|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
Research Article |
Institute of Comparative Medicine, University of Glasgow Veterinary School, Bearsden Rd, Glasgow G61 1QH, UK
* Author for correspondence (e-mail: p.j.o'shaughnessy{at}vet.gla.ac.uk)
Accepted 17 June 2002
| Summary |
|---|
|
|
|---|
Key words: Androgen-receptor, Testis, Leydig cell, Development, Gene expression, Cell number, Puberty
| Introduction |
|---|
|
|
|---|
-hydroxylase and 17-ketosteroid reductase
enzyme activity in Leydig cells of the adult animal
(Murphy and O'Shaughnessy,
1991| Materials and Methods |
|---|
|
|
|---|
Reverse transcription and real-time PCR
For quantification of the content of specific mRNA species in testes during
development, a real-time PCR approach was used that utilised the TaqMan PCR
method following reverse transcription of the isolated RNA
(Bustin, 2000
). To allow
specific mRNA levels to be expressed per testis and to control for the
efficiency of RNA extraction, RNA degradation and the reverse transcription
step, an external standard was used (Baker
and O'Shaughnessy, 2001a
). The external standard was luciferase
mRNA (Promega UK, Southampton, UK), and 5 ng was added to each testis at the
start of the RNA extraction procedure. Testis RNA was extracted using Trizol
(Life Technologies, Paisley, UK), and residual genomic DNA was removed by
DNAse treatment (DNA-free, Ambion Inc, supplied by AMS biotechnology, UK). The
RNA was reverse transcribed using random hexamers and Moloney murine leukemia
virus reverse transcriptase (Superscript II, Life Technologies, UK) as
described previously (O'Shaughnessy and
Murphy, 1993
; O'Shaughnessy et
al., 1994
).
With the exception of renin 1 (Ren 1), primers and probes for use in the
TaqMan method have been described previously
(O'Shaughnessy et al., 2002
).
The primers used to amplify Ren1 had sequences CCGAGCTGCCCCTGATC and
GGGAAAGCCCATGCCTAGAA, whereas the probe had sequence
CTTTCATGCTGGCCAAGTTTGACGG; these were all based on GenBank sequence NM_031192.
The real-time PCRs were carried out in a 25 µl volume using a 96-well plate
format. Components for real-time PCR were purchased from Applied Biosystems
(Warrington, UK) apart from the primers and probes, which came from MWG
Biotech (Milton Keynes, UK). Each PCR well contained reaction buffer (with
passive reference), 5 mM MgCl2, 200 µM dNTPs, 300 nM each
primer, 200 nM probe and 0.02 U/µl enzyme (Amplitaq Gold). Reactions were
carried out and fluorescence detected on a GeneAmp 5700 system (Applied
Biosystems, Warrington, Cheshire, UK). For each sample a replicate was run
omitting the reverse transcription step, and a template negative control was
run for each primer-probe combination. The quantity of each measured cDNA was
then expressed relative to the internal standard luciferase cDNA in the same
sample. This method allows direct comparison of expression levels per testis
between different samples (Baker and
O'Shaughnessy, 2001a
).
Enzyme activity
The activity of 5
-reductase activity in testes of normal and AR-null
mice was measured by determining the conversion of a saturating concentration
of tritiated substrate (testosterone) by homogenates of whole testes
(O'Shaughnessy, 1991
).
Substrate and product were separated by thin layer chromatography, and enzyme
activity was expressed as pmol/minute/testis.
Stereology
Testes were embedded in Technovit 7100 resin, cut into sections (20 µm
thickness) and stained with Harris' haematoxylin. Total testis volume was
estimated using the Cavalieri principle
(Mayhew, 1992
), and the slides
used to count the number of cells were also used to measure testis volume. The
optical disector technique (Wreford,
1995
) was used to count the number of Leydig cells in each testis.
