|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
Research Article |
Department of Anatomy and Cell Biology, Columbia University, College of Physicians and Surgeons, New York, NY 10032, USA
* Author for correspondence (e-mail: gb74{at}columbia.edu )
Accepted 24 May 2002
| Summary |
|---|
|
|
|---|
Key words: SNAP-25, Regulated exocytosis, Cysteine-rich domain
| Introduction |
|---|
|
|
|---|
SNAP-25 and its non-neuronal homologue Syndet/SNAP-23
(Wang et al., 1997
;
Ravichandran et al., 1996
) are
synthesized as soluble proteins in the cytosol. Others and ourselves have
shown that both SNAP-25 and Syndet/SNAP-23 are palmitoylated at cysteine
residues clustered in a loop between two N- and C-terminal coils and that
palmitoylation is essential for membrane binding and plasma membrane targeting
(Gonzalo et al., 1999
;
Gonzalo and Linder, 1998b
;
Koticha et al., 1999
;
Veit et al., 1996
;
Vogel et al., 2000
). It is
possible that palmitoylation at the cysteine-rich domain of SNAP-25 modulates
its biological activity. However, it is not clear whether the cysteine-rich
domain is necessary for function. The loop with the cysteine-rich motif is not
required for complex formation in vitro
(Fasshauer et al., 1998
;
Poirier et al., 1998
;
Vogel et al., 2000
).
Reconstitution experiments using liposomes show that the cysteine-rich domain
is not necessary for vesicle fusion in vitro
(Parlati et al., 1999
). In
cracked PC12 cells treated with BoNT/E toxin, bacterially expressed,
non-palmitoylated, wild-type SNAP-25 and a full-length SNAP-25 mutant with its
cysteines mutated into alanine residues are able to reconstitute
Ca2+-dependent exocytosis
(Scales et al., 2000
). In
agreement with these findings, it has been suggested that soluble SNAP-25
mutants have biological activity and support secretion in
Streptolysin-O-permeabilized HIT cells
(Gonelle-Gispert et al., 2000
).
However, it has also been proposed that the cysteine residues of SNAP-25 are
required for exocytosis in Streptolysin-O-permeabilized PC12 cells
(Washbourne et al., 2001
). The
discrepancy between data using cracked or permeabilized cells may be caused by
different levels of exogenous SNAP-25 in the transfected cell. Moreover, by
using Streptolysin-O-permeabilized cells, it is difficult to establish whether
soluble SNAP-25 proteins are indeed functional. This is because soluble
SNAP-25, unlike the membrane-bound protein, can diffuse out of the pores
created by toxin. In conclusion, although it is established that
palmitoylation of SNAP-25 plays an important role in targeting the protein to
the plasma membrane, the question of whether this process is required for
SNAP-25 function in exocytosis remains under discussion. To test whether
membrane association and plasma-membrane targeting is required for function,
we have used an `intact-cell'-based system. In this system, the level of
expression of exogenous SNAP-25 is similar to that of the endogenous protein,
and the activity of the same amount of soluble and membrane-bound SNAP-25 can
be directly compared. By using this controlled experimental system, we find
that soluble SNAP-25 proteins do not form SNARE complexes and are unable to
reconstitute regulated secretion.
| Materials and Methods |
|---|
|
|
|---|
1 subunit of
Na+/K+ ATPase was from Upstate Biotechnology Inc (Lake
Placid NY). Mouse monoclonal antibody 42.1 against Rab3 was provided by R.
Jahn (Max-Planck-Institute for Biophysical Chemistry, Gottingen, Germany)
(Matteoli et al., 1991
Constructs
Murine POMC-pSP65 plasmid was a kind gift from Gary Thomas (Oregon Health
Sciences University, Portland, Oregon). POMC-ß-Gal was constructed by
performing a PCR on POMC-pSP65 using the following primers: 5'
GGTGCTAGCCGCCTTTCCGCGACAGAG and 5'TAAAAGCTTCTGGCCCTTCTTCTGCGC. The PCR
product was cut with NheI and HindIII and inserted into the
NheI- and HindIII-digested pcDNA3.1 vector to obtain
POMC-pcDNA3.1. ß-Gal cDNA was excised from pIND/LacZ using
HindIII and XbaI, and this fragment was inserted into
HindIII and XbaI-digested POMC-pcDNA3.1 to obtain
POMC-
-Gal-pcDNA3.1.
SNAP-25A-pcB7 containing a myc-tag at the C-terminus was excised with
KpnI and BamHI from SNAP25-Amyc-pCMX vector
(Bark et al., 1995
) and
subcloned into the pcB7 vector (Koticha et
al., 1999
). Delta-SNAP25-A-myc-pcB7 was generated using the
Long-Distance Inverse PCR method as described by Koticha et al.
(Koticha et al., 1999
) using
SNAP-25A-pcB7 as a template and the following primers: 5'
AAACTTAAATCCAGTGATGCTTACAAAA and 5' GCCTAAATCTTTTAAATTTTTCTCG. SNAP-25
protein encoded by SNAP-25A-pcB7 or Delta-SNAP-25A-pcB7 was made resistant to
Botulinum Neurotoxin E (BoNT/E) by changing 179Asp into a Lys
residue and 182Met into Thr residue using the following primers:
5' GCATCACAGAGAAGGCTGACTCCAACAAAACCAG and 5'
GCTTAATCTGGCGATTCTGGGTGTCAATCTC and performing PCR as described above.
SNAP-25A with its cysteines changed to alanines was generated by performing
PCR on SNAP-25A/ER-pcB7 using the following primers: 5'
CGGCTAATAAACTTAAATCCAGTGATGCTTACAA and 5'
GCGCTATAAATAATCCTGCTGCTTTGCCTAAATCTTTTAAATTTTTCTC giving CA-SNAP-25A/ER-pcB7.
SNAP-25A lacking the N-terminal helix and containing amino acids 82-206 was
generated by performing PCR on SNAP-25A/ER-pcB7 using the following primers;
5' TGGTAGTGGTGGGGGGTTG and 5' TGGATTTAGGCAAATGCTGTGGC to give
SNAP-25A/ER-82-206-pcB7. SNAP-25A lacking the N-terminal helix and the loop
between the helices (amino acids 140-206) was generated by performing PCR on
SNAP-25A/ER-pcB7 using the following primers; 5' TGGTAGTGGTGGGGGGTTG and
5' TGGATGCCCGGGAAAATGAAA to give SNAP-25A/ER-140-206-pcB7.
