (60 mM
Tris [pH6.8], 2%SDS, 10% glycerol, and 0.001% bromphenol blue) containing 10
mM dithiothreitol (DTT) and were boiled for 5 minutes. 4-20% precast
polyacrylamide gradient gels (Novex) were used for SDS-PAGE, and proteins were
stained with Coomassie Brilliant blue.
For immunoblotting, lenses were homogenized in 0.1M NaCl, 0.1 M
Na2HPO4 (pH 7.4). Soluble and insoluble fractions were
collected and dissolved in sample buffer with 10 mM DTT prior to SDS-PAGE and
subsequent transfer (Yan et al.,
2000
).
Total RNA was isolated from lens fiber cells of wt and SPARC-null mice with an RNeasy Mini Kit (Qiagen, Valencia, CA) according to the manufacturer's instructions. Lens fiber cells were homogenized in TRI reagent (Molecular Research Center, Inc., Cincinnati, OH) and were washed initially with chloroform and isopropanol to remove fiber proteins. The quality and yield of recovered RNA were evaluated by absorption at 260 and 280 nm. Total RNA was reverse-transcribed into cDNA by the use of an Omniscript RT kit (Qiagen). MIP cDNA was amplified using the primer pair: GCCTGGCCTTGGCTACATTGGT/TGGCCTTGGCTACATTGGT.
Lens capsular permeability assay and measurement of water
content
Whole lenses with intact capsules were removed from freshly enucleated eyes
under a dissecting microscopy. Lenses from wt and SPARC-null mice were
incubated immediately in 0.4% trypan blue dye (Sigma), 1 µCi/ml
[methyl-3H]-thymidine (1 mCi/ml; New England Nuclear, Boston, MA)
or a 1: 2000 dilution of 1 mCi/g 3H2O (1 mCi/g; New
England Nuclear, Boston, MA) for 20 minutes at room temperature. The lenses
were subsequently rinsed briefly in PBS. The lens capsules were removed
immediately. The decapsulized lenses and isolated capsules were homogenized
separately (1 lens capsule/100 µl PBS; 1 decapsulized lens/100 µl PBS in
a 1.5 ml tube). The [3H]-thymidine or 3H2O
that penetrated into the lens capsules or lens masses was quantified by liquid
scintillation counting in 3 ml Ecolume (ICN, Irvine, CA). For quantification
of trypan blue dye, supernatants were collected after centrifugation of the
lens capsules or lens masses at 13,000 g, and the absorbance
at 497 nm was determined for samples.
| Results |
|---|
|
|
|---|
|
Cataract lens morphology in SPARC-null mice
To determine the onset of cataract formation in SPARC-null mice, we
examined lenses from SPARC+/+ and SPARC-null animals before and
after the appearance of cataracts. In E14 and E18 embryos, wt and SPARC-null
lenses were indistinguishable in size and in general morphology
(Fig. 2). The initial induction
of the lens vesicle on E11.5 was not affected (data not shown). Elongation of
the lens fiber cells appeared to proceed normally, as the cavity of the lens
vesicle was filled with postmitotic, differentiated fiber cells
(Fig. 2). The nuclei of the
lens fiber cells were located in the anterior part of the cytoplasm.
Microphthalmia was not detected during the development of SPARC-null mice. At
1 month (the beginning of cortical opacity), the SPARC-null lenses exhibited
the same size and symmetrical arrangement of lens fibers, with the lens
nucleus centrally located (Fig.
3A,B). However, under higher magnification, a few of the cortical
fiber cells of the SPARC-null lenses appeared enlarged/swollen and lost their
hexagonal shape (Fig. 3D,
arrows). Tiny vacuoles appeared in fibers at the bow region; these fiber cells
were loosely packed and exhibited an uneven distribution of cytoplasm
(Fig. 3F, arrows). By 3 months
of age, the size of wt and SPARC-null lenses remained similar
(Fig. 4A,B). However, the
SPARC-null lens nucleus was displaced posteriorly
(Fig. 4B). All the secondary
fiber cells in SPARC-null cortex were swollen, altered in size and shape and
disorganized (Fig. 4D,F,H). By
4 months, SPARC-null lens fiber cell swelling was advanced, fiber cell plasma
membranes were ruptured and vacuolated fibers appeared at the bow region
(Bassuk et al., 1999
). At 5
months, the SPARC-null posterior lens capsule had ruptured, and the nucleus
was dislocated in the posterior cavity, with a severely disorganized cortex
(data not shown) (Norose et al.,
1998
).
|
|
|
Lens epithelial cell proliferation is not a causative factor in
cataract formation
Whether or not the proliferation of lens epithelial cells is abnormal and a
causative factor in the formation of cataract in SPARC-null lenses is not
known. Lens development and growth depend on normal lens epithelial cell
proliferation and terminal differentiation into lens fibers
(Wride, 1996
). Because SPARC
is a potent inhibitor of the cell cycle in vitro, and overproliferation of
lens epithelial cells is associated with posterior subcapsular cataract, lens
cell proliferation was measured in SPARC+/+ and SPARC-null lenses.