The numerical density of Leydig cells was estimated using an Olympus BX50
microscope fitted with a motorized stage (Prior Scientific Instruments,
Cambridge, UK) and Stereologer software (Systems Planning Analysis,
Alexandria, VA, USA).
Statistics
Results were analysed by analysis of variance. Differences between AR-null
animals and the appropriate control group at each age (normal animals when
aged 5 and 20 days and cryptorchid animals when adult) were assessed by
t-tests using the pooled variance. Differences between adult normal,
cryptorchid and AR-null animals were determined using analysis of variance
followed by the Neuman-Keul test. Where heterogeneity of variance occurred
values were log-transformed before analysis.
| Results |
|---|
|
|
|---|
|
|
Expression of Leydig-cell-specific mRNA species
Genes expressed at a normal or increased level in AR-null
animals
Of the 14 Leydig-cell-specific mRNA species measured in this study, six
[3ß-hydroxysteroid dehydrogenase type I (3ßHSD I), cytochrome P450
side chain cleavage (P450scc), luteinising hormone receptor (LH-R),
steroidogenic acute regulatory (StAR) protein, thrombospondin 2 (TSP-2) and
Ren 1] showed normal or increased levels of expression in AR-null mice
(Fig. 3A). Expression levels in
this group were all normal on days 5 and 20 in AR-null mice apart from
P450scc, which showed a small but significant increase in expression on day 5.
In the adult animal, levels of mRNA encoding StAR protein and LH-receptor were
normal in AR-null mice, but levels of the other three mRNA species (3ßHSD
I, P450scc and Ren 1) were all increased relative to cryptorchid controls.
Cryptochidism per se reduced expression of 3ßHSD I and P450scc, but had
no significant effect on Ren1, StAR protein and LH-R mRNA levels.
|
Genes with a reduced level of expression in AR-null mice
Nine of the fifteen mRNA species measured showed a reduced level of
expression in adult testes of AR-null mice. Three of these mRNA species
[17ß-hydroxysteroid dehydrogenase type III (17ßHSD III),
prostaglandin D (PGD)-synthetase and 3ß-hydroxysteroid dehydrogenase type
VI (3ßHSD VI)] were barely detectable in the adult AR-null testis
(Fig. 3B), whereas the other
six mRNA species [relaxin-like factor (RLF), glutathione S-transferase 5-5
(GST5-5), cytochrome P450 17
-hydroxylase (P450c17), epoxide hydrolase
(EH), 5
-reductase type I and estrogen sulfotransferase (EST)] showed a
significant reduction in expression relative to the cryptorchid controls
(Fig. 3C). With one exception
(17ßHSD III), expression of all mRNA species was normal on day 5 in
AR-null mice, and all were reduced on day 20 apart from GST5-5. The overall
pattern of expression, therefore, is one of normal mRNA expression levels on
day 5 in AR-null mice but with reduced expression on day 20 and a relatively
more marked reduction in expression in the adult animal. Cryptorchidism
reduced expression in five of the eight mRNA species, with a marked effect on
the expression of EST.
5
-reductase enzyme activity
Changes in 5
-reductase enzyme activity during development in normal
and AR-null mice are shown in Fig.
4. In normal animals, there was a pubertal peak of activity around
day 25 followed by a decline in the adult animal. In the AR-null mouse, levels
of 5
-reductase activity were generally lower than in normal animals but
there was a similar developmental pattern of enzyme activity. There was no
apparent effect of cryptorchidism on testicular 5
-reductase
activity.