BoNT/E light chain was amplified from BoNT/E-pCMV plasmid (a kind gift from
T. Binz, Hanover, Germany) using primers: 5'
CCTCCTGCGCTCGAGTCTAGATTACCTTATGCCTTTTACAGAA and 5'
TAATTAACCTAAGCTTGCCACCATGGGAATGCCAAAAATTAATAGTTTTAAT, digested with
HindIII and XbaI and subcloned into pCDNA3.1 and pIND
vectors to give BoNT/E-pCDNA3.1 and BoNT/E-pIND.
Syndet/SNAP-23-Delta-BoNT/E-pcB7 has been described elsewhere
(Koticha et al., 1999
).
Cell culture and transfections
Neuro2A cells (a kind gift from Peter Cserjesi, Columbia University, NY)
were cultured in DMEM with 8% FBS. Cells were transfected with Lipofectamine,
according to the manufacturer's instructions. The efficiency of this method
was determined by co-transfecting the pEGFP.C1 construct together with
POMC-ß-Gal and counting the percentage of cells expressing green
fluorescent protein (GFP). Approximately 15% of Neuro2A cells expressed GFP
when transfected with plasmids derived from DH5
bacterial cells.
Neuro2A cell lines stably expressing BoNT/E, in the pIND vector, (G14 cells)
were prepared according to the manufacturer's instructions. The G14 cells were
routinely transfected with plasmids derived from JM109 bacteria to increase to
25% their tranfection rate. Cells were induced with 5 µM Ponasterone A for
20 hours before experiments.
Estimation of the amount exogenous SNAP-25 expressed in Neuro2A
cells
To estimate the amount of Myc-tagged CA-SNAP-25A/ER expressed in Neuro2A
cells, an SDS-PAGE gel was loaded with post-nuclear supernatants derived from
2 and 4x105 cells. The intensity of the protein band obtained
by western blot analysis with anti Mycantibodies was compared with that of
known amounts (2.8, 5.6, 11.2, 22.4 and 44.8 ng) of Myc-tagged GFP-ensconsin
(a kind gift from J. Chloe Bulinski, Columbia University, NY)
(Faire et al., 1999
). We
estimated that approximately 0.0225 pg of CA-SNAP-25A/ER are expressed per
transfected cell. Neuro2A cell lines stably expressing BoNT/E, in the pIND
vector were prepared according to the manufacturer's instructions. Cells were
induced with 5 µM Ponasterone A for 20 hours before experiments. The volume
of Neuro2A cells was estimated by measuring confocal images of 22 cells using
the `LSM 510 Image Examiner' software (Zeiss, Thornwood, NY). The shape of
these cells was approximated to that of an ellipsoid with diameters (µm)
of: d1=27.4±12, d2=17.3±5.6 and
d3=6.15±1 and calculated to have a volume of approximately
1.5x10-6 µl per cell. Assuming that 50% of the cell volume
is occupied by organelles and that the molecular weight of the Myc-tagged
CA-SNAP-25A/ER is approximately 25 kDa, we deduced that the concentration of
the exogenous, soluble SNAP-25 in the cytosol of the transfected cell
corresponds to 1 µM.
Secretion assay
Neuro2A cells grown in 35 mm wells were transiently transfected with
POMC-ß-Gal and the indicated constructs 48 hours before the secretion
experiments. For the experiment, cells were washed twice with M2 medium (145
mM NaCl, 4.8 mM KCl, 1.2 mM MgCl2, 0.7 mM CaCl2 and 1
mg/ml BSA) and incubated at 37°C for 30 minutes in 1.0 ml M2. The medium
was replaced with 1.0 ml M2 buffer with or without 1 µM Ionomycin for
another 60 minutes. The medium was collected and centrifuged at 300
g for 5 minutes at room temperature to remove cell debris. Of
this cell-free medium, 0.75 ml was added to 0.22 ml M2 containing 4 mg/ml
ONPG. This reaction was incubated at 37°C for 60 minutes to measure
ß-Gal enzymatic activity. This incubation period was optimized so that
the absorbance of the reactions was measured within the linear range. The
reaction was stopped by the addition of 0.02 ml of 200 mM EGTA and 0.5 ml of 1
M Na2CO3. The absorbance was read at 420 nm. To measure
total ß-Gal activity in homogenates from transfected Neuro2A cell and G14
cell, cells were scraped in 0.250 ml M2 buffer and mixed with an equal volume
of M2 buffer containing 2% Triton. After incubation on ice for 30 minutes,
samples were centrifuged at 5000 g for 5 minutes. The
ß-Gal activity of 0.05 ml of the supernatant was measured as described
above. Average cell ß-Gal activities were obtained from triplicate
samples per experiment. We estimated the fraction of damaged cells by
measuring the amount of ß-Gal activity released by Neuro2A cells
expressing wild-type ß-Gal after 1 hour of incubation in basal
conditions. The ß-Gal activity released was calculated as a percentage of
the total ß-Gal activity in the cell. This experiment was done twice,
with triplicate points. For some experiments, cells were depolarized with 55
mM KCl in the presence of calcium. The NaCl concentration of the M2 medium was
reduced to 85 mM, and KCl was increased to 55 mM. The cells were kept in this
medium for 120 minutes. The medium was collected and processed as described
above.
SNARE complex analysis
Neuro2A cells grown in a 35 mm plate were scraped in 0.5 ml of buffer
containing 10 mM HEPES, 200 mM sucrose 10 mM EDTA and 2 mM EGTA, pH 7.4 and
homogenized by six passages through an insulin needle as described previously
(Koticha et al., 1999
). The
homogenates were centrifuged at 600 g for 5 minutes. The
postnuclear supernatant was mixed with an equal volume of sample buffer
containing 4% SDS, sonicated for 2 seconds to disperse the pellet and
electrophoresed on a 9% SDS-PAGE gel. A slice of the SDS-PAGE gel
corresponding to the 99 kDa region was excised. The gel slice was heated at
100°C, re-electrophoresed on a 13% gel and analyzed by western blot with
anti-SNAP-25, anti-VAMP-2 and anti-Syntaxin-1 antibodies as described
(Otto et al., 1997
).
Cell fractionation, electrophoresis procedures and confocal
micrography
These procedures were carried out as described previously
(Koticha et al., 1999
).
