|
|
![]() |
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
doi: 10.1242/10.1242/jcs.00048
Research Article |

School of Biosciences, The University of Birmingham, Birmingham B15 2TT, UK
Author for correspondence (e-mail:
F.C.H.Franklin{at}bham.ac.uk)
Accepted 8 July 2002
| Summary |
|---|
|
|
|---|
Key words: Arabidopsis, Brassica, Meiosis, Synapsis, Synaptonemal complex
| Introduction |
|---|
|
|
|---|
Despite a range of proposals, the real function of the SC is as yet unresolved. Nevertheless its ubiquitous occurrence, its remarkable evolutionary structural conservation and its temporal and spatial association with chromosome synapsis and at least some events of homologous recombination highlight the central importance of the SC in the meiotic process. One approach to dissecting its function (or functions) is to analyze the composition and interactions of SC proteins, and also SC-associated proteins, and to investigate the structure and regulation of the genes that encode them. Another important goal is to understand how these proteins interact with DNA and chromatin.
In recent years studies in yeast, and mammals in particular, have produced
considerable progress in the identification of genes encoding SC and
SC-associated proteins (reviewed in
Heyting, 1996
;
Roeder, 1997
;
Zickler and Kleckner, 1999
).
However in the case of higher plants, little progress has been made towards
identification of SC genes. A major barrier is that despite the availability
of the Arabidopsis thaliana genome sequence and the apparent
structural conservation of the SC, the SC proteins themselves and those
associated with them exhibit a high degree of sequence divergence. For example
Zip1 from yeast and Scp1 from rats are structurally similar transverse
filament proteins, yet they exhibit no sequence homology other than that
expected for two coiled-coil proteins
(Heyting, 1996
). We have
therefore used a different route to identify candidate genes encoding SC
proteins. Arabidopsis T-DNA insertion lines were screened for lines
exhibiting reduced fertility. Meiotic mutants were then confirmed by
cytological analysis of pollen mother cells
(Ross et al.,
1997
,Ross et al.,
1997
). One such mutant, asy1, exhibits an asynaptic
phenotype and dramatically reduced chiasma formation. Subsequently the
ASY1 gene was cloned and found to encode a 596 amino-acid polypeptide
with some similarity to the N-terminus of the yeast axial core-associated
protein Hop1 (Caryl et al.,
2000
). The two proteins exhibit 28% identity and 51% similarity
over the first 250 amino acids. This corresponds to a HORMA domain
(Hop1, Rev7 and MAD2)
(Aravind and Koonin, 1998
), a
sequence that is found in a number of proteins that interact with chromatin,
including Him-3, a Caenorhabditis elegans protein that also encodes a
component of the meiotic chromosome core
(Zetka et al., 1999
).
In this study we have used an antibody raised against recombinant Asy1 to
carry out a detailed analysis of spatial and temporal expression of Asy1
throughout meiosis. These studies have been carried out in both the model
plant species Arabidopsis and the related species Brassica
oleracea, which is not only an important corp but is technically more
amenable to detailed cytological analyses
(Armstrong et al., 1998
). This
has enabled us to establish that ASY1 encodes a protein that
interacts with chromatin associated with the chromosome axes. We also explore
the extent to which the predicted HORMA domain in Asy1 is indicative of a
functional similarity with other meiotic genes known to possess this
structural feature.
| Materials and Methods |
|---|
|
|
|---|
Nucleic acid isolation
Genomic DNA was isolated using the Nucleon Phytopure (Amersham Pharmacia
Biotech). Total RNA was isolated using the Rneasy Plant Mini Kit (Qiagen).
Nucleic acid hybridization
Capillary blotting was used to transfer 5 µg of digested genomic DNA
onto Hybond N+ membrane (Amersham Pharmacia Biotech) and fixed by baking at
80°C for 2 hours. Southern blots were hybridized using Rapid-hyb (Amersham
Pharmacia Biotech) and probed with radiolabelled DNA
(Feinberg and Vogelstein,
1983
; Feinberg and Vogelstein,
1984
). The blots were then washed at high stringency (0.2x
SSC, 0.1% SDS 65°C). Radioactivity was detected by autoradiography. The
probe used was the 2145 by Asy1 cDNA (GenBank accession AF157576) minus the
first 61 bp.
PCR and RT-PCR analysis
The Omniscript RT kit (Qiagen) was used to synthesize cDNA from B.
oleracea meiotic bud RNA using an Oligo-dT(16) primer. Cloned
Pfu DNA polymerase (Stratagene) was then used to amplify part of the
BoASY1 gene using primers FP2 and R1 (designed to the Arabidopsis
ASY1 gene). The PCR products were cloned into the pZErO-2 vector
(Invitrogen) and sequenced. This sequence data was used to design
BoASY1-specific primers for RACE PCR. The cDNA for the RACE PCR was
prepared using Superscript II reverse transcriptase (Invitrogen), and the PCR
amplifications were carried out with Super Taq DNA polymerase (HT
Biotechnology Ltd). 5' RACE was carried out using AUAP (Life
Technologies) with BoASY1-pecific nested primers R2 and R3. The cDNA
was tailed with dCTP using Terminal Transferase (Roche). The 3' RACE
used R4 together with BoASY1 specific nested primers F2 and F3. PCR
products were cloned into the pCR2.1 vector (Invitrogen) and sequenced.