|
| Discussion |
|---|
|
|
|---|
The fetal Leydig cell population is responsible for masculinisation of the
fetus during development in utero. In studies reported here, Leydig cell
function was normal in AR-null mice on day 5, indicating that fetal Leydig
cell development and function is not dependent on androgens. In mice the fetal
Leydig cell population persists after birth but becomes subordinate to the
adult population, which begins to differentiate sometime between days seven
and 10 after birth (Vergouwen et al.,
1991
; Baker et al.,
1999
; Nef et al.,
2000
). The stimulus leading to adult Leydig cell differentiation
around day 10 is not clear, but in the absence of desert hedgehog (Dhh) or
platelet-derived growth factor (PDGF)-A the adult Leydig cell population fails
to develop, indicating a role for these growth factors in this process
(Clark et al., 2000
;
Gnessi et al., 2000
). Once
differentiation has started, development of the adult Leydig cell population
is critically dependent on LH
(O'Shaughnessy, 1991
;
Zhang et al., 2001
;
Baker and O'Shaughnessy,
2001b
), but the highly abnormal pattern of Leydig cell gene
expression in AR-null mice reported here shows that androgens are also
required for this process. From the data reported, two alternative hypotheses
can be advanced to explain the role of androgens in post-natal Leydig cell
development. Firstly, androgens may be required for maturation and maintenance
of the adult Leydig cell population; alternatively, in the absence of
androgens, the adult Leydig cell population may fail to differentiate and
Leydig cells present in adult AR-null mice may be derived predominantly from
the fetal population.
In some respects the evidence available fits the second hypothesis more
clearly. Of the 14 mRNA species measured in this study, four (17ßHSD III,
PGD-synthetase, 3ßHSD VI and EST) are expressed only in the adult Leydig
cell population and not in the fetal cell population and could, therefore, act
as markers for adult Leydig cell differentiation
(O'Shaughnessy et al., 2002
).
In the AR-null mice all four of these mRNA species showed barely detectable
expression in the adult testis. Whereas this may be linked to the inherent
cryptorchidism of the animals as far as EST is concerned, failure of
17ßHSD III, PGD-synthetase and 3ßHSD VI expression would be
consistent with failure of adult Leydig cell differentiation. Other
observations would be consistent with a predominance of fetal Leydig cells in
the adult AR-null testes. For example, RLF mRNA levels are reduced in fetal
Leydig cells (Balvers et al.,
1998
; O'Shaughnessy et al.,
2002
), and renin levels are increased
(Perera et al., 2001
). In
addition, LH levels are increased in adult AR-null mice
(Scott et al., 1992
;
Murphy et al., 1994
), and
normal expression of LH-receptor mRNA in the presence of increased circulating
LH is consistent with the presence of fetal-type Leydig cells
(Pakarinen et al., 1990
;
Pakarinen et al., 1994
).
There are, however, a number of observations that would run contrary to
this hypothesis. Firstly, expression and activity of the 5
-reductase
enzyme and 5
-reductase type 1 gene shows a characteristic peak
in adult Leydig cells around puberty in rodents
(Ficher and Steinberger, 1971
;
Rosness et al., 1977
;
Viger and Robaire, 1995
). In
this study, a similar peak of activity and expression was seen in AR-null
mice, although levels were lower than normal. Secondly, the expression pattern
of TSP-2 during development in normal mice is consistent with predominant
expression in the fetal population
(O'Shaughnessy et al., 2002
),
but overall expression in the adult AR-null mouse testis was no different from
control animals. Thirdly, in transgenic mice in which the adult Leydig cell
population fails to develop (Dhh-null and PDGF-A-null animals), the fetal
Leydig cells do not proliferate and populate the adult interstitial tissue,
which is left largely devoid of Leydig cells
(Clark et al., 2000
;
Gnessi et al., 2000
). This
suggests that, even in the absence of adult Leydig cells, the fetal population
is unable to proliferate post-natally, although it is possible, of course,
that this is affected by the absence of Dhh or PDGF. Lastly, whereas levels of
mRNA encoding 3ßHSD VI, PGD-synthetase, 17ßHSD III and EST are
extremely low in the adult AR-null mouse, they are not undetectable,
particularly in the case of EST. In addition, taking into account changes in
Leydig cell number, the expression of 3ßHSD VI on day 20 is about 7% of
normal (as opposed to 0.15% of normal in the adult), showing that there is
initial differentiation that is not maintained.