Post-nuclear supernatants were derived from N2A cell homogenates centrifuged
at 600 g for 5 minutes. The protease inhibitor cocktail
Complete Mini (Roche Diagnostics, Mannheim, Germany) was mixed with the
homogenization buffer (20 mM Hepes pH 7.4, 120 mM potassium glutamate, 20 mM
potassium acetate, 1 mM EGTA, 1 mg/ml BSA) before the experiment. For
immunofluorescence, antibodies against SNAP-25 were used at a dilution of
1:2000 and antibodies against myc were used at a dilution of 1:400.
| Results |
|---|
|
|
|---|
|
|
To determine whether processed POMC-ß-Gal is secreted in a regulated
manner, cells were incubated for 1 hour in basal conditions and with Ionomycin
in the presence of Ca2+. The medium was analyzed by western blot
(Fig. 1E). Results from three
independent experiments indicated that the average ratio of the 150 kDa
POMC-ß-Gal precursor found in the medium of stimulated to that of
unstimulated cells is 0.96 (±0.12). Thus, the amounts of
POMC-ß-Gal precursor released by cells kept in basal and stimulated
conditions are very similar. This observation is in agreement with the finding
that unprocessed forms of POMC are secreted by the constitutive pathway
(Gumbiner and Kelly, 1982). The ratio of the 120/124 kDa processed
POMC-ß-Gal products in the medium of stimulated to that of unstimulated
cells is 4.36 (±0.73). Thus, processed POMC-ß-Gal, unlike the 150
kDa precursor, is released into the medium in a regulated manner. The data are
in agreement with the observation that in Neuro2A cells,
Ca2+-dependent release of ß-endorphin hormone is four-fold
more compared with that observed in basal conditions after 30 minutes
incubation (Noel et al.,
1989
). In conclusion, the cell fractionation experiments and the
secretion data support the concept that processed POMC-ß-Gal is
specifically targeted to granules that undergo regulated secretion.
We measured the amount of ß-Gal activity released by Neuro2A cells transiently transfected with POMC-ß-Gal. Cells treated for 1 hour in basal conditions released approximately 6% of their total ß-Gal activity. Incubation with Ionomycin in the presence of Ca2+ lead to a two-fold increase in ß-Gal secretion (Fig. 1F). Depolarizing the cells with 55 mM KCl in the presence of calcium for 2 hours lead to a similar increase in ß-Gal release (Fig. 1F). The extent of Ca2+-dependent release of ß-Gal was similar at the 30 minute and 1 hour time points (Fig. 1G). Cells transfected with wild-type ß-Gal released less than 0.5% of their total ß-Gal activity when incubated for 1 hour in control conditions, whereas Ca2+-dependent release of ß-Gal activity was undetectable (data not shown). This observation indicates that, in the conditions used for our experiments, the fraction of damaged cells was minimal and that Ca2+-dependent secretion depends on POMC-dependent targeting of ß-Gal to the secretory pathway. By measuring ß-Gal activity, it is not possible to discriminate between the unprocessed and the processed forms of POMC-ß-Gal. The lower fold increase in regulated secretion (two-fold) measured by the ß-Gal activity assay is probably because of the background of constitutively secreted POMC-ß-Gal precursor (see Fig. 1E). In support of this possibility, the ratio of the sum of all three ß-Gal-immunoreactive bands in the medium of stimulated to that of unstimulated cells was 1.86 (±0.23). Thus, the extent of total POMC-ß-Gal release observed by using western blot analysis of the medium and the ß-Gal activity assay is similar. Fig. 1E shows that only the processed forms of POMC-ß-Gal undergo regulated secretion. Thus, it is likely that the Ca2+-dependent secretion measured by the ß-Gal activity assay is specifically caused by the release of the 137 and 124/120 POMC-ß-Gal products. As the ß-Gal activity assay is easier to quantify, we used this method to measure Ca2+-dependent secretion in all the following experiments.
SNAP-25 is required for Ca2+-dependent secretion in
Neuro2A cells
Neuro2A cells have the SNARE components Syntaxin-1, VAMP-2, SNAP-25 and the
non-neuronal SNAP-25 homologue Syndet/SNAP-23
(Fig. 2A). Endogenous SNAP-25
and exogenous myc-tagged SNAP-25A are prevalently localized at the plasma
membrane (Fig. 2B,C). BoNT/E, a
potent inhibitor of neurotransmission, cleaves SNAP-25
(Binz et al., 1994
), and using
BoNT/E toxin, SNAP-25 was shown to be specifically involved in
Ca2+-dependent secretion of hormones
(Sadoul et al., 1997
;
Sadoul et al., 1995
). To
determine whether Ca2+-dependent release of ß-Gal activity
occurs by the same pathway, we co-transfected BoNT/E-pcDNA3.1 and
POMC-ß-Gal in Neuro2A cells. We find that Ca2+-stimulated
secretion of ß-Gal activity is almost abolished when BoNT/E light chain
is expressed (Fig. 2D). When
BoNT/E was transiently expressed together with POMC-ß-Gal in wild-type
Neuro2A cells, approximately 10-15% of the endogenous SNAP-25 was cleaved
(Fig. 2E, lanes 1 and 2). Since
in these conditions the efficiency of cell transfection was 10%-15%, BoNT/E
toxin cleaves most of the endogenous SNAP-25 protein in the transfected cells.
We could not detect any cleavage of the endogenous or overexpressed
Syndet/SNAP-23 by the toxin (Fig.
2E, lanes 3-6). These data are in agreement with the finding that
Syndet/SNAP-23 is poorly digested by BoNT/E in vitro compared with SNAP-25
(Washbourne et al., 1997
).
These experiments show that SNAP-25 is required for regulated secretion of
ß-Gal activity and that Syndet/SNAP-23 is not involved in this process.
Previously, it has been shown that SNAP-25 is necessary for hormone secretion
and only highly overexpressed SNAP-23 (the human homologue of Syndet/SNAP-23)
can replace SNAP-25 in regulated insulin release
(Sadoul et al., 1997
). Our
results show that Ca2+-stimulated secretion of ß-Gal activity
occurs by the same pathway as that of hormone release by endocrine cells.