FP2: ATGGCTCAGAAGCTGAAGG;
R1: GCGGCCGCTCAATTAGCTTGAGATTTCTG;
R2: CATGTTGTGAAGCTTTGT;
R3: TTCACCCTTTCTAGCTG; AUAP: GGCCACGCGTCGACTAGTAC;
R4: CATCTCGAGCGGCGGCTTTTTTTTTTTTTTTTTTTTTTTT;
F2: CTTTTCTGACTTCATTTAGCTT; F3 CTGACAGCCAAGATGTCATG.
Nucleic acid sequencing
Nucleic acid sequencing was carried out using the BigDye Terminator
Sequencing v2.0 Ready Reaction kit (PE Biosystems). Sequencing reactions were
run out on an ABI 3700 DNA analyzer by the Functional Genomics Unit,
University of Birmingham, UK.
Antibody production
The coding region of the Arabidopsis ASY1 gene was cloned into the
protein expression vector pGEX-6P-1 (Amersham Pharmacia Biotech) as an
N-terminal fusion to glutathione S-transferase. Upon induction, the GST-Asy1
fusion protein accumulated as insoluble inclusion bodies in E. coli
SK1592. Purified, refolded recombinant protein was prepared as described
previously (Kakeda et al.,
1998
). Rabbit polyclonal antiserum was produced against the
GST-Asy1 fusion protein (ISL, Poole, UK). The antibody was found to be
specific for the Asy1 component of the GST-Asy1 fusion protein and did not
cross-react with the GST component.
Western blotting
Plant proteins were extracted in 1% SDS, 5% ß-mercaptoethanol and 50
mM Tris-HCl, pH 7.5, containing 1 Complete Mini protease inhibitor cocktail
tablet (Roche) in 10 ml extraction buffer), and insoluble material was removed
by centrifugation. Protein samples were separated by SDS-PAGE and
electroblotted onto Hybond C extra nitrocellulose membrane (Amersham Pharmacia
Biotech). Western blots were incubated with anti-Asy1 antiserum (1:2000
dilution) followed by anti-rabbit antibodies conjugated to horseradish
peroxidase (1:5000 dilution) (Sigma-Aldrich). Protein bands were visualized
using ECL reagents (Amersham Pharmacia Biotech) and detected by
autoradiography.
Immunolocalization
Preparation of spreads and sections
Individual flower buds were dissected out from one inflorescence at a time,
of either Brassica or Arabidopsis, and ordered by size in a
Petri dish containing damp filter paper. Only the smallest buds were included,
and any buds containing yellowish anthers, indicating the presence of pollen,
were discarded. The relationship of meiotic stage to floral morphology has
been described earlier (Armstrong and
Jones, 2001
; Armstrong et al.,
2001
). Single anthers from individual buds were assessed for their
meiotic stage after staining and lightly squashing the PMCs in acetic orcein.
The remaining five anthers, from buds at appropriate meiotic stages, were
placed in a cavity slide, and a small volume (20 µl for Brassica,
5 µl for Arabidopsis) of enzyme digestion mixture was added. The
digestion mixture includes 0.1 g cytohelicase, 0.0375 g sucrose, 0.25 g
polyvinylpyrollidone MW 40,000 (all Sigma)
(Albini et al., 1984
). Anthers
were incubated in the digestion mixture for 8 minutes (Brassica) or 2
minutes (Arabidopsis) at 37°C in a moisture chamber. After this
time the anthers were gently tapped out in the digestion mixture using a brass
rod to release PMCs, and anther wall debris was removed from the suspension
thus created.
For immunofluorescence LM analysis, subsequent steps were performed using good quality pre-cleaned glass slides. For immunogold EM analysis, the slides were pre-coated with a plastic film and glow-discharged to make them hydrophilic. Slides were dipped one at a time into a solution of 0.75% plastic Petri dish (Greiner) dissolved in chloroform and left in an upright position to dry. The slides were then glow-discharged by exposure to UV light at 10-1 torr.
To prepare the spreads, 10 µl of Lipsol spreading medium (1% Lipsol
detergent in freshly distilled water buffered to pH 9.0 with borate buffer)
was drawn up with a pipette. The liquid was then expelled such that the drop
was retained at the end of the pipette tip. 1-2 µl of the cell suspension
was then drawn up using a separate pipette, and this was combined with the
Lipsol drop. The mixture was expelled onto a treated slide. The cells were
then monitored by phase contrast microscopy. When the chromatin started to
spill out from PMCs, 10 µl of fixative (4% paraformaldehyde pH 8.0) was
added. The slide was then allowed to dry in a fume-hood. Wax-embedded sections
of anthers were prepared as described previously
(Armstrong and Jones,
2001
).
Fluorescence immunolocalization
Slides were first immersed in wash (PBS + 0.1% Triton) for 2x5
minutes. To block non-specific antibody binding (optional depending on
background levels), 100 µl of blocking buffer (1% BSA in PBS) was applied
directly to the slides, covered with parafilm and incubated at room
temperature for 45 minutes. 100 µl of primary (anti-Asy1) antibody, diluted
1:500 in blocking buffer (PBS + 0.1% Triton + 1% BSA) was applied directly to
the slides, covered with parafilm and incubated overnight at 4°C in a
moisture chamber. The slides were then washed (2x5 minutes) before
adding 100 µl of the secondary antibody (anti-rabbit FITC, Sigma, 1:50 in
blocking buffer) and incubating for 90 minutes at room temperature. Finally
the slides were washed for 2x5 minutes, mounted in DAPI (10 µg/ml) in
Vectashield antifade mounting medium. Slides were examined by fluorescence
microscopy using a Nikon Eclipse T300 microscope. Capture and analysis of
images was achieved using an image analysis system (Applied Imaging).