The data, therefore, fit more closely with the hypothesis that adult Leydig
cell differentiation occurs in the AR-null mouse except that there is a
failure of cell development. Morphological and functional development of the
adult Leydig cell lineage has recently been reviewed
(Mendis-Handagama and Ariyaratne,
2001
). Leydig cell precursor cells are found in the peritubular
region and possibly around the vessels of the interstitium and differentiate
initially to progenitor cells in the same region. Further development to
`newly formed' and `immature' adult Leydig cells is associated with
development of the typical Leydig cell morphology and movement of the cells to
the central interstitial region
(Mendis-Handagama and Ariyaratne,
2001
). In an earlier developmental study of adult Leydig cell gene
expression, we showed that EST, PGD-synthetase and 17ßHSD III were
expressed relatively late in Leydig cell development
(O'Shaughnessy et al., 2002
),
which would be consistent with a failure of cell maturation in AR-null mice.
This would not be consistent, however, with failure of 3ßHSD VI
expression, which starts early in adult Leydig cell development
(O'Shaughnessy et al., 2002
).
It appears likely, therefore, that in the absence of androgen action, adult
Leydig cells will differentiate but fail to develop the characteristics of the
adult cells. Most of the mRNA species that are expressed normally in the
Leydig cells of the adult AR-null mouse are fundamental to Leydig cell
function (e.g. StAR protein, LH-R, P450scc and 3ßHSD I) but are not
specific to the adult population of cells. It is likely, therefore, that these
mRNA species are either constitutively expressed in the Leydig cells [e.g.
3ßHSD (O'Shaughnessy,
1991
)] or are under the control of LH alone [e.g. P450scc
(O'Shaughnessy, 1991
)]. This
correlates with morphological studies in AR-null mice, which have shown that
Leydig cells in these animals lack the characteristic growth in smooth ER and
surface specialisations associated with adult Leydig cell development
(Russo and De Rosas, 1971
;
Blackburn et al., 1973
).
During normal testis development, adult Leydig cells first appear shortly
before day 10, and there is a marked, LH-dependent, increase in adult Leydig
cell number between days 10 and 20 (Baker
and O'Shaughnessy, 2001b
). This is followed by a further increase
between day 20 and adulthood, which establishes the normal adult cohort of
cells. In AR-null mice, Leydig cell number was normal on day 5, showing that
establishment of the fetal Leydig cell number is not androgen dependent. The
normal pre-pubertal rise in Leydig cell number was significantly attenuated,
however, in AR-null mice, showing that this process is partially androgen
dependent. After day 20, Leydig cell number increased by a similar number in
both normal and AR-null mice, indicating that only the early part of the
developmental process, which establishes Leydig cell number, is androgen
dependent. Results from this study also highlight the importance of measuring
Leydig cell number directly rather than inferring changes from apparent
interstitial hyperplasia, which can arise simply through shrinkage of the
seminiferous tubules.
Although it is clear from results reported here and from other studies that
androgens are required for normal adult Leydig cell development, the
mechanisms by which androgens regulate this process are uncertain. There has
been limited study of androgen-receptor distribution in the mouse testis
during development. Zhou et al. have reported immunohistochemical localisation
of the androgen receptor only in Sertoli cells, myoid cells and germ cells of
the mouse testis two weeks after birth with immunoreactivity present in the
Leydig cells after three weeks (Zhou et
al., 1996
). This suggests that newly formed adult Leydig cells
lack androgen receptors and that the effects of androgens on early Leydig cell
differentiation and development are mediated through the myoid cells or
Sertoli cells. Later effects on Leydig cell function and development may be
mediated directly through receptors on the cells themselves or may continue to
be mediated through other cells in the testis. In cultured mouse Leydig cells,
androgens acting through the androgen receptor inhibit the synthesis of the
P450c17 enzyme (Hales et al.,
1987
). This direct effect of androgens is opposite to what is seen
in the AR-null mouse and suggests that at least some of the effects of the
AR-null mutation in the adult are mediated through another cell type.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Ariyaratne, H. B., Mendis-Handagama, S. M., Hales, D. B. and
Mason, J. I. (2000). Studies of the onset of Leydig precursor
cell differentiation in the prepubertal rat testis. Biol.