Indirect immunocytochemical staining of BrdU-incorporated S-phase cells was
conducted in lenses from E14 to 1 year old SPARC+/+ and SPARC-null
mice. Detection of BrdU incorporated into DNA was used as an indication of
replicating cells. From E14-E18, the primary fiber cells formed normally, and
cell proliferation was restricted to the anterior lens epithelium, with
equivalent numbers of BrdU-positive cells in SPARC+/+ and
SPARC-null animals (Fig. 5A).
Inappropriate S-phase entry in lens fiber cells was not observed in SPARC-null
embryonic mice (data not shown). Posnatally, there was no significant
difference in BrdU labeling between wt and SPARC-null lens cells
(Fig. 5B,C); moreover, the
fiber cells showed no incorporation of BrdU up to 6-7 months of age. In 7.5
month-old SPARC+/+ lenses, BrdU labeling was restricted mainly to
the germinative zone of the epithelium, with a few in the transition zone, and
there were reduced numbers of positive cells in comparison with younger
SPARC+/+ lenses. However, the number of BrdU-labeled cells
increased significantly in 7.5 month-old SPARC-null lenses
(P<0.01, Fig. 5C),
largely because of fibroblast-like cell masses appearing beneath the posterior
capsule (normally, nucleated cells are not found under the posterior capsule).
The posterior capsule was thin and ruptured at this age. Ocular inflammation
was indicated by the presence of neutrophils, lymphocytes and macrophages in
the vitreous cavity (data not shown)
(Norose et al., 1998
). In 7
month to 1 year-old SPARC+/+ mice
(Fig. 5C), the extent of lens
cell proliferation decreased. In contrast, SPARC-null lenses showed increased
numbers of BrdU-labeled cells, concomitant with ocular inflammation. In
summary, these results indicate that SPARC does not exert a significant effect
on the cell cycle in the lens. Therefore, abnormal proliferation of lens
epithelial cells does not contribute causally to cataractogenesis in animals
lacking SPARC.
|
Disorganization of lens fibers in the absence of SPARC
Disorganization and swelling of lens fiber cells were the primary
morphological alterations observed in the cortex of SPARC-null lenses at 1-3
months after birth. Since severe changes in fiber cells were apparent by 3
months of age (Fig. 4), we
isolated these cells and analyzed the fiber proteins in wt and SPARC-null
lenses. Fiber cells derived from both genotypes showed almost identical
protein patterns by SDS-PAGE (Fig.
6). The water-soluble crystallin proteins (
, ß and
crystallins comprise approximately 90% of lens soluble proteins)
showed no differences in levels or in degradation by immunoblot analysis of
SPARC-null versus SPARC+/+ lenses (data not shown). The MIP-26
(aquaporin 0) is a membrane-bound protein, abundantly and specifically
expressed in lens fiber cells, that regulates the transport of water
(Benedetti et al., 1974
;
Shiels and Bassnett, 1996
). At
either the mRNA or protein level, there were minimal differences between
SPARC+/+ and SPARC-null fiber cells with respect to expression of
MIP26 (Fig. 7A,B). However,
immunostaining for MIP26, which outlines the fiber cell membrane, revealed a
striking disorganization of cortical fiber cells in SPARC-null relative to
SPARC+/+ lenses, which could result from swelling
(Fig. 7C,D).
|
|
Since the secondary lens fiber cells were swollen by 2-3 months of age, and there was apparently no degradation or alteration of their major proteins, we began to suspect that the filtration barrier of the capsule and underlying cells for maintaining normal homeostasis might be compromised in the SPARC-null lens. Such a functional alteration could lead to an imbalance of water and ions in the lens and might result in swollen fibers as observed in Figs 3 and 4.
Compromised BM in SPARC-null lens
By light microscopy, the lens capsule showed minimal abnormalities within 3
months (Figs 3 and
4). Moreover, EM showed a
smooth interface between the lens capsule and the underlying cells in
SPARC+/+ lenses at 1 and 3 months of age
(Fig. 8A,C, arrows). However,
by 1 month of age, SPARC-null lens fibers immediately posterior to the equator
exhibited a few finger-like protrusions into the lens capsule
(Fig. 8B, arrows). These
protrusions appeared progressive, in that numerous large extensions penetrated
deeply into the lens capsule at 3 months of age
(Fig. 8D, arrows). These
observations are in agreement with a previous EM study
(Norose et al., 2000
). The
extensions of the cell membrane into the anterior capsule were not as obvious
as those into the posterior capsule in the lenses of 1 month-old SPARC-null
mice (data not shown).
|
Collagen type IV is a major structural component of the lens capsule
(Fitch et al., 1983
;
Cammarata et al., 1986
).