Immunogold (electron microscopy) localization
Suitably spread PMC nuclei on plastic-coated slides were located by phase
contrast microscopy and their positions marked. The unstained spreads on
plastic film were then transferred to nickel electron microscope (EM) grids by
flotation on a clean water surface. After picking up the grids, and allowing
them to dry, the locations of spreads on the grids was once more checked by
phase contrast microscopy. The following immunological and staining steps were
all carried out by placing the grids on drops of reagent on a hydrophobic
plastic surface. The grids were first taken through two changes (2x5
minutes) of PBS. Grids were next transferred to primary (anti-Asy1) antibody
diluted 1:500 in blocking buffer (as for LM) and incubated overnight at
4°C, then washed (3x5 minutes). The grids were then incubated with a
secondary antibody for EM (goat anti-rabbit IgG [BB International] conjugated
to 5 nm gold particles 1:50 dilution) for 90 minutes at room temperature,
followed by three washes (3x5 minutes) and 2x5 minutes washes in
distilled water. Finally the grids were stained using the most appropriate
method of the following three different procedures: (1) Uranyl acetate (30%);
incubation for 7 minutes at room temperature followed by washing in methanol
and then distilled water; (2) osmium tetroxide (0.1% in water) - incubation
for 30 minutes at room temperature, followed by washing in distilled water;
(3) phosphotungstic acid (1% in absolute ethanol), incubation for 10 minutes
at room temperature. Overall uranyl acetate and phosphotungstic acid resulted
in a higher level of background chromatin staining, but despite this,
phosphotungstic acid was preferable for staining the SC. Osmium tetroxide did
not produce as much background staining, but provided only poor definition of
the SC. The stained grids were examined using a Jeol 1200Ex electron
microscope.
| Results |
|---|
|
|
|---|
Initially, a Southern blot of B. oleracea genomic DNA was prepared and probed at high stringency with the ASY1 coding region. This confirmed the presence of closely related, low copy number sequences within the Brassica genome (data not shown). A PCR-based approach was then used to clone the putative B. oleracea orthologue of ASY1. Arabidopsis gene-specific primers were used to amplify the coding region of BoASY1 from B. oleracea flower bud cDNA. Brassica gene-specific primers were then designed on the basis of this sequence and used in RACE PCR to identify the 5' and 3' ends of the gene. Finally, the sequences were assembled to produce a full-length BoASY1 cDNA sequence of 2182 bp (Accession: AF410429) (Fig. 1A).
|
A comparison of BoASY1 and ASY1 showed that the genes were 87% identical across the full length of the cDNA-coding region (position 102 to 1904). Sequencing of B. oleracea genomic DNA corresponding to this region revealed that BoASY1 is composed of at least 21 exons. This is the same as the coding region of ASY1 (which has 22 exons in total, one comprising the 5' UTR). The similarity is reflected when the BoAsy1 and Asy1 proteins are examined. Both are almost identical in length (599 and 596 amino acids respectively) with a similar pI (5.2 and 5.04 respectively) and molecular weight (67.98 kDa and 67.3 kDa respectively). The proteins share 83% identity and 89% similarity across the full length of the sequences (Fig. 1B), with conservation highest at the N-terminus.
This region includes a HORMA domain
(Aravind and Koonin, 1998
)
extending across the first 250 amino acids of the protein. There are two
potential in-frame translation start codons separated by 3 bp, of which only
the first has the Kozak consensus sequence
(Kozak, 1995
) necessary for
efficient translation initiation.
Asy1/BoAsy1 is expressed in early meiotic cells in both
Arabidopsis and Brassica
To begin the analysis of Asy1 function, an antibody was raised against the
full-length recombinant protein expressed in E. coli. The expression
of Asy1 and BoAsy1 was then determined in protein extracts from
Arabidopsis flower buds and B. oleracea anthers collected at
different stages of meiosis. We have previously reported that there is a clear
relationship between meiotic progression in pollen mother cells and flower bud
length in Arabidopsis (Armstrong
et al., 2001
). Protein extracts were therefore prepared from bud
size series taken from a single inflorescence representing pre-meiosis through
to the tetrad stage. In the case of Brassica, protein extracts were
prepared from meiotically staged anthers.
Western analysis of Arabidopsis bud extracts revealed expression
of a single protein with a molecular mass of slightly below 69 kDa, which is
in agreement with a predicted size for Asy1 of 67.3 kDa. Expression was first
detected in buds at a size corresponding to early male meiosis, the signal
then gradually decreased in older buds as they approached the tetrad stage
(Fig. 2A). Interestingly there
was a slight increase in band intensity in the extract prepared from buds at
the tetrad stage. We believe that this reflects the asynchrony between male
and female meiosis in Arabidopsis that we have previously reported
(Armstrong and Jones, 2001
).