Reprod. 63,165
-171.
Baker, P. J. and O'Shaughnessy, P. J. (2001a). Expression of prostaglandin D synthetase during development in the mouse testis. Reproduction 122,553 -559.[Abstract]
Baker, P. J. and O'Shaughnessy, P. J. (2001b). Role of gonadotrophins in regulating numbers of Leydig and Sertoli cells during fetal and postnatal development in mice. Reproduction 122,227 -234.[Abstract]
Baker, P. J., Sha, J. A., McBride, M. W., Peng, L., Payne, A. H. and O'Shaughnessy, P. J. (1999). Expression of 3ß-hydroxysteriod dehydrogenase type I and VI isoforms in the mouse testis during development. Eur. J. Biochem. 260,911 -916.[Medline]
Balvers, M., Spiess, A. N., Domagalski, R., Hunt, N., Kilic, E.,
Mukhopadhyay, A. K., Hanks, E., Charlton, H. M. and Ivell, R.
(1998). Relaxin-like factor expression as a marker of
differentiation in the mouse testis and ovary.
Endocrinology 139,2960
-2970.
Blackburn, W. R., Chung, K. W., Bullock, L. and Bardin, C. W. (1973). Testicular feminization in the mouse: studies of Leydig cell structure and function. Biol. Reprod. 9, 9-23.[Abstract]
Bustin, S. A. (2000). Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol. 25,169 -193.[Abstract]
Clark, A. M., Garland, K. K. and Russell, L. D.
(2000). Desert hedgehog (Dhh) gene is required
in the mouse testis for formation of adult-type Leydig cells and normal
development of peritubular cells and seminiferous tubules. Biol.
Reprod. 63,1825
-1838.
Ficher, M. and Steinberger, E. (1971). In vitro
progesterone metabolism by rat testicular tissue at different stages of
development. Acta Endocrinol. (Copenh)
68,285
-292.
Gnessi, L., Basciani, S., Mariani, S., Arizzi, M., Spera, G.,
Wang, C., Bondjers, C., Karlsson, L. and Betsholtz, C.
(2000). Leydig cell loss and spermatogenic arrest in
platelet-derived growth factor (PDGF)-A-deficient mice. J. Cell
Biol. 149,1019
-1026.
Hales, D. B., Sha, L. L. and Payne, A. H.
(1987). Testosterone inhibits cAMP-induced de Novo synthesis of
Leydig cell cytochrome P-450(17 alpha) by an androgen receptor-mediated
mechanism. J. Biol. Chem.
262,11200
-11206.
Mayhew, T. M. (1992). A review of recent advances in stereology for quantifying neural structure. J. Neurocytol. 21,313 -328.[Medline]
Mendis-Handagama, S. M. and Ariyaratne, H. B.
(2001). Differentiation of the adult Leydig cell population in
the postnatal testis. Biol. Reprod.
65,660
-671.
Murphy, L. and O'Shaughnessy, P. J. (1991).
Testicular steroidogenesis in the testicular feminized (Tfm) mouse: loss of
17
-hydroxylase activity. J. Endocrinol.
131,443
-449.