The cysteine-rich domain of SNAP-25 is necessary to support regulated
exocytosis in intact cells
To determine whether the cysteine-rich domain of SNAP-25A is important for
function in intact cells, we generated a deletion mutant, Delta-SNAP-25A, that
lacks the SNAP-25A sequence from 84Cys to 95Lys
(Fig. 3A). We also generated a
SNAP-25 mutant, CA-SNAP-25A, with its four cysteines changed to alanines
(Fig. 3A). This mutant is the
same as that used by Scales et al. to reconstitute regulated exocytosis in
permeabilized PC-12 cells (Scales et al.,
2000
). In untransfected Neuro2A cells, more than 95% of the
endogenous SNAP-25 is bound to membranes (data not shown). In transiently
transfected cells, approximately 80% of foreign SNAP-25A is membrane bound
(Fig. 3B). Thus, a minor
fraction of SNAP-25 in the transfected cells is shifted into the cytosol,
presumably because the membrane-binding machinery is saturated. In the same
experiment, more than 95% of Delta-SNAP-25A is found in the soluble fraction,
showing that deletion of the cysteine-rich domain shifts the protein into the
cytosol. CA-SNAP-25A mutant is also found in the soluble fraction in
transiently transfected Neuro2A cells (Fig.
3C). Thus, removing the cysteine-rich domain of SNAP-25 or
substituting the cysteines with alanines makes the protein soluble in the
transiently transfected Neuro2A cells. These data are in agreement with other
reports (Lane and Liu, 1997
;
Veit et al., 1996
).
|
Unlike SNAP-25, SNAP-23 is resistant to proteolysis by BoNT/E
(Sadoul et al., 1997
;
Washbourne et al., 2001
). To
obtain a SNAP-25 protein resistant to BoNT/E digestion, we mutated its
cleavage site sequence to that of SNAP-23. SNAP-25A residue 179Asp
was mutated into a Lys, and residue 182Met was mutated into a Thr
(Fig. 3A) to obtain the
toxin-resistant construct SNAP-25A/ER-pcB7. This SNAP-25A/ER-pcB7 construct
was mutated to obtain the Delta-SNAP-25A/ER-pcB7 and the CA-SNAP-25/ER-pcB7
constructs. All of these constructs have the myc-epitope tag at the
C-terminus.
We generated a Neuro2A cell line, G14, that stably expresses BoNT/E toxin. In the G14 cells, all of the endogenous SNAP-25A is cut by the toxin. The cleaved SNAP-25 thus migrates faster than the intact SNAP-25 protein (Fig. 4A, compare lane 1 with lane 2). We transiently transfected the SNAP-25A/ER-pcB7 and Delta-SNAP-25A/ER-pcB7 plasmids in G14 cells. Both SNAP-25A/ER and Delta-SNAP-25A/ER proteins have the myc-tag at the C-terminus and, thus, migrate with higher molecular weight than endogenous SNAP-25 (Fig. 4A, compare lane 1 with lanes 3 and 4). If cut by the toxin, the myc-tagged SNAP-25A/ER protein would generate a peptide with the same size as the endogenous BoNT/E SNAP-25 fragment, whereas myc-tagged Delta-SNAP-25A/ER would generate a smaller peptide. We find that the size and the amount of the cleaved SNAP-25 fragment is the same in G14 cells expressing BoNT/E and transfected with POMC-ß-Gal together with pcB7, SNAP-25A/ER-pcB7 or Delta-SNAP-25A/ER-pcB7 (Fig. 4A, compare lane 2 with lanes 3 and 4). We conclude that SNAP-25A/ER and Delta-SNAP-25A/ER proteins are resistant to BoNT/E and that expression of these proteins does not inhibit the cleavage of endogenous SNAP-25A by BoNT/E. These experiments also show that similar amounts of SNAP-25A/ER and Delta-SNAP-25A/ER are expressed in G14 cells. We obtained the same results when the G14 cells were transfected with the CA-SNAP-25A/ER construct (data not shown). We estimated that the amount of CA-SNAP-25A/ER expressed is approximately 0.025 pg per transfected cell (see Materials and Methods), leading to a cytosolic concentration of approximately 1 µM. The western blot in Fig. 4A shows that the amount of endogenous, cleaved SNAP-25 in the G14 cells is similar to that of exogenous SNAP-25. Co-transfection of the plasmids POMC-ß-Gal together with pcB7, SNAP-25A/ER-pcB7 or Delta-SNAP-25A/ER-pcB7 in G14 cells results in a transfection efficiency of approximately 25%. As the exogenous SNAP-25 is expressed only in 25% of the cell population, we deduce that the amount of endogenous SNAP-25 corresponds to one fourth of the exogenous protein and is 0.00625 pg per cell or approximately 150,000 molecules per cell. G14 cells have similar morphology and generation time to the Neuro2A cells (data not shown). Unstimulated G14 cells release the same amount of ß-Gal activity as wild-type Neuro2A (Fig. 4B) cells, indicating that the release of ß-Gal activity observed in basal conditions is not affected by BoNT/E expression.
|
A full-length SNAP-25 protein with its cysteines mutated to alanines is
able to rescue regulated secretion in permeabilized, BoNT/E-treated PC12 cells
(Scales et al., 2000
). We
expressed the same level of full-length, soluble SNAP-25 (SNAP-25A/ER) and
wild-type SNAP-25 to study the role of the cysteine-rich domain in intact
cells. Regulated exocytosis of ß-Gal activity was measured in cells
lacking endogenous SNAP-25. G14 cells stably expressing BoNT/E were
transiently transfected with POMC-ß-Gal in combination with pcB7
or SNAP-25A/ER or Delta-SNAP-25A/ER or CA-SNAP-25A/ER
(Fig. 5A,B). The variability
between the average ß-Gal activities of each of these groups of cells was
less than 10%. This observation indicates that expression of different SNAP-25
proteins did not change the level of expression of POMC-ß-Gal. Cells
co-tranfected with POMC-ß-Gal and the pcB7 vector
(Fig. 5A,B) or with
POMC-ß-Gal alone (data not shown) did not release ß-Gal activity in
response to increase in intracellular Ca2+. These data further
support the concept that regulated release of ß-Gal activity requires
SNAP-25 (Fig. 2A). In agreement
with this concept, Ca2+-stimulated release of ß-Gal-activity
is reconstituted in G14 cells expressing SNAP-25A/ER
(Fig. 5A,B). In these cells,
the extent of Ca2+-dependent ß-Gal release was approximately
65% of that of wild-type Neuro2A cells. It is possible that SNAP-25A/ER with
mutations at 179Asp and at 182Met and the Myc epitope
tag is less efficient than wild-type SNAP-25 in reconstituting regulated
secretion. Another possibility is that expression of SNAP-25A/ER does not
occur in all the cells expressing the POMC-ß-Gal protein, thus lowering
the efficiency by which regulated release is reconstituted.