Male meiosis initiates at an earlier stage of bud development so that by the
time the PMCs have reached the tetrad stage, the embryo sac mother cells are
still only in prophase I.
|
Western blots also revealed that BoAsy1 is expressed during early meiosis in B. oleracea, and because cytologically staged Brassica anthers were analyzed, expression could be more directly related to the meiotic stage of the material (Fig. 2B). This analysis revealed that the Asy1 protein begins to accumulate during meiotic interphase. It increases, peaking at leptotene before gradually decreasing towards the later stages of meiosis. We noticed some slight variation in the rate of disappearance of the protein. Generally it was no longer detectable after diplotene/diakinesis, but in a few cases it apparently persisted to later stages of meiosis. This is probably because of some meiotic asynchrony of the anthers within a single bud, so that the stage indicated by cytological analysis of a single anther may not always correspond precisely with the stages present in the remaining anthers. Expression of BoAsy1 was not detected in the vegetative tissues of the stem and leaf.
Asy1 protein is located in pollen mother cells undergoing
meiosis
The anti-Asy1 antibody was next used to immunolocalize Asy1 in
Arabidopsis (wild-type) anther locule sections prepared at prophase I
and at the tetrad stage after meiosis is complete
(Fig. 3). Binding of
FITC-labelled anti-Asy1 Ab to the PMCs that are located in the central region
of the anther locule was clearly detected at prophase I
(Fig. 3A) but was no longer
detectable in PMCs at the tetrad stage
(Fig. 3B). Antibody binding was
not found in any of the locule cells that surround the PMCs at either time
point. When pre-immune serum was used on comparable sections in place of the
anti-Asy1 antibody, no signal was detected.
|
Immunolocalization of Asy1 and BoAsy1 to meiotic nuclei and
chromosomes
FITC-labelled anti-Asy1 Ab was used to immunolocalize Asy1/BoAsy1 on
meiotic chromosome spreads prepared from Arabidopsis and
Brassica PMCs at different stages of meiosis (Figs
4 and
5).
|
|
Expression in both species was first detected as punctate foci at meiotic interphase (Fig. 4A, Fig. 5A). During leptotene, when the axial element first becomes visible, punctate signals are still present but mixed with some stretches of more continuous signal (Fig. 5B). As the homologous chromosomes continue to condense and synapse through zygotene, the signal becomes associated with the entire length of the lateral elements, although not with the nucleolar region (Fig. 4B, Fig. 5C). One possibility is that the initially punctate signals gradually extend as meiosis proceeds to give a more continuous signal. Alternatively the apparent continuity of the signal may be caused by juxtaposition of individual foci resulting from condensation of the homologues as meiosis proceeds. Either way it is apparent that the signal intensity is not absolutely uniform, and interestingly the intensity of the signal mirrors that of the DAPI signal along the axes. Continuity of the signal is maintained throughout pachytene (Fig. 4C, Fig. 5D) but begins to disappear as the homologues desynapse during diplotene (Fig. 5E). During these stages it is evident that the antibody is localized to the chromosome/bivalent axes and not to the DAPI-positive extended chromatin loops surrounding these structures. Association of BoAsy1 with the desynapsing lateral elements of the SC is maintained at early diplotene where antibody binding to both homologues is clearly visible. However, by late diplotene the signal is no longer associated with the chromosomes, although a few larger foci appear away from the chromosomes, suggesting that the protein accumulates as aggregates prior to degradation (Fig. 5F). By diakinesis and at the tetrad stage the protein is no longer detectable (Fig. 5G,H).
BoAsy1 does not localize to the telomere regions
Fluorescence in situ hybridization (FISH) of telomere repeat sequences used
in conjunction with silver-stained surface spreads of pachytene chromosomes
has revealed that the telomeres appear to abut onto the ends of SCs
(Cuñado and Santos,
1998
). Given the close association of Asy1/BoAsy1 with the lateral
elements, it was of interest to investigate the distribution of the protein
relative to the telomere structures. Combined immunolocalization and FISH
using a telomerespecific probe was performed on pachytene chromosome spreads
of B. oleracea (Fig.
6). This revealed that BoAsy1 extended to the telomeres but did
not extend into the telomere region as there was little or no merging of the
two signals (Fig. 6A). At a
higher resolution it appears that there may be a short region of chromatin not
associated with the protein interposed between the signal derived from the
fluorescent antibody and that from the telomere repeat, and the Asy1 signal
does not extend to the end of the bivalent
(Fig. 6B-E).
|
EM reveals BoAsy1 localizes to axis-associated chromatin
To resolve the subcellular localization of Bo Asy1 in detail, an
immunogold-labelled antibody was applied to spreads prepared from
Brassica PMCs at pre-leptotene, early zygotene and pachytene
(Fig. 7). This revealed that in
meiotic interphase, prior to the appearance of axial elements, BoAsy1 is
distributed over the diffuse chromatin with the gold particles lying in short
linear arrays (Fig. 7A). In
leptotene nuclei, as the axial elements appear, it is clear that the gold
particles are associated with the chromatin rather than the axial elements
(Fig. 7B). The same pattern of
localization to axis-associated chromatin is apparent in zygotene and in
pachytene nuclei containing tripartite SC
(Fig. 7C,D). Thus these
observations taken in conjunction with the fluorescence microscopy indicate
that Asy1 is localized to regions of chromatin that are closely associated
with the chromosome axes rather than the axes themselves.
|
| Discussion |
|---|
|
|
|---|
The observation of several bands when Brassica genomic DNA was
probed with ASY1 was not unexpected and suggests the presence of at
least one other ASY1-related sequence in the Brassica
genome. We have previously reported the identification of ASY2, an
Arabidopsis gene that encodes a predicted 58.5 kDa protein. Asy2
exhibits 57% amino-acid identity with Asy1 over the N-terminal half of the
protein that includes the HORMA domain region, although there is no
significant homology over the remainder of the protein. The function of Asy2
is currently unknown. The possibility that it is a functional homologue of
Asy1 may be excluded on the basis that it is expressed in an asy1
mutant line. It seems likely that ASY1/2 arose as a result of an
ancient duplication of the Arabidopsis genome that is known to have
occurred during the evolutionary past of the species and that subsequently
there has been a divergence in the functions of the two genes
(Arabidopsis Genome Initiative,
2000
). It is therefore likely that homologues of the two genes are
also present in the B. oleracea genome. Moreover it is quite possible
that additional related copies exist, since it is evident that the
Brassica genome has undergone triplication and has expanded about 1.5
times compared with Arabidopsis
(O'Neill and Bancroft,
2000
).