Murphy, L., Jeffcoate, I. A. and O'Shaughnessy, P. J. (1994). Abnormal Leydig cell development at puberty in the androgen-resistant Tfm mouse. Endocrinology 135,1372 -1377.[Abstract]
Nef, S., Shipman, T. and Parada, L. F. (2000). A molecular basis for estrogen-induced cryptorchidism. Dev. Biol. 224,354 -361.[Medline]
O'Shaughnessy, P. J. (1991). Steroidogenic enzyme-activity in the hypogonadal (hpg) mouse testis and effect of treatment with luteinizing-hormone. J. Steroid Biochem. Mol. Biol. 39,921 -928.[Medline]
O'Shaughnessy, P. J., Baker, P., Sohnius, U., Haavisto, A.-M.,
Charlton, H. M. and Huhtaniemi, I. (1998). Fetal development
of Leydig cell activity in the mouse in independent of pituitary gonadotroph
function. Endocrinology
139,1141
-1146.
O'Shaughnessy, P. J., Marsh, P. and Dudley, K. (1994). Follicle-stimulating hormone receptor mRNA in the mouse ovary during post-natal development in the normal mouse and in the adult hypogonadal (hpg) mouse: structure of alternate transcripts. Mol. Cell Endocrinol. 101,197 -201.[Medline]
O'Shaughnessy, P. J. and Murphy, L. (1993).
Cytochrome P-450 17
-hydroxylase protein and mRNA in the testis of the
testicular feminized (Tfm) mouse. J. Mol.
Endocrinol. 11,77
-82.
O'Shaughnessy, P. J., Willerton, L. and Baker, P. J.
(2002). Changes in Leydig cell gene expression during development
in the mouse. Biol. Reprod.
66,966
-975.
Pakarinen, P., Vihko, K. K., Voutilainen, R. and Huhtaniemi,
I. (1990). Differential response of luteinizing-hormone
receptor and steroidogenic enzyme gene-expression to human
chorionic-gonadotropin stimulation in the neonatal and adult-rat testis.
Endocrinology 127,2469
-2474.
Pakarinen, P., Niemimaa, T., Huhtaniemi, I. T. and Warren, D. W. (1994). Transcriptional and translational regulation of LH, prolactin and their testicular receptors by hCG and bromocriptine treatments in adult and neonatal rats. Mol. Cell Endocrinol. 101,37 -47.[Medline]
Perera, E. M., Martin, H., Seeherunvong, T., Kos, L., Hughes, I.
A., Hawkins, J. R. and Berkovitz, G. D. (2001). Tescalcin, a
novel gene encoding a putative EF-hand Ca(2+)-binding protein, Col9a3, and
renin are expressed in the mouse testis during the early stages of gonadal
differentiation. Endocrinology
142,455
-463.
Rosness, P. A., Sunde, A. and Eik-Nes, K. B. (1977). Production and effects of 7 alpha-hydroxytestosterone on testosterone and dihydrotestosterone metabolism in rat testis. Biochim. Biophys. Acta 488, 55-68.[Medline]
Russo, J. and de Rosas, J. C. (1971). Differentiation of the Leydig cell of the mouse testis during the fetal periodan ultrastructural study. Am. J. Anat. 130,461 -480.[Medline]
Scott, I. S., Bennett, M. K., PorterGoff, A. E., Harrison, C.
J., Cox, B. S., Grocock, C. A., O'Shaughnessy, P. J., Clayton, R. N., Craven,
R., Furr, B. J. A. and Charlton, H. M. (1992). Effects of the
gonadotrophin-releasing hormone agonist `Zoladex' upon pituitary and gonadal
function in hypogonadal (hpg) male mice: A comparison with normal male and
testicular feminized (tfm) mice. J. Mol. Endocrinol.
8, 249-258.
Vergouwen, R. P., Jacobs, S. G., Huiskamp, R., Davids, J. A. and
de Rooij, D. G. (1991). Proliferative activity of gonocytes,
sertoli cells and interstitial cells during testicular development in mice.
J. Reprod. Fertil. 93,233
-243.