Immunohistochemical staining of collagen IV revealed a similar distribution of
this ubiquitous BM protein in SPARC+/+ and SPARC-null anterior lens
capsules of 1 month-old mice (Fig.
9A,C), However, SPARC-null lens capsules posterior to the bow
region were abnormal (Fig. 9D,
arrows). At 3 months, SPARC-null anterior lens capsules exhibited a more
mottled appearance, and small, fine protrusions could be observed by light
microscopy (Fig. 9G, arrows).
The posterior lens capsule was characterized by numerous clefts, which
penetrated deeply into the lens capsule and might be predicted to disrupt the
permeability of the capsule (Fig.
9H, arrows).
|
Increased penetration of dye and radioactive tracer in SPARC-null
lens
Trypan blue dye (906 Da) and [3H]-thymidine (242 Da) were chosen
as tracers to evaluate the penetration of small molecules through the lens
capsules of wt and SPARC-null lenses. In lenses from mice of 1-3 month of age,
the possibility of incorporation of [3H]-thymidine into lens
epithelial cell DNA is highly unlikely during the 20 minute assay [there was
no labeling of lens epithelial cells of 1-month-old mice after 1 half hour
BrdU delivery; (Q.Y., unpublished)]. In
Fig. 10 the difference in dye
and [3H]-thymidine penetration between wt and SPARC-null lenses is
obvious. The dye content measured in SPARC-null decapsulized lenses
(1-month-old) was 1.38 times the value of the SPARC+/+ lenses. The
[3H]-thymidine CPM in SPARC-null decapsulized lenses were 1.3 times
(1-month-old) and 3.4 times (3 month-old) the values of the corresponding +/+
lenses. 3H2O was also evaluated for its penetration into
the lenses. After 20 minutes, the CPM in capsules of wt and SPARC-null mice (1
and 3 months of age) were minimal, with no difference (data not shown).
However, there were significant differences in decapsulized lenses: the CPM in
the SPARC-null lenses were 1.6 times (1-month-old) and 2.5 times (3-month-old)
the values of the corresponding +/+ lenses (data not shown). The
conclusions are that (1) SPARC-null lens capsules exhibited increased levels
of dye or [3H]-thymidine, but not 3H2O, (2)
SPARC-null lens capsules and underlying cells allowed more dye,
[3H]-thymidine or 3H2O to penetrate into the
lens mass and (3) the amount of 3H2O or
[3H]-thymidine that penetrated into the lenses was substantially
greater in 3-month-old mice than in 1-month-old mice. The normal lens capsule
is permeable to water and small macromolecules
(Newell, 1996
). Trypan blue
dye and [3H]-thymidine can diffuse through the capsule and enter
the lens mass (Fig. 10).
However, within 20 minutes, SPARC-null lenses contained more dye and
radioactive tracer relative to wt controls, a result indicating that
disorganization of the capsule and its underlying cells is associated with
increased penetration into SPARC-null lenses. The dye was distributed mostly
in the equatorial region (Fig.
10A, arrowheads). This observation is consistent with our data
from EM and immunostaining of collagen type IV, that is, the lens capsule
posterior to the bow region is the initial and principal site of the
structural abnormality (Figs 8
and 9).
|
Wt and SPARC-null lenses had similar wet weights (4.09 mg versus 4.15 mg, respectively) (Fig. 11). After dehydration, the dry weight of 1-month-old SPARC-null lenses was less than that of the SPARC+/+ lenses (0.77 mg versus 1.13 mg, respectively), owing to the increased water content of the SPARC-null lenses. This observation is consistent with the 3H2O penetration assay. Breakdown of the physiological barrier of SPARC-null lenses would allow increased water flux and/or altered ion transport, which would perturb the osmotic balance in the lens fiber cell membranes and lead to the swelling of fibers. The results are the first to indicate the possible influence of SPARC on permeability in the lens.
|
| Discussion |
|---|
|
|
|---|
The lens capsule is a specialized ECM that (a) is responsible for lens
compartmentalization and the maintenance of lens tissue structure, (b)
controls fluid and substrate exchange and (c) regulates normal lens epithelial
cell growth and differentiation. In the SPARC-null lens, we propose that its
compromised lens capsule contributes to altered homeostasis of the lens and
the transport of water, small molecules and ions into the strictly aligned
lens fiber cells. The result of these changes is swelling of the lens fibers,
one of the hallmarks of an osmotic cataract (e.g., the diabetic cataract)
(Bond et al., 1996
).