Asy1 expression is specific to meiosis
A feature of ASY1 is that gene transcripts are detectable in both
reproductive and vegetative tissues of Arabidopsis
(Caryl et al., 2000
). This is
not restricted to ASY1, as vegetative expression of other meiotic
genes in Arabidopsis has also been reported
(Doutriaux et al., 1998
;
Bai et al., 1999
). In other
species, transcription of meiotic genes appears to be more strictly confined
to reproductive cells, although this is not without exception; for example,
the rat SCP1 gene is expressed, albeit at a low level, in the brain
(Kerr et al., 1996
). In the
case of ASY1, we suggest that expression might be subject to some
degree of regulation at the level of translation since the phenotype of
asy1 is clearly meiotic with no detectable effect on vegetative
growth (Ross et al.,
1997
,Ross et al.,
1997
; Caryl et al.,
2000
). This suggestion is supported by the results of the western
analysis and immunolocalization studies on Arabidopsis anther locule
sections, which clearly demonstrate that expression of Asy1 protein is
restricted to cells undergoing meiosis
(Fig. 3). Expression of the
protein has not been detected in any of the vegetative cells tested to
date.
Asy1 is associated with chromatin in close proximity to the axial
elements/lateral elements of homologous chromosomes
Mutant asy1 plants exhibit an asynaptic phenotype with a
substantially reduced chiasma frequency
(Ross et al.,
1997
,Ross et al.,
1997
). The genetic lesion becomes apparent early in prophase I.
Telomere pairing at the interphase/leptotene transition that precedes synapsis
in wild-type plants is unaffected in asy1, and development of the
chromosome axes appears to be substantially normal at the light microscope
level (Armstrong et al., 2001
).
However, synapsis fails, and the normal events of zygotene and pachytene are
not seen. This failure of synapsis suggests that asy1 plants might be
defective in a component of the SC or in a protein required for establishment
of the SC. Light microscopy studies using FITC-labelled anti-Asy1 initially
led us to believe that the protein may be an integral component of the
chromosome axes. The signal is clearly associated with both the axial elements
prior to synapsis and the lateral elements of the fully synapsed homologues.
Moreover, whereas the chromatin not immediately adjacent to the axes was
detectable using DAPI, there was no evidence that it interacted with the
anti-Asy1 Ab (for example see Figs
5B-E and Fig.
6D-E). However close inspection of the FITC signal revealed that
the signal was never truly uniform along the chromosome cores, and some
variation in intensity was evident. The regions of increased intensity
corresponded to regions of chromatin adjacent to the chromosome axes that
exhibited an increased staining intensity with DAPI.
The application of electron microscopy in conjunction with immunogold
labelling confirmed that Asy1 is a chromatin-associated protein rather than an
integral component of the axial/lateral elements, such as the rat SC proteins
SCP2 and SCP3 (Schalk et al.,
1998
). However, it is apparently confined to chromatin immediately
adjacent to these structures. Thus it belongs to the general category of
axis-associated proteins, similar to, for example, TOPO II
(Moens and Earnshaw, 1989
). It
seems likely that the HORMA domain plays a role in the interaction with
chromatin. Whether this structural motif in conjunction with a DNA target is
sufficient, or other proteins are required, remains to be resolved. Either
way, there is clearly selectivity in the regions of chromatin to which Asy1
associates. This point was further emphasized by the observation that the
localization of BoAsy1 along the lateral elements did not extend into the
telomere region. It will be of interest to determine if the distribution of
the SC structure also follows this pattern relative to the telomere
region.
Functional considerations
The function of Asy1 is currently a matter for speculation. To our
knowledge a protein with the pattern of distribution described above (see
below for further comments) has not previously been described. An obvious
consequence of mutation of ASY1 is an inability to establish the SC,
but its precise role in the establishment of the SC is unclear. Asy1 protein
is detected as a chromatin-associated signal before the chromosome axes
appear. As the axes become apparent during leptotene, the protein localizes to
the chromatin close to the axial elements, and this persists throughout
zygotene and pachytene. As meiosis progresses, the paired homologous
chromosomes desynapse and the SC breaks down; eventually Asy1 is no longer
associated with the axes but some residual protein is detected as protein
complexes. It seems possible that these correspond to so-called polycomplexes
that become apparent in a wide range of species, including higher plants
during diplotene (Zickler and Kleckner,
1999
). They are composed of SC material and their appearance
coincides with SC degradation. Although these observations indicate a link
between Asy1 and the SC, the nature of this remains to be resolved. On the
other hand, the diplotene observations may simply represent extrachromosomal
protein aggregates not associated with polycomplexes.