|
Hormone secretion is specifically dependent on intact SNAP-25. In this assay, ß-Gal activity release is abolished by BoNT/E toxin digestion of SNAP-25 and reconstituted by expression of toxin-resistant SNAP-25. These data further confirms the conclusion that Ca2+-dependent ß-Gal activity release occurs by the same pathway as native hormone release (Fig. 2). The amount of Ca2+-dependent ß-Gal released from cells expressing either Delta-SNAP-25A/ER (Fig. 5A) or CA-SNAP-25A/ER (Fig. 5B) was equal to that released by G14 cells transfected with control plasmid. Thus, soluble SNAP-25 mutant proteins are unable to reconstitute Ca2+-dependent secretion of ß-Gal activity when expressed at the same level as the palmitoylated protein. We conclude that the cysteine-rich domain of SNAP-25 is necessary for function in intact cells.
| The cysteine-rich domain of SNAP-25 is important for SNARE complex formation in intact cells |
|---|
|
|
|---|
|
A truncated SNAP-25A protein having amino acids 82-206 rescues
regulated exocytosis
It has been proposed that a ternary SNARE complex could be formed by the C-
and the N-terminal domains of two distinct SNAP-25 molecules
(Fasshauer et al., 1998
). The
flexible linker region connecting the two helices of SNAP-25 is necessary for
multimerization of SNARE complexes
(Fasshauer et al., 1998
;
Poirier et al., 1998
). The
possible significance of SNARE complex multimerization in regulated exocytosis
is not clear, as the SNAP-25 peptides corresponding to the C-terminus and the
N-terminus helices not linked by the loop were able to rescue exocytosis in
the in vitro assays (Chen et al.,
1999
; Parlati et al.,
1999
). These data suggested that if the SNAP-25 C-terminus helix
is efficiently targeted to the plasma membrane it should rescue regulated
secretion in the G14 cells expressing BoNT/E. To test this possibility, we
expressed the SNAP-25 C-terminus attached to the loop with the entire
cysteine-rich domain, producing S25A/ER-82-206
(Fig. 7A). The minimal plasma
membrane-targeting domain of SNAP-25 maps to residues 85-120
(Gonzalo et al., 1999
); thus,
it is expected that a SNAP-25 mutant lacking the entire N-terminus domain
would still be targeted to the plasma membrane.
Fig. 7B shows that
S25A/ER-82-206 protein is efficiently targeted to the plasma membrane. When
S25A/ER-82-206 protein was transiently transfected in G14 cells, it was able
to rescue Ca2+-dependent secretion of ß-Gal activity as
efficiently as the wild-type SNAP-25 protein
(Fig. 5). The S25A/ER-82-206
protein was also able to form SNARE complexes of 70 kDa
(Fig. 7D), which are similar to
the complexes formed by the C-terminal helix of SNAP-25 introduced in
permeabilized PC12 cells (Chen et al.,
1999
). The C-terminal helix of SNAP-25, without the
membrane-binding region, S25A-ER-140-206, is highly unstable when expressed in
cells, and its activity cannot be estimated. These experiments show that the
two helices of SNAP-25 do not need to be physically linked in order to
function in intact cells. As SNAP-25 residues 20-80 are required for SNAP-25
binding to syntaxin, these experiments support the concept that that the
interaction between SNAP-25 and sytaxin is not necessary for membrane binding
and plasma-membrane targeting.
|
| Discussion |
|---|
|
|
|---|
A number of studies have demonstrated that SNAP-25 and Syndet/SNAP-23 are
targeted to the plasma membrane by the cysteine-rich domain
(Gonzalo et al., 1999
;
Gonzalo and Linder, 1998a
;
Koticha et al., 1999
;
Veit et al., 2000
;
Vogel and Roche, 1999
).
However, the biological significance of the membrane localization of
endogenous SNAP-25 remains under discussion, as one study found that soluble
SNAP-25 proteins functions in regulated exocytosis in HIT cells
(Gonelle-Gispert et al., 2000
),
whereas a more recent paper shows that soluble SNAP-25 is inactive in PC12
cells (Washbourne et al.,
2001
). A discrepancy in the results may be caused by different
levels of overexpressed SNAP-25 in the transfected cells. It is also possible
that the permeabilized cell system used in both studies leads to depletion of
different amounts of soluble SNAP-25 proteins through the pores created by the
toxin at the plasma membrane
(Gonelle-Gispert et al., 2000
;
Washbourne et al., 2001
). To
resolve the question of whether membrane localization is required for SNAP-25
function in the cell, we measured secretion from intact Neuro2A cell lines
stably transfected with BoNT/E toxin. Transfected neuroblastoma cells are
dependent on expression of exogenous, BoNT/E-resistant SNAP-25 for regulated
secretion. By using the Neuro2A cells, it was possible to achieve a level of
exogenous SNAP-25 overexpression in the transiently transfected cells that was
only four-fold higher than endogenous SNAP-25. Moreover, the effect of
membrane-bound and soluble SNAP-25 could be directly compared as no
permeabilization procedures are used prior to stimulation of the cells. Under
these conditions we find that soluble, BoNT/E-resistant SNAP-25 mutants,
either lacking the cysteine-rich domain or with the four cysteines residues
changed to alanines, are unable to support exocytosis.
In vitro reconstitution of norepinephrine secretion occurs at
concentrations of 10-40 µM of full-length, soluble SNAP-25 with its
cysteine residues mutated into alanines
(Scales et al., 2000
). In the
Neuro2A cells used here, the intracellular concentration of the same soluble
mutated SNAP-25 protein is 1 µM, which is below the level required to
reconstitute granule release in vitro (Chen
et al., 1999
; Scales et al.,
2000
). Targeting of SNAP-25 to the plasma membrane or to
cholesterol-dependent clusters at which secretory vesicles preferentially dock
and fuse (Lang et al., 2001
)
would greatly increase the concentration of SNAP-25 to the levels required for
exocytosis. We conclude that the role of the cysteine-rich domain is to
increase the concentration of SNAP-25 near the plasma membrane to a sufficient
level to allow exocytosis.