SPARC-null mice begin to exhibit cortical alterations at 1 month of age, when secondary lens fibers located in the cortex and bow region appear swollen (Fig. 3). Ultrastructural analysis disclosed defects in the lens capsule and lens cells in 1 month-old SPARC-null mice (Fig. 8A,B). At this early stage, the capsule structure begins to appear disorganized. The structurally compromised lens capsule, especially at the equator, was associated with increased dye and radioactive tracer penetration into the lens (Fig. 10A, arrowheads; Fig. 10), a result indicating that SPARC-null lenses lack normal permeability. The swelling of the fibers in the bow region at early stages (Fig. 3F), and the numerous vacuoles in this region, could be caused by the disruption of normal cell-matrix interactions and initial damage of the posterior lens capsule behind the equator in the SPARC-null lens. The progression of the fiber cell protrusion into the lens capsule is consistent with the amounts of tracers in the lens capsules and lenses (Fig. 10, 1 month versus 3 months). The presence of defective lens capsular structure is consistent with the swelling of the fiber cells.
The lens capsule is an unusally thick basement membrane. Its intrinsic
structural components include collagen type IV, laminin, nidogen and heparan
sulfate proteoglycan (Cammarata et al.,
1986
; Starkey et al.,
1987
; Inoue,
1994
). The importance of heparan sulfate proteoglycan in the BM
for regulation of the permeability of ions and macromolecules has been amply
demonstrated in the glomerular BM (Groffen
et al., 1999
). Heparan sulfate glycosaminoglycans provide a
chargesieving function, as the polyanionic chains are associated with large
spheres of hydration, which would leave little free water between
macromolecules. Since the distribution of glycosaminoglycans appears to be
different in normal and cataractous lens capsules
(Winkler et al., 2001
), it is
likely that alteration of anionic sites would affect the permeability of
metabolites as well. Disruption of the organization of the macromolecular
network of the lens BM is predicted to facilitate the passage of water, ions
and possibly larger molecules across the BM. In fact, increased permeability
of the lens capsule to water was found in lenses with cortical cuneiform
opacities, to the exclusion of the nucleus
(Fisher, 1977
;
Maraini and Mangili, 1973
).
Moreover, such increases were also found in the rabbit lens, in which the
posterior lens capsule had been perforated, and in adult human diabetic
lenses, in which edematous lens fibers were correlated with a 37% increase in
hydraulic permeability (Fisher,
1985
; Fisher and Wakely,
1976
). SPARC-null lenses with cortical opacity exhibited an
increased permeability to water, relative to wt lenses, that could disrupt the
Na+ and K+ balance in fiber cells and could cause cell
swelling. Dysfunctional cell membrane selectivity to ions has been correlated
with increased permeability (Duncan and
Croghan, 1969
) and is consistent with the association of increases
in ion flux with the onset of cataracts
(Matsuda et al., 1982
). The
SPARC-null mice that exhibit cortical lenticular opacity, but no involvement
of the nucleus until later stages, might represent another cataract model with
compromised permeability of the lens capsule.
Lens capsular BM is not a static structure but is continually produced and
remodeled by lens epithelial cells and newly differentiated fiber cells
(Johnson and Beebe, 1984
). As
SPARC regulates the production of ECM proteins and binds to several collagens
including the BM collagen type IV (Lane et
al., 1992
; Kamihagi et al.,
1994
; Francki et al.,
1999
; Sage et al.,
1989
; Sasaki et al.,
1998
), our data are consistent with the proposal that SPARC
affects the organization and assembly of the components in the lens capsular
matrix. Additionally, it is highly likely that lens cells without SPARC
exhibit abnormal behavior. For example, the protrusion of the fiber cells into
the lens capsule indicates not only that the lens capsule is abnormal, but
also that these fiber cells without SPARC become invasive and pathological.
SPARC-null lens cells are clearly altered in their morphology, but their
production of ECM components and heparan sulfate proteoglycan, as well as
their migratory, adhesive and differentiation properties, are poorly
understood and are currently under investigation in our laboratory.
It is interesting that age-related changes in the lenses of Fischer rats
were morphologically similar to those observed in SPARC-null lenses. For
example, at 18 months of age, Uga et al. observed posterior invasion by the
processes of the cortical fiber cells toward the lens capsule and swelling of
anterior cortical fibers (Uga et al.,
1996
). Whether or not age-related human cataracts exhibit any
abnormalities in the lens capsule, as seen in SPARC-null mice, has not been
reported and needs to be investigated. Elevated levels of SPARC mRNA and
protein have been described in human cataratous lenses, an observation leading
Kantorow et al. to propose that SPARC is associated with the process of human
cataractogenesis (Kantorow et al.,
2000
).