As Asy1 is clearly detectable at early leptotene, a substantial period
before synapsis commences, Asy1 may have an role in the juxtaposition of the
homologues that occurs in early prophase I. This is supported by our recent
observation that in an asy1 mutant homologue, synapsis does not
progress beyond the pairing of telomeres in leptotene
(Armstrong et al., 2001
). In
this case the failure to establish the SC may be a consequence of an inability
to pair rather than the protein directly mediating SC assembly. However, we
cannot rule out the possibility that in the asy1 mutant
transient/unstable pairing occurs but has not been detected by the methodology
we have applied. If so, then the protein may act at the interface between
homologue pairing and synapsis rather than at an earlier stage, possibly
recruiting the bases of the chromatin loops to the developing axial/lateral
elements. Such a role may be reflected in the observation that the protein
remains associated with the homologues throughout pachytene and its
degradation coincides with desynapsis and SC disassembly.
The relationship of Asy1 to SC-associated proteins from other
organisms
Given the fundamental nature of meiosis it might seem reasonable to assume
that the genes involved would be highly conserved in different species.
Although this assumption appears to hold true for genes that encode proteins
with a defined enzymatic activity, notably recombination proteins, the
position is less clear for other meiotic proteins such as those involved in
chromosome synapsis. Thus, even in the case of the SC, which is an
evolutionarily conserved structure, identification of homologues to known SC
components has proved elusive, suggesting that functional conservation is not
necessarily reflected in sequence homology
(Heyting, 1996
).
When ASY1 was originally isolated it was noted that it possessed
some limited similarity to the yeast HOP1 gene
(Hollingsworth et al., 1990
).
The predicted proteins are virtually the same size and a BLAST database search
revealed that both possess a HORMA domain located towards their N-terminal
region. However set against this was a lack of any identifiable homology in
the C-terminal half of each protein. In particular, a zinc finger DNA-binding
domain and sequences at the C-terminus that are required for Hop1 function are
entirely absent in Asy1 (Hollingsworth et
al., 1990
; Caryl et al.,
2000
). A HOP1 homologue has also been reported in the
yeast Kluyveromyces lactis (Smith
and Roeder, 2000
). The protein KlHop1 has an overall identity of
40% with Hop1 and although this is indicative of the divergence that is
apparent amongst SC-associated proteins, it should be noted that regions
essential for Hop1 function are conserved in the K. lactis protein. A
limited degree of homology has also been noted between Hop1 and the Him3
protein from C. elegans (Zetka et
al., 1999
). At 239 amino acids, Him3 is less than half the size of
Hop1 (and Asy1) but it contains a HORMA domain that encompasses virtually the
entire protein. However in a pairwise comparison it exhibits only 16% identity
and 31% similarity to the Hop1 domain
(Zetka et al., 1999
). This is
somewhat lower than the homology shared between the Hop1 and Asy1 HORMA
domains (Caryl et al., 2000
).
Also, when Him3 was compared with the Asy1 HORMA domain we failed to detect
any significant sequence homology. Thus on balance, the overall high degree of
sequence divergence and an absence of any defined biological role for the
HORMA domain provides little firm evidence to suggest any functional
similarity between the three proteins beyond sharing the potential to interact
with chromatin.
We anticipated that determining the localization of Asy1 (and BoAsy1) would provide further insight into to the functional relationship, or lack of, between the three proteins. A comparison of the immunolocalization studies using antibodies raised against the proteins reveals differences in the distribution of each protein during meiosis, although some caution in reaching firm conclusions is required since, to date, localization of Hop1 and Him3 has been based on light microscopy only.
Yeast Hop1 associates with chromosomes during leptotene as a series of foci
(Smith and Roeder, 1997
). This
is dependent upon Red1, a protein that is required for axial element assembly;
Red1 also shows a similar distribution. Evidence suggests that the two
proteins work both in concert and possess independent activities
(de los Santos and Hollingsworth,
1999
; Hollingsworth and Ponte,
1997
; Woltering et al.,
2000
). As meiosis progresses into zygotene, Hop1 becomes more
broadly distributed over each chromosome, although less so than for Red1, and
is absent from the nucleolar region. By late pachytene, Hop1 has disassociated
from the chromosomes, and it has been suggested that this is coincident with
synapsis (Smith and Roeder,
1997
). This pattern of events would suggest that Hop1 is not an
integral structural component of the axial cores. Thus, although in this
respect the yeast protein seems similar to Asy1/BoAsy1, there is some
discrepancy in their temporal distribution. In many respects the distribution
of Asy1/BoAsy1 is more reminiscent of Red1, which localizes to both unsynapsed
and synapsed chromosomes and persists during pachytene
(Smith and Roeder, 1997
).
Moreover immunofluorescence using anti-Red1 antibody reveals that the protein
is initially present as individual punctate signals that develop into a
semi-continuous signal. However, in contrast to Red1, but like Hop1, the plant
proteins do not localize to the nucleolus
(Smith and Roeder, 1997
). In
addition, there is no similarity at the sequence level between Asy1 and Red1,
indeed none of the predicted proteins in the Arabidopsis proteome
exhibits homology to the yeast protein.
The distribution of Him3 is, however, rather different from both Hop1 and
Asy1/BoAsy1, being reminiscent of Cor1, a mammalian axial element protein
(Zetka et al., 1999
;
Dobson et al., 1994
).