Mutation of the palmitoylation site of G proteins or the GRK class of
serine/threonine kinases impairs their function in signal transduction
[reviewed by Resh (Resh,
1999
)]. Similarly, it is possible that palmitoylation of SNAP-25
modulates its activity by controlling its cell localization. It has been
proposed that SNAP-25 is a major substrate for palmitoylation in adult CNS and
that palmitoylation is necessary to target newly synthesized SNAP-25 to the
plasma membrane (Gonzalo et al.,
1999
; Gonzalo and Linder,
1998a
; Hess et al.,
1992
). Our results show that mutants at the palmitoylation site of
SNAP-25 are unable to support regulated exocytosis. Together, these findings
suggest that inhibition of SNAP-25 palmitoylation lead to a pool of newly
synthesized SNAP-25 that is inactive. Mature SNAP-25 is dynamically
palmitoylated in PC12 cells and in neurites
(Hess et al., 1993
;
Lane and Liu, 1997
); thus, in
principle, it is possible that the activity of mature, processed SNAP-25 is
controlled by cycles of pamitoylation and depalmitoylation. Against this
possibility, it has been shown that chemical deacylation of SNAP-25 does not
release the protein from its membrane association
(Gonzalo and Linder, 1998a
),
possibly because of its interaction with syntaxin
(Gonelle-Gispert et al., 2000
;
Vogel et al., 2000
;
Washbourne et al., 2001
).
SNARE complexes can be formed in vitro by soluble Syntaxin-1, VAMP-2 and
the SNAP-25 N- and C-terminal fragments. Thus, the loop that connects the N-
and C-terminal coils of SNAP-25, including the cysteine-rich motif, does not
participate in complex formation in vitro
(Fasshauer et al., 1998
;
Poirier et al., 1998
;
Sutton et al., 1998
). Here, we
find that a SNAP-25 mutant, either lacking the cysteine-rich domain or with
its cysteines substituted with alanines, does not form SNARE complexes when
expressed at the same level as wild-type SNAP-25 in transfected neuroblastoma
cells. To observe SNARE complexes, exogenous soluble SNAP-25 protein was
expressed at approximately five-fold higher levels than the exogenous
membrane-bound SNAP-25. The only known role of the cysteine-rich domain is to
target SNAP-25 to the plasma membrane. Thus, the simplest interpretation of
these results is that the cysteine-rich domain, by controlling the
localization of SNAP-25 at the plasma membrane, regulates its availability to
form SNARE complexes in the cell.
We have also shown that the C-terminal and the N-terminal helices of
SNAP-25, each targeted to the plasma membrane by two distinct cysteine-rich
domains, function as well as full-length SNAP-25 in intact cells. These
results are in agreement with the in vitro finding that the two helices do not
need to be linked together to function
(Chen et al., 1999
;
Parlati et al., 1999
;
Scales et al., 2000
). Although
the loop may act as a linker of multiple SNARE complexes, this function does
not appear to be necessary for function in the cell.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Baldini, G., Baldini, G., Wang, G., Weber, M., Zweyer, M.,
Bareggi, R., Witkin, J. W. and Martelli, A. M. (1998).
Expression of Rab3D N1351 inhibits regulated secretion of ACTH in AtT-20cells.
J. Cell Biol. 140,305
-313.
Bark, I. C., Hahn, K. M., Ryabinin, A. E. and Wilson, M. C.
(1995). Differential expression of SNAP-25 protein isoforms
during divergent vesicle fusion events of neural development. Proc.
Natl. Acad. Sci. USA 92,1510
-1514.
Binz, T., Blasi, J., Yamasaki, S., Baumeister, A., Link, E.,
Sudhof, T. C., Jahn, R. and Niemann, H. (1994). Proteolysis
of SNAP-25 by types E and A botulinal neurotoxins. J. Biol.
Chem. 269,1617
-1620.
Chen, Y. A., Scales, S. J., Patel, S. M., Doung, Y. C. and Scheller, R. H. (1999). SNARE complex formation is triggered by Ca2+ and drives membrane fusion. Cell 97,165 -174.[Medline]
Chevrier, D., Fournier, H., Nault, C., Zollinger, M., Crine, P. and Boileau, G. (1991). Expression of porcine pro-opiomelanocortin in mouse neuroblastoma (Neuro2A) cells: targeting of the foreign neuropeptide to dense-core vesicles. Mol. Cell Endocrinol. 79,109 -118.[Medline]
Faire, K., Waterman-Storer, C. M., Gruber, D., Masson, D., Salmon, E. D. and Bulinski, J. C. (1999). E-MAP-115 (ensconsin) associates dynamically with microtubules in vivo and is not a physiological modulator of microtubule dynamics. J. Cell Sci. 112,4243 -4255.[Abstract]
Fasshauer, D., Eliason, W. K., Brunger, A. T. and Jahn, R. (1998). Identification of a minimal core of the synaptic SNARE complex sufficient for reversible assembly and disassembly. Biochemistry 37,10354 -10362.[Medline]
Gonelle-Gispert, C., Molinete, M., Halban, P. A. and Sadoul, K. (2000). Membrane localization and biological activity of SNAP-25 cysteine mutants in insulin-secreting cells. J. Cell Sci. 113,3197 -3205.[Abstract]
Gonzalo, S. and Linder, M. E. (1998a). SNAP-25
palmitoylation and plasma membrane targeting require a functional secretory
pathway. Mol. Biol. Cell
9, 585-597.
Gonzalo, S. and Linder, M. E. (1998b). SNAP-25 palmitoylation and plasma membrane targeting require a functional secretory pathway. Mol. Biol. Cell 9, 585-597.
Gonzalo, S., Greentree, W. K. and Linder, M. E.
(1999). SNAP-25 is targeted to the plasma membrane through a
novel membrane-binding domain. J. Biol. Chem.
274,21313
-21318.
Hanson, P. I., Heuser, J. E. and Jahn, R. (1997). Neurotransmitter release four years of SNARE complexes. Curr. Opin. Neurobiol. 7, 310-315.[Medline]
Hess, D. T., Slater, T. M., Wilson, M. C. and Skene, J. H. (1992). The 25 kDa synaptosomal-associated protein SNAP-25 is the major methioninerich polypeptide in rapid axonal transport and a major substrate for palmitoylation in adult CNS. J. Neuroscience 12,4634 -4641.[Abstract]
Hess, D. T., Patterson, S. I., Smith, D. S. and Skene, J. H. (1993). Neuronal growth cone collapse and inhibition of protein fatty acylation by nitric oxide. Nature 366,562 -565.[Medline]
Iezzi, M., Escher, G., Meda, P., Charollais, A., Baldini, G.,
Darchen, F., Wollheim, C. B. and Regazzi, R. (1999).