Viger, R. S. and Robaire, B. (1995). Steady
state steroid 5
-reductase messenger ribonucleic acid levels and
immunocytochemical localization of the type 1 protein in the rat testis during
postnatal development. Endocrinology
136,5409
-5415.[Abstract]
Wreford, N. G. (1995). Theory and practice of stereological techniques applied to the estimation of cell number and nuclear volume of the testis. Microsc. Res. Tech. 32,423 -436.[Medline]
Zhang, F.-P., Poutanen, M., Wilbertz, J. and Huhtaniemi, I.
(2001). Normal prenatal but arrested postnatal sexual development
of luteinizing hormone receptor knockout (LuRKO) mice. Mol.
Endocrinol. 15,172
-183.
Zhou, X., Kudo, A., Kawakami, H. and Hirano, H. (1996). Immunohistochemical localization of androgen receptor in mouse testicular germ cells during fetal and postnatal development. Anat. Rec. 245,509 -518.[Medline]
This article has been cited by other articles:
![]() |
K.A. Walters, U. Simanainen, and D.J. Handelsman Molecular insights into androgen actions in male and female reproductive function from androgen receptor knockout models Hum. Reprod. Update, March 15, 2010; (2010) dmq003v1. [Abstract] [Full Text] [PDF] |
||||
![]() |
P J O'Shaughnessy, A Monteiro, G Verhoeven, K De Gendt, and M H Abel Effect of FSH on testicular morphology and spermatogenesis in gonadotrophin-deficient hypogonadal mice lacking androgen receptors Reproduction, January 1, 2010; 139(1): 177 - 184. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Strauss, J. Kallio, N. Desai, P. Pakarinen, T. Miettinen, H. Gylling, M. Albrecht, S. Makela, A. Mayerhofer, and M. Poutanen Increased Exposure to Estrogens Disturbs Maturation, Steroidogenesis, and Cholesterol Homeostasis via Estrogen Receptor {alpha} in Adult Mouse Leydig Cells Endocrinology, June 1, 2009; 150(6): 2865 - 2872. [Abstract] [Full Text] [PDF] |
||||
![]() |
R.-S. Wang, S. Yeh, C.-R. Tzeng, and C. Chang Androgen Receptor Roles in Spermatogenesis and Fertility: Lessons from Testicular Cell-Specific Androgen Receptor Knockout Mice Endocr. Rev., April 1, 2009; 30(2): 119 - 132. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Lague and J. J. Tremblay Antagonistic Effects of Testosterone and the Endocrine Disruptor Mono-(2-Ethylhexyl) Phthalate on INSL3 Transcription in Leydig Cells Endocrinology, September 1, 2008; 149(9): 4688 - 4694. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Eacker, N. Agrawal, K. Qian, H. L. Dichek, E.-Y. Gong, K. Lee, and R. E. Braun Hormonal Regulation of Testicular Steroid and Cholesterol Homeostasis Mol. Endocrinol., March 1, 2008; 22(3): 623 - 635. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M. Eacker, J. E. Shima, C. M. Connolly, M. Sharma, R. W. Holdcraft, M. D. Griswold, and R. E. Braun Transcriptional Profiling of Androgen Receptor (AR) Mutants Suggests Instructive and Permissive Roles of AR Signaling in Germ Cell Development Mol. Endocrinol., April 1, 2007; 21(4): 895 - 907. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Merlet, C. Racine, E. Moreau, S. G. Moreno, and R. Habert Male fetal germ cells are targets for androgens that physiologically inhibit their proliferation PNAS, February 27, 2007; 104(9): 3615 - 3620. [Abstract] [Full Text] [PDF] |
||||
![]() |