Initially the protein localizes as numerous foci during early meiosis. As the
chromosome axes develop, the punctate appearance is replaced by more
continuous staining of the axial elements. This pattern persists throughout
prophase I and, importantly, is retained on the chromosome cores following
desynapsis of the homologues up to the metaphase I -anaphase I transition. On
the basis of this finding it is currently postulated that Him3 is an integral
component of the chromosome core that may play a role in sister chromatid
cohesion (Zetka et al., 1999
).
Thus although the spatial distribution of Asy1/BoAsy1 appears similar to that
of Him3, it is quite obvious that there are significant temporal differences
as Asy1 clearly disassociates from the chromosome cores before the end of
prophase I. Overall there is no evidence to suggest that Asy1/BoAsy1 is
involved in sister chromatid cohesion and hence is functionally distinct from
Him3.
In summary, it appears that Asy1/BoAsy1 may perform a role similar to that of Hop1/Red1; however further clarification will require identification of the meiotic proteins with which it interacts. The exact role of the protein remains to be established. In the absence of Asy1/BoAsy1, SC morphogenesis cannot take place, suggesting that the protein performs a crucial function, possibly at the interface of the axis-associated chromatin and the nascent SC structure.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Albini, S. M., Jones, G. H. and Wallace, B. M. N. (1984). A method for preparing two-dimensional surface-spreads of synaptonemal complexes from plant meiocytes for light and electron microscopy. Exp. Cell Res. 152,280 -285.[CrossRef][Medline]
Arabidopsis Genome Initiative (2000). Analysis of the genome sequence of the flowering plant Arabidopsis thaliana. Nature 408,796 -816.[CrossRef][Medline]
Aravind, L. and Koonin, E. V. (1998). The HORMA domain: a common structural denominator in mitotic checkpoints, chromosome synapsis and DNA repair. Trends Biochem. Sci. 23,284 -286.[Medline]
Armstrong, S. J. and Jones, G. H. (2001). Female meiosis in wild-type Arabidopsis thaliana and in two meiotic mutants. Sex. Plant Reprod. 13,177 -183.[CrossRef]
Armstrong, S. J., Franz, P., Marshall, D. F. and Jones, G. H. (1998). Physical mapping of DNA repetitive sequences to mitotic and meiotic chromosomes of Brassica oleracea var. alboglabra by fluorescence in situ hybridization. Heredity 81,666 -673.[CrossRef]
Armstrong, S. J., Franklin, F. C. H. and Jones, G. H.
(2001). Nucleolus-associated telomere clustering and pairing
precede meiotic chromosome synapsis in Arabidopsis thaliana. J.
Cell Sci. 114,4207
-4217.
Bai, X., Peirson, B. N, Dong, F., Xue, C. and Makaroff, C.
A. (1999). Isolation and characterization of SYN1, a
RAD21-like gene essential for meiosis in Arabidopsis.Plant Cell 11,417
-430.
Bohoun, E. J. R., Keith, D. J., Parkin, I. A. P., Sharpe, A. G. and Lydiate, D. J. (1996). Alignment of the conserved C genomes of Brassica oleracea and Brassica napus. Theor. Appl. Genet. 93,833 -839.
Caryl, A. P., Armstrong, S. J., Jones, G. H. and Franklin, F. C. H. (2000). A homologue of the yeast HOP1 gene is inactivated in the Arabidopsis meiotic mutant asy1.Chromosoma 159,62 -71.
Cuñado, N. and Santos, J. L. (1998). A method for fluorescence in situ hybridization against synaptonemal complex-associated chromatin of plant meiocytes. Exp. Cell Res. 239,179 -182.[CrossRef][Medline]
Dawe, R. K., Sedat, J. W., Agard, D. A. and Cande, W. Z. (1994). Meiotic chromosome pairing in maize is associated with a novel chromatin organization. Cell 77,901 -912.
de los Santos, T. and Hollingsworth, N. M.
(1999). Red1p: a MEK1-dependent phosphoprotein that physically
interacts with Hop1p during meiosis in yeast. J. Biol.
Chem. 274,1783
-1790.
Dobson, M. J., Pearlman, R. E., Karaiskakis, A., Spyropoulos, B. and Moens, P. B. (1994). Synaptonemal complex proteins: Occurrence, epitope mapping and chromosome disjunction. J. Cell Sci. 107,2749 -2760.[Abstract]
Doutriaux, M. P., Couteau, F., Bergounioux, C. and White, C. (1998). Isolation and characterisation of the RAD51 and DMC1 homologues from Arabidopsis thaliana. Mol. Gen. Genet. 257,283 -291.[CrossRef][Medline]
Feinberg, A. P. and Vogelstein, B. (1983). A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity. Anal Biochem. 132, 6-13.[CrossRef][Medline]
Feinberg, A. P. and Vogelstein, B. (1984). Addendum: a technique for radiolabelling DNA restriction endonuclease fragments to high specific activity. Anal Biochem. 137,266 -267.[CrossRef][Medline]
Henikoff, S. and Henikoff, J. G. (1992). Amino
acid substitution matrices from protein blocks. Proc. Natl. Acad.
Sci. USA 89,10915
-10919.