Subcellular distribution and function of Rab3A, B, C, and D isoforms in
insulin-secreting cells. Mol. Endocrinol.
13,202
-212.
Jahn, R. and Sudhof, T. C. (1999). Membrane fusion and exocytosis. Annu. Rev. Biochem. 68,863 -911.[Medline]
Kaether, C., Salm, T., Glombik, M., Almers, W. and Gerdes, H. H. (1997). Targeting of green fluorescent protein to neuroendocrine secretory granules: a new tool for real time studies of regulated protein secretion. Eur. J. Cell Biol. 74,133 -142.[Medline]
Koticha, D. D., Huddleston, S. J., Witkin, J. W. and Baldini,
G. (1999). Role of the cysteine-rich domain of syndet in
membrane binding and cellular localization. J. Biol.
Chem. 274,9053
-9060.
Lane, S. R. and Liu, Y. (1997). Characterization of the palmitoylation domain of SNAP-25. J. Neurochem. 69,1864 -1869.[Medline]
Lang, T., Wacker, I., Steyer, J., Kaether, C., Wunderlich, I., Soldati, T., Gerdes, H. H. and Almers, W. (1997). Ca2+-triggered peptide secretion in single cells imaged with green fluorescent protein and evanescent-wave microscopy. Neuron 18,857 -863.[Medline]
Lang, T., Bruns, D., Wenzel, D., Riedel, D., Holroyd, P., Thiele, C. and Jahn, R. (2001). SNAREs are concentrated in cholesterol-dependent clusters that define docking and fusion sites for exocytosis. EMBO J. 20,2202 -2213.[Medline]
Lombardi, D., Soldati, T., Riederer, M. A., Goda, Y., Zerial, M. and Pfeffer, S. R. (1993). Rab9 functions in transport between late endosomes and the trans Golgi network. EMBO J. 12,677 -682.[Medline]
Martelli, A. M., Baldini, G., Tabellini, G., Koticha, D. D., Bareggi, R. and Baldini, G. (2000). Rab3A and Rab3D control the total granule number and the fraction of granules docked at the plasma membrane in PC12 cells. Traffic 1, 976-986.[Medline]
Matteoli, M., Takei, K., Cameron, R., Hurlbut, P., Johnston, P.
A., Sudhof, T. C., Jahn, R. and de Camilli, P. (1991).
Association of Rab3A with synaptic vesicles at late stages of the secretory
pathway. J. Cell Biol.
115,625
-633.
McNew, J. A., Parlati, F., Fukuda, R., Johnston, R. J., Paz, K., Paumet, F., Sollner, T. H. and Rothman, J. E. (2000). Compartmental specificity of cellular membrane fusion encoded in SNARE proteins. Nature 407,153 -159.[Medline]
Noel, G., Zollinger, L., Laliberte, F., Rassart, E., Crine, P. and Boileau, G. (1989). Targeting and processing of pro-opiomelanocortin in neuronal cell lines. J. Neurochem. 52,1050 -1057.[Medline]
Orci, L., Ravazzola, M., Storch, M. J., Anderson, R. G., Vassalli, J. D. and Perrelet, A. (1987). Proteolytic maturation of insulin is a post-Golgi event which occurs in acidifying clathrin-coated secretory vesicles. Cell 49,865 -868.[Medline]
Otto, H., Hanson, P. I. and Jahn, R. (1997).
Assembly and disassembly of a ternary complex of synaptobrevin, syntaxin, and
SNAP-25 in the membrane of synaptic vesicles. Proc. Natl. Acad.
Sci. USA 94,6197
-6201.
Oyler, G. A., Higgins, G. A., Hart, R. A., Battenberg, E.,
Billingsley, M., Bloom, F. E. and Wilson, M. C. (1989). The
identification of a novel synaptosomal-associated protein, SNAP-25,
differentially expressed by neuronal subpopulations. J. Cell
Biol. 109,3039
-3052.
Parlati, F., Weber, T., McNew, J. A., Westermann, B., Sollner,
T. H. and Rothman, J. E. (1999). Rapid and efficient fusion
of phospholipid vesicles by the alpha-helical core of a SNARE complex in the
absence of an N-terminal regulatory domain. Proc. Natl. Acad. Sci.
USA 96,12565
-12570.
Poirier, M. A., Hao, J. C., Malkus, P. N., Chan, C., Moore, M.
F., King, D. S. and Bennett, M. K. (1998). Protease
resistance of syntaxin. SNAP-25. VAMP complexes. Implications for assembly and
structure. J. Biol. Chem.
273,11370
-11377.
Pouli, A. E., Kennedy, H. J., Schofield, J. G. and Rutter, G. A. (1998). Insulin targeting to the regulated secretory pathway after fusion with green fluorescent protein and firefly luciferase. Biochem. J. 331,669 -675.
Ravichandran, V., Chawla, A. and Roche, P. A.
(1996). Identification of a novel syntaxin- and
synaptobrevin/VAMP-binding protein, SNAP-23, expressed in non-neuronal
tissues. J. Biol. Chem.
271,13300
-13303.
Resh, M. D. (1999). Fatty acylation of proteins: new insights into membrane targeting of myristoylated and palmitoylated proteins. Biochim. Biophys. Acta 1451, 1-16.[Medline]
Sadoul, K., Berger, A., Niemann, H., Weller, U., Roche, P. A.,
Klip, A., Trimble, W. S., Regazzi, R., Catsicas, S. and Halban, P. A.
(1997). SNAP-23 is not cleaved by botulinum neurotoxin E and can
replace SNAP- 25 in the process of insulin secretion. J. Biol.
Chem. 272,33023
-33027.
Sadoul, K., Lang, J., Montecucco, C., Weller, U., Regazzi, R.,
Catsicas, S., Wollheim, C. B. and Halban, P. A. (1995).
SNAP-25 is expressed in islets of Langerhans and is involved in insulin
release. J. Cell Biol.
128,1019
-1028.
Scales, S. J., Chen, Y. A., Yoo, B. Y., Patel, S. M., Doung, Y. C. and Scheller, R. H. (2000). SNAREs contribute to the specificity of membrane fusion. Neuron 26,457 -464.[Medline]
Sollner, T., Bennett, M. K., Whiteheart, S. W., Scheller, R. H. and Rothman, J. E. (1993). A protein assembly-disassembly pathway in vitro that may correspond to sequential steps of synaptic vesicle docking, activation, and fusion. Cell 75,409 -418.[Medline]
Sutton, R. B., Fasshauer, D., Jahn, R. and Brunger, A. T. (1998). Crystal structure of a SNARE complex involved in synaptic exocytosis at 2.4 A resolution. Nature 395,347 -353.[Medline]
Tanner, L. I. and Lienhard, G. E. (1989).