In this study, the labeling of proliferating cells in vivo with BrdU tested
the hypothesis that accelerated proliferation of lens epithelial cells in
SPARC-null mice results in lenticular opacity. No significant differences in
cell proliferation between wt and SPARC-null lenses from E14 to 4 months of
age were observed, despite the presence of opacity in SPARC-null mice that
began at 1 month. Only in SPARC-null mice of 7 months and older was there a
significant increase in BrdU-positive cells, which occurred concomitantly with
inflammation and tissue necrosis in the ruptured posterior area
(Norose et al., 1998
). It is
likely that inflammatory cells recruited into the injured area stimulated an
increase in BrdU-positive cells by their release of cytokines. In addition,
there were no significant changes in the levels of MIP 26 and crystallins in
SPARC-null lenses. The absence of proteolytic degradation of crystallins and
MIP 26 indicate that the activation of proteases for these substrates is
minimal in the SPARC-null lenses, at least up to 3 months of age.
SPARC interacts with ECM proteins (e.g., collagen types I, III and IV) and
growth factors (platelet-derived growth factor and vascular endothelial growth
factor) and influences cell proliferation, migration, adhesion,
differentiation and/or barrier function
(Yan and Sage, 1999
;
Brekken and Sage, 2001
;
Goldblum et al., 1994
). If
SPARC is important in the regulation of the distribution and organization of
lens BM matrix, it follows that this protein is likely to influence lens
epithelial cell growth and differentiation. This study indicates that
compromised lens permeability is a consequence of the absence of SPARC and
contributes to cataract formation. The mechanism(s) that accounts for the
defects in the lens capsule will contribute to our understanding of the
biological functions of SPARC and the organization of lens BM proteins and
proteoglycans, as well as the importance of cell-matrix interactions in the
lens.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Bassuk, J. A., Birkebak, T., Rothmier, J. D., Clark, J. M., Bradshaw, A., Muchowski, P. J., Howe, C. C., Clark, J. I. and Sage, E. H. (1999). Disruption of the Sparc locus in mice alters the differentiation of lenticular epithelial cells and leads to cataract formation. Exp. Eye Res. 68,321 -331.[Medline]
Benedetti, E. L., Dunia, I. and Bloemendal, H.
(1974). Development of junctions during differentiation of lens
fibers. Proc. Natl. Acad. Sci. USA
715073
-5077.
Bond, J., Green, C., Donaldson, P. and Kistler, J.
(1996). Liquefaction of cortical tissue in diabetic and
galactosemic rat lenses defined by confocal laser scanning microscopy.
Invest. Ophthalmol. Vis. Sci.
37,1557
-1565.
Bornstein, P. (1995). Diversity of function is
inherent in matricellular proteins: an appraisal of thrombospondin 1.
J. Cell Biol. 130,503
-506.
Bosman, F. T., Cleutjens, J., Beek, C. and Havenith, M. (1989). Basement membrane heterogeneity. Histochem. J. 21,629 -633.[Medline]
Brekken, R. A. and Sage, E. H. (2001). SPARC, a matricellular protein: at the crossroads of cell-matrix communication. Matrix Biol. 19,816 -827.[Medline]
Cammarata, P. R., Cantu-Crouch, D., Oakford, L. and Morrill, A. (1986). Macromolecular organization of bovine lens capsule. Tissue Cell 18,83 -97.[Medline]
Duncan, G. and Croghan, P. C. (1969). Mechanisms for the regulation of cell volume with particular reference to the lens. Exp. Eye Res. 8,421 -428.[Medline]
Fisher, R. F. (1977). Changes in the permeability of the lens capsule in senile cataract. Trans. Ophthalmol. Soc. UK 97,100 -103.[Medline]
Fisher, R. F. (1985). The structure and function of basement membrane (lens capsule) in relation to diabetes and cataract. Trans. Ophthalmol. Soc. UK 104,755 -759.
Fisher, R. F. and Wakely, J. (1976). Changes in lens fibres after damage to the lens capsule. Trans Ophthalmol Soc UK 96,278 -284.[Medline]
Fitch, J. M., Mayne, R. and Linsenmayer, T. F.
(1983) Developmental acquisition of basement membrane
heterogeneity: type IV collagen in the avian lens capsule. J. Cell
Biol. 97,940
-943.
Francki, A., Bradshaw, A. D., Bassuk, J. A., Howe, C. C.,
Couser, W. G. and Sage, E. H. (1999). SPARC regulates the
expression of collagen type I and transforming growth factor-beta1 in
mesangial cells. J. Biol. Chem.
274,32145
-32152.
Gilmour, D. T., Lyon, G. J., Carlton, M. B., Sanes, J. R., Cunningham, M. J., Anderson, J. R., Hogan, B. L., Evans, M. J. and Colledge, W. H. (1998). Mice deficient for the secreted glycoprotein SPARC/osteonectin/BM40 develop normally but show severe age-onset cataract formation and disruption of the lens. EMBO J. 17,1860 -1870.[Medline]
Goldblum, S. E., Ding, X., Funk, S. E. and Sage, E. H.