Heyting, C. (1996). Synaptonemal complexes: structure and function. Curr. Opin. Cell Biol. 8, 389-396.[CrossRef][Medline]
Hollingsworth, N. M., Goetsch, L. and Byers, B. (1990). The HOPI gene encodes a meiosis-specific component of yeast chromosomes. Cell 61, 73-84.[CrossRef][Medline]
Hollingsworth, N. M. and Ponte, L. (1997). Genetic interactions between HOP1, RED1 and MEK1 suggest that MEK1 regulates assembly of axial element components during meiosis in the yeast Saccharomyces cerevisiae.Genetics 147,33 -42.[Abstract]
Kakeda, K., Jordan, N. D., Conner, A., Ride, J. P.,
Franklin-Tong, V. E. and Franklin, F. C. H. (1998).
Identification of residues in a hydrophilic loop of the Papaver
rhoeas S protein that play a crucial role in recognition of incompatible
pollen. Plant Cell. 10,1723
-1731.
Kerr, S. M., Taggart, M. H., Lee, M. and Cooke, H. J.
(1996). Ott, a mouse X-linked multigene family expressed
specifically during meiosis. Hum. Mol. Genet.
5,1139
-1148.
Kozak, M. (1995). Adherence to the first-AUG
rule when a second AUG codon follows closely upon the first. Proc.
Natl. Acad. Sci. USA 92,2662
-2666.
Moens, P. B. and Earnshaw, W. C. (1989). Anti-topoisomerase II recognizes meiotic chromosome cores. Chromosoma 98,317 -322.[CrossRef][Medline]
Moses, M. J. (1968). Synaptonemal complex. Annu. Rev. Genet. 2,363 -412.[CrossRef]
O'Neill, C. M. and Bancroft, I. (2000). Comparative physical mapping of segments of the genome of Brassica oleracea var. alboglabra that are homoeologous to sequenced regions of chromosomes 4 and 5 of Arabidopsis thaliana. The Plant J. 23,233 -243.[CrossRef][Medline]
Roeder, G. S. (1997). Meiotic chromosomes: it
takes two to tango. Genes Dev.
11,2600
-2621.
Ross, K. J., Fransz, P. and Jones, G. J. (1997). A light microscopic atlas of meiosis in Arabidopsis thaliana. Chromosome Res. 4,507 -516.
Ross, K. J., Fransz, P., Armstrong, S. J., Vizir, I., Mulligan, B., Franklin, F. C. H. and Jones, G. J. (1997). Cytological characterisation of four meiotic mutants of Arabidopsis isolated from T-DNA transformed lines. Chromosome Res. 5, 551-559.[CrossRef][Medline]
Schalk, J. A. C., Dietrich, A. J. J., Vink, A. C. G., Offenberg, H. H., van Aalderen, M. and Heyting, C. (1998). Localization of SCP2 and SCP3 protein molecules within the synaptonemal complexes of the rat. Chromosoma 107,540 -548.[CrossRef][Medline]
Scherthan, H., Eils, R., Trelles-Sticken, E., Dietzel, S., Cremer, T., Walt, H. and Jauch, A. (1998). Aspects of three-dismensional chromosome reorganization during onset of human male meiotic prophase. J. Cell Sci. 111,2337 -2351.[Abstract]
Schwarzacher, T. (1997). Three stages of meiotic homologous chromosome pairing in wheat: cognition, alignment and synapsis. Sex. Plant Reprod. 10,324 -331.[CrossRef]
Smith, A. V. and Roeder, G. S. (1997). The
yeast Red1 protein localizes to the cores of meiotic chromosomes.
J. Cell Biol. 136,957
-967.
Smith, A. V. and Roeder, G. S. (2000). Cloning and characterization of the Kluyveromyces lactis homologues of the Saccharomyces cerevisiae RED1 and HOP1 genes. Chromosoma 109,50 -61.[CrossRef][Medline]
Tatusova, T. A. and Madden, T. L. (1999). BLAST 2 Sequences, a new tool for comparing protein and nucleotide sequences. FEMS Microbiol. Lett. 174,247 -250.[CrossRef][Medline]
Von Wettstein, D., Rasmussen, S. W. and Holm, P. B. (1984). The synaptonemal complex in genetic segregation. Annu. Rev. Genet. 18,331 -413.[Medline]
Woltering, D., Baumgartner, B., Bagchi, S., Larkin, B., Loidl,
J., de los Santos, T. and Hollingsworth, N. M. (2000).
Meiotic segregation, synapsis and recombination checkpoint functions require
physical interaction between the chromosomal proteins Red1p and Hop1p.
Mol. Cell. Biol. 20,6646
-6658.
Zetka, M. C., Kaawasaki, I., Strome, S. and Müller, F.
(1999). Synapsis and chiasma formation in Caenorhabditis
elegans require HIM-3, a meiotic chromosome core component that functions
in chromosome segregation. Genes Dev.
13,2258
-2270.
Zickler, D. and Kleckner, N. (1999). Meiotic chromosomes: integrating structure and function. Annu. Rev. Genet. 33,603 -754.[CrossRef][Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
K. Wang, D. Tang, M. Wang, J. Lu, H. Yu, J. Liu, B. Qian, Z. Gong, X. Wang, J. Chen, et al. MER3 is required for normal meiotic crossover formation, but not for presynaptic alignment in rice J. Cell Sci., June 15, 2009; 122(12): 2055 - 2063. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. P. Pawlowski, C.-J. R. Wang, I. N. Golubovskaya, J. M. Szymaniak, L. Shi, O. Hamant, T. Zhu, L. Harper, W. F. Sheridan, and W. Z. Cande Maize AMEIOTIC1 is essential for multiple early meiotic processes and likely required for the initiation of meiosis PNAS, March 3, 2009; 106(