M.-Y. Tsai, S.-D. Yeh, R.-S. Wang, S. Yeh, C. Zhang, H.-Y. Lin, C.-R. Tzeng, and C. Chang Differential effects of spermatogenesis and fertility in mice lacking androgen receptor in individual testis cells PNAS, December 12, 2006; 103(50): 18975 - 18980. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Ichihara, F. Suzuki, T. Nakagawa, Y. Kaneshiro, T. Takemitsu, M. Sakoda, A.H.M. N. Nabi, A. Nishiyama, T. Sugaya, M. Hayashi, et al. Prorenin Receptor Blockade Inhibits Development of Glomerulosclerosis in Diabetic Angiotensin II Type 1a Receptor-Deficient Mice J. Am. Soc. Nephrol., July 1, 2006; 17(7): 1950 - 1961. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. A. Albertelli, A. Scheller, M. Brogley, and D. M. Robins Replacing the Mouse Androgen Receptor with Human Alleles Demonstrates Glutamine Tract Length-Dependent Effects on Physiology and Tumorigenesis in Mice Mol. Endocrinol., June 1, 2006; 20(6): 1248 - 1260. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. F. M. Mikkila, J. Toppari, and J. Paranko Effects of Neonatal Exposure to 4-Tert-Octylphenol, Diethylstilbestrol, and Flutamide on Steroidogenesis in Infantile Rat Testis Toxicol. Sci., June 1, 2006; 91(2): 456 - 466. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Yu, N. Dadgar, M. Albertelli, A. Scheller, R. L. Albin, D. M. Robins, and A. P. Lieberman Abnormalities of Germ Cell Maturation and Sertoli Cell Cytoskeleton in Androgen Receptor 113 CAG Knock-In Mice Reveal Toxic Effects of the Mutant Protein Am. J. Pathol., January 1, 2006; 168(1): 195 - 204. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. De Gendt, N. Atanassova, K. A. L. Tan, L. R. de Franca, G. G. Parreira, C. McKinnell, R. M. Sharpe, P. T. K. Saunders, J. I. Mason, S. Hartung, et al. Development and Function of the Adult Generation of Leydig Cells in Mice with Sertoli Cell-Selective or Total Ablation of the Androgen Receptor Endocrinology, September 1, 2005; 146(9): 4117 - 4126. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Delbes, C. Levacher, C. Duquenne, C. Racine, P. Pakarinen, and R. Habert Endogenous Estrogens Inhibit Mouse Fetal Leydig Cell Development via Estrogen Receptor {alpha} Endocrinology, May 1, 2005; 146(5): 2454 - 2461. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Zhou, J. E. Shima, R. Nie, P. J. Friel, and M. D. Griswold Androgen-Regulated Transcripts in the Neonatal Mouse Testis as Determined Through Microarray Analysis Biol Reprod, April 1, 2005; 72(4): 1010 - 1019. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Johnston, P. J. Baker, M. Abel, H. M. Charlton, G. Jackson, L. Fleming, T. R. Kumar, and P. J. O'Shaughnessy Regulation of Sertoli Cell Number and Activity by Follicle-Stimulating Hormone and Androgen during Postnatal Development in the Mouse Endocrinology, January 1, 2004; 145(1): 318 - 329. [Abstract] [Full Text] [PDF] |
||||
![]() |
G.-M. Wang, P. J. O'Shaughnessy, C. Chubb, B. Robaire, and M. P. Hardy Effects of Insulin-Like Growth Factor I on Steroidogenic Enzyme Expression Levels in Mouse Leydig Cells Endocrinology, November 1, 2003; 144(11): 5058 - 5064. [Abstract] [Full Text] [PDF] |
||||
![]() |
P.J. O'Shaughnessy, L. Fleming, P.J. Baker, G. Jackson, and H. Johnston Identification of Developmentally Regulated Genes in the Somatic Cells of the Mouse Testis Using Serial Analysis of Gene Expression Biol Reprod, September 1, 2003; 69(3): 797 - 808. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Rothschild, C. M. Sottas, H. Kissel, V. Agosti, K. Manova, M. P. Hardy, and P. Besmer A Role for Kit Receptor Signaling in Leydig Cell Steroidogenesis Biol Reprod, September 1, 2003; 69(3): 925 - 932. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||