(1994). SPARC (secreted protein acidic and rich in cysteine)
regulates endothelial cell shape and barrier function. Proc. Natl.
Acad. Sci. USA 91,3448
-3452.
Groffen, A. J., Veerkamp, J. H., Monnens, L. A. and van den
Heuvel, L. P. (1999). Recent insights into the structure and
functions of heparan sulfate proteoglycans in the human glomerular basement
membrane. Nephrol. Dial. Transplant.
14,2119
-2129.
Inoue, S. (1994). Basic structure of basement membranes is a fine network of "cords", irregular anastomosing strands. Microsc. Res. Tech. 28, 29-47.[Medline]
Johnson, M. C. and Beebe, D. C. (1984). Growth, synthesis and regional specialization of the embryonic chicken lens capsule. Exp. Eye Res. 38,579 -592.[Medline]
Kamihagi, K., Katayama, M., Ouchi, R. and Kato, I. (1994). Osteonectin/SPARC regulates cellular secretion rates of fibronectin and laminin extracellular matrix proteins. Biochem. Biophys. Res. Commun. 200,423 -428.[Medline]
Kantorow, M., Huang, Q., Yang, X. J., Sage, E. H., Magabo, K. S., Miller, K. M. and Horwitz, J. (2000). Increased expression of osteonectin/SPARC mRNA and protein in age-related human cataracts and spatial expression in the normal human lens. Mol. Vis. 6,24 -29.[Medline]
Kupprion, C., Motamed, K. and Sage, E. H.
(1998). SPARC (BM-40, osteonectin) inhibits the mitogenic effect
of vascular endothelial growth factor on microvascular endothelial cells.
J. Biol. Chem. 273,29635
-29640.
Lane, T. F. and Sage, E. H. (1990). Functional
mapping of SPARC: peptides from two distinct Ca++-binding sites
modulate cell shape. J. Cell Biol.
111,3065
-3076.
Lane, T. F., Iruela-Arispe, M. L. and Sage, E. H.
(1992). Regulation of gene expression by SPARC during
angiogenesis in vitro. Changes in fibronectin, thrombospondin-1, and
plasminogen activator inhibitor-1. J. Biol. Chem.
267,16736
-16745.
Lane, T. F. and Sage, E. H. (1994). The biology of SPARC, a protein that modulates cell-matrix interactions. FASEB J. 8,163 -173.[Abstract]
Lee, S. M., Lin, S. Y., Li, M. J. and Liang, R. C. (1997). Possible mechanism of exacerbating cataract formation in cataractous human lens capsules induced by systemic hypertension or glaucoma. Ophthalmic Res. 29,83 -90.[Medline]
Li, Y., Yan, Q. and Wolf, N. S. (1997).
Long-term caloric restriction delays age-related decline in proliferation
capacity of murine lens epithelial cells in vitro and in vivo.
Invest. Ophthalmol. Vis. Sci.
38,100
-107.
Maraini, G. and Mangili, R. (1973). Differences in proteins and in the water balance of the lens in nuclear and cortical types of senile cataract. In The Human Lens in Relation to Cataract (K. M. Elliott and D. W. Fitzsimmons, eds), pp.79 -97. Amsterdam: Elsevier Excerpta Medica.
Matsuda, H., Giblin, F. J. and Reddy, V. N.
(1982). The effect of X-irradiation on Na-K ATPase and cation
distribution in rabbit lens. Invest. Ophthalmol. Vis
Sci. 22,180
-185.
Mayer, U., Aumailley, M., Mann, K., Timpl, R. and Engel, J. (1991). Calcium-dependent binding of basement membrane protein BM-40 (osteonectin, SPARC) to basement membrane collagen type IV. Eur. J. Biochem. 198,141 -150.[Medline]
Maurer, P., Hohenadl, C., Hohenester, E., Göhring, W., Timpl, R, and Engel, J. (1995). The C-terminal portion of BM-40 (SPARC/osteonectin) is an autonomously-folding and crystallisable domain that binds calcium and collagen IV. J. Mol. Biol. 253,347 -357.[Medline]
Murphy-Ullrich, J. E., Lane, T. F., Pallero, M. A. and Sage, E. H. (1995). SPARC mediates focal adhesion disassembly in endothelial cells through a follistatin-like region and the calcium-binding EF-hand. J. Cell Biochem. 57,341 -350.[Medline]
Newell, F. W. (1996). Physiology and biochemistry of the eye. In Ophthalmology principles and concepts (K. Kirst, ed.), pp. 74-102. St Louis, MO: Mosby Year Book Inc.
Norose, K., Clark, J. I., Syed, N. A., Basu, A., Heber-Katz, E.,
Sage, E. H. and Howe, C. C. (1998). SPARC deficiency leads to
early-onset cataractogenesis. Invest. Ophthalmol. Vis.