Localization of transferrin receptors and insulin-like growth factor.
J. Cell Biol. 108,1537
-1545.
Tooze, J., Hollinshead, M., Frank, R. and Burke, B.
(1987). An antibody specific for an endoproteolytic cleavage site
provides evidence that pro-opiomelanocortin is packaged into secretory
granules in AtT20 cells before its cleavage. J. Cell
Biol. 105,155
-162.
Veit, M., Sollner, T. H. and Rothman, J. E. (1996). Multiple palmitoylation of synaptotagmin and the t-SNARE SNAP-25. FEBS Lett. 385,119 -123.[Medline]
Veit, M., Becher, A. and Ahnert-Hilger, G. (2000). Synaptobrevin 2 is palmitoylated in synaptic vesicles prepared from adult, but not from embryonic brain. Mol. Cell Neurosci. 15,408 -416.[Medline]
Vogel, K., Cabaniols, J. P. and Roche, P. A.
(2000). Targeting of SNAP-25 to membranes is mediated by its
association with the target SNARE syntaxin. J. Biol.
Chem. 275,2959
-2965.
Vogel, K. and Roche, P. A. (1999). SNAP-23 and SNAP-25 are palmitoylated in vivo. Biochem. Biophys. Res. Commun. 258,407 -410.[Medline]
Walch-Solimena, C., Blasi, J., Edelmann, L., Chapman, E. R., von
Mollard, G. F. and Jahn, R. (1995). The t-SNAREs syntaxin 1
and SNAP-25 are present on organelles that participate in synaptic vesicle
recycling. J. Cell Biol.
128,637
-645.
Wang, G., Witkin, J. W., Hao, G., Bankaitis, V. A., Scherer, P. E. and Baldini, G. (1997). Syndet is a novel SNAP-25 related protein expressed in many tissues. J. Cell Sci. 110,505 -513.[Abstract]
Washbourne, P., Cansino, V., Mathews, J. R., Graham, M., Burgoyne, R. D. and Wilson, M. C. (2001). Cysteine residues of SNAP-25 are required for SNARE disassembly and exocytosis, but not for membrane targeting. Biochem. J. 357,625 -634.[Medline]
Washbourne, P., Pellizzari, R., Baldini, P., Wilson, M. C. and Montecucco, C. (1997). Botulinum neurotoxin types A and E require the SNARE motif in SNAP-25 for proteolysis. FEBS Lett. 418,1 -5.[Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
Related articles in JCS:
This article has been cited by other articles:
![]() |
G. Nagy, I. Milosevic, R. Mohrmann, K. Wiederhold, A. M. Walter, and J. B. Sorensen The SNAP-25 Linker as an Adaptation Toward Fast Exocytosis Mol. Biol. Cell, September 1, 2008; 19(9): 3769 - 3781. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Mohammad, G. Baldini, S. Granell, P. Narducci, A. M. Martelli, and G. Baldini Constitutive Traffic of Melanocortin-4 Receptor in Neuro2A Cells and Immortalized Hypothalamic Neurons J. Biol. Chem., February 16, 2007; 282(7): 4963 - 4974. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Holt, F. Varoqueaux, K. Wiederhold, S. Takamori, H. Urlaub, D. Fasshauer, and R. Jahn Identification of SNAP-47, a Novel Qbc-SNARE with Ubiquitous Expression J. Biol. Chem., June 23, 2006; 281(25): 17076 - 17083. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Reales, F. Mora-Lopez, V. Rivas, A. Garcia-Poley, J. A. Brieva, and A. Campos-Caro Identification of Soluble N-Ethylmaleimide-Sensitive Factor Attachment Protein Receptor Exocytotic Machinery in Human Plasma Cells: SNAP-23 Is Essential for Antibody Secretion J. Immunol., November 15, 2005; 175(10): 6686 - 6693. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Baldini, A. M. Martelli, G. Tabellini, C. Horn, K. Machaca, P. Narducci, and G. Baldini Rabphilin Localizes with the Cell Actin Cytoskeleton and Stimulates Association of Granules with F-actin Cross-linked by {alpha}-Actinin J. Biol. Chem., October 14, 2005; 280(41): 34974 - 34984. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Wiersma-Meems, J. Van Minnen, and N. I. Syed Synapse Formation and Plasticity: The Roles of Local Protein Synthesis Neuroscientist, June 1, 2005; 11(3): 228 - 237. [Abstract] [PDF] |
||||
![]() |
C. Salaun, G. W. Gould, and L. H. Chamberlain Lipid Raft Association of SNARE Proteins Regulates Exocytosis in PC12 Cells J. Biol. Chem., May 20, 2005; 280(20): 19449 - 19453. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Dong, W. H. Tepp, E. A. Johnson, and E. R. Chapman Using fluorescent sensors to detect botulinum neurotoxin activity in vitro and in living cells PNAS, October 12, 2004; 101(41): 14701 - 14706. [Abstract] [Full Text] [PDF] |
||||
![]() |
N.-J. Xu, Y.-X. Yu, J.-M. Zhu, H. Liu, L. Shen, R. Zeng, X. Zhang, and G. Pei Inhibition of SNAP-25 Phosphorylation at Ser187 Is Involved in Chronic Morphine-induced Down-regulation of SNARE Complex Formation J. Biol. Chem., September 24, 2004; 279(39): 40601 - 40608. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Chieregatti, M. C. Chicka, E. R. Chapman, and G. Baldini SNAP-23 Functions in Docking/Fusion of Granules at Low Ca2+ Mol. Biol. Cell, April 1, 2004; 15(4): 1918 - 1930. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. G. Duman and J. G. Forte What is the role of SNARE proteins in membrane fusion? Am J Physiol Cell Physiol, August 1, 2003; 285(2): C237 - C249. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Pallavi and R. Nagaraj Palmitoylated Peptides from the Cysteine-rich Domain of SNAP-23 Cause Membrane Fusion Depending on Peptide Length, Position of Cysteines, and Extent of Palmitoylation J. Biol. Chem., April 4, 2003; 278(15): 12737 - 12744. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||