Sci. 39,2674
-2680.
Norose, K., Lo, W. K., Clark, J. I., Sage, E. H. and Howe, C. C. (2000). Lenses of SPARC-null mice exhibit an abnormal cell surface-basement membrane interface. Exp. Eye Res. 71,295 -307.[Medline]
Raines, E. W., Lane, T. F., Iruela-Arispe, M. L., Ross, R. and
Sage, E. H. (1992). The extracellular glycoprotein SPARC
interacts with platelet-derived growth factor (PDGF)-AB and -BB and inhibits
the binding of PDGF to its receptors. Proc. Natl. Acad. Sci.
USA 89,1281
-1285.
Sage, H., Vernon, R. B, Funk, S. E., Everitt, E. A. and Angello,
J. (1989). SPARC, a secreted protein associated with cellular
proliferation, inhibits cell spreading in vitro and exhibits Ca+2-dependent
binding to the extracellular matrix. J. Cell Biol.
109,341
-356.
Sage, E. H. (1997). Terms of attachment: SPARC and tumorigenesis. Nat. Med. 3, 144-146.[Medline]
Sage. E. H. and Bornstein, P. (1991).
Extracellular proteins that modulate cell-matrix interactions. SPARC,
tenascin, and thrombospondin. J. Biol. Chem.
266,14831
-14834.
Sasaki, T., Hohenester, E., Göhring, W. and Timpl, R. (1998). Crystal structure and mapping by site-directed mutagenesis of the collagen-binding epitope of an activated form of BM-40/SPARC/osteonectin. EMBO J. 17,1625 -1634.[Medline]
Shiels, A. and Bassnett, S. (1996). Mutations in the founder of the MIP gene family underlie cataract development in the mouse. Nat. Genet. 12,212 -215.[Medline]
Starkey, J. R., Stanford, D. R., Magnuson, J. A., Hamner, S., Robertson, N. P. and Gasic, G. J. (1987). Comparison of basement membrane matrix degradation by purified proteases and by metastatic tumor cells. J. Cell. Biochem. 35, 31-49.[Medline]
Timpl, R. and Dziadek, M. (1986). Structure, development, and molecular pathology of basement membranes. Int. Rev. Exp. Pathol. 29,1 -112.[Medline]
Tremble, P. M., Lane, T. F., Sage, E. H. and Werb, Z.
(1993). SPARC, a secreted protein associated with morphogenesis
and tissue remodeling, induces expression of metalloproteinases in fibroblasts
through a novel extracellular matrix-dependent pathway. J. Cell
Biol. 121,1433
-1444.
Uga, S., Obara, Y., Takehana, M., Nishigori, H., Hikida, M. and Mibu, H. (1996). Morphological study of age-related changes in Fischer rat lens. Jpn. J. Ophthalmol. 40, 33-41.[Medline]
Wight, T. N., Lara, S., Riessen, R., le Baron, R. and Isner, J. (1997). Selective deposits of versican in the extracellular matrix of restenotic lesions from human peripheral arteries. Am. J. Pathol. 151,963 -973.[Abstract]
Winkler, J., Wirbelauer, C., Frank, V. and Laqua, H. (2001). Quantitative distribution of glycosaminoglycans in young and senile (cataractous) anterior lens capsules. Exp. Eye Res. 72,311 -318.[Medline]
Wride, M. A. (1996). Cellular and molecular features of lens differentiation: a review of recent advances. Differentiation 61,77 -93.[Medline]
Yan, Q., Sage, E. H. and Hendrickson, A. E.
(1998). SPARC is expressed by ganglion cells and astrocytes in
bovine retina. J. Histochem. Cytochem.
46, 3-10.
Yan, Q. and Sage, E. H. (1999). SPARC, a matricellular glycoprotein with important biological functions. J. Histochem. Cytochem. 47,495 -506.
Yan, Q., Clark, J. I. and Sage, E. H. (2000). Expression and characterization of SPARC in human lens and in the aqueous and vitreous humors. Exp. Eye Res. 71, 81-90.[Medline]
Yurchenco, P. D. and Schittny, J. C. (1990). Molecular architecture of basement membranes. FASEB J. 4,1577 -1590.[Abstract]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
M. S. Weaver, G. Workman, and E. H. Sage The Copper Binding Domain of SPARC Mediates Cell Survival in Vitro via Interaction with Integrin {beta}1 and Activation of Integrin-linked Kinase J. Biol. Chem., August 15, 2008; 283(33): 22826 - 22837. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Martinek, J. Shahab, M. Saathoff, and M. Ringuette Haemocyte-derived SPARC is required for collagen-IV-dependent stability of basal laminae in Drosophila embryos J. Cell Sci., May 15, 2008; 121(10): 1671 - 1680. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Gotoh, N. R. Perdue, H. Matsushima, E. H. Sage, Q. Yan, and J. I. Clark An In Vitro Model of Posterior Capsular Opacity: SPARC and TGF-{beta}2 Minimize Epithelial-to-Mesenchymal Transition in Lens Epithelium Invest. Ophthalmol. Vis. Sci., October 1, 2007; 48(10): 4679 - 4687. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. J. Rentz, F. Poobalarahi, P. Bornstein, E. H. Sage, and A. D. Bradshaw SPARC Regulates Processing of Procollagen I and Collagen Fibrillogenesis in Dermal Fibroblasts J. Biol. Chem., July 27, 2007; 282(30): 22062 - 22071. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Kzhyshkowska, G. Workman, M. Cardo-Vila, W. Arap, R. Pasqualini, A. Gratchev, L. Krusell, S. Goerdt, and E. H. Sage Novel Function of Alternatively Activated Macrophages: Stabilin-1-Mediated Clearance of SPARC J. Immunol., May 15, 2006; 176(10): 5825 - 5832. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Yan, N. Perdue, D. Blake, and E. H. Sage Absence of SPARC in Murine Lens Epithelium Leads to Increased Deposition of Laminin-1 in Lens Capsule Invest. Ophthalmol. Vis. Sci., December 1, 2005; 46(12): 4652 - 4660. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. H. Barker, G. Baneyx, M. Cardo-Vila, G. A. Workman, M. Weaver, P. M. Menon, S. Dedhar, S. A. Rempel, W. Arap, R. Pasqualini, et al. SPARC Regulates Extracellular Matrix Organization through Its Modulation of Integrin-linked Kinase Activity J. Biol. Chem., October 28, 2005; 280(43): 36483 - 36493. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. E. Gruber, E. H. Sage, H. J. Norton, S. Funk, J. Ingram, and E. N. Hanley Jr. Targeted Deletion of the SPARC Gene Accelerates Disc Degeneration in the Aging Mouse J. Histochem. Cytochem., September 1, 2005; 53(9): 1131 - 1138. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sangaletti, L. Gioiosa, C. Guiducci, G. Rotta, M. Rescigno, A. Stoppacciaro, C. Chiodoni, and M. P. Colombo Accelerated dendritic-cell migration and T-cell priming in SPARC-deficient mice J. Cell Sci., August 15, 2005; 118(16): 3685 - 3694. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. A. Puolakkainen, A. D. Bradshaw, R. A. Brekken, M. J. Reed, T. Kyriakides, S. E. Funk, M. D. Gooden, R. B. Vernon, T. N. Wight, P. Bornstein, et al. SPARC-thrombospondin-2-double-null Mice Exhibit Enhanced Cutaneous Wound Healing and Increased Fibrovascular Invasion of Subcutaneous Polyvinyl Alcohol Sponges J. Histochem. Cytochem., May 1, 2005; 53(5): 571 - 581. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Sweetwyne, R. A. Brekken, G. Workman, A. D. Bradshaw, J. Carbon, A. W. Siadak, C. Murri, and E. H. Sage Functional Analysis of the Matricellular Protein SPARC with Novel Monoclonal Antibodies J. Histochem. Cytochem., June 1, 2004; 52(6): 723 - 733. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Alizadeh, J. Clark, T. Seeberger, J. Hess, T. Blankenship, and P. G. FitzGerald Characterization of a Mutation in the Lens-Specific CP49 in the 129 Strain of Mouse Invest. Ophthalmol. Vis. Sci., March 1, 2004; 45(3): 884 - 891. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. M. Delany, I. Kalajzic, A. D. Bradshaw, E. H. Sage, and E. Canalis Osteonectin-Null Mutation Compromises Osteoblast Formation, Maturation, and Survival Endocrinology, June 1, 2003; 144(6): 2588 - 2596. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. D. Bradshaw, D. C. Graves, K. Motamed, and E. H. Sage SPARC-null mice exhibit increased adiposity without significant differences in overall body weight PNAS, May 13, 2003; 100(10): 6045 - 6050. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Yan, D. Blake, J. I. Clark, and E. H. Sage Expression of the Matricellular Protein SPARC in Murine Lens: SPARC Is Necessary for the Structural Integrity of the Capsular Basement Membrane J. Histochem. Cytochem., April 1, 2003; 51(4): 503 - 511. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Puolakkainen, A. D. Bradshaw, T. R. Kyriakides, M. Reed, R. Brekken, T. Wight, P. Bornstein, B. Ratner, and E. H. Sage Compromised Production of Extracellular Matrix in Mice Lacking Secreted Protein, Acidic and Rich in Cysteine (SPARC) Leads to a Reduced Foreign Body Reaction to Implanted Biomaterials Am. J. Pathol., February 1, 2003; 162(2): 627 - 635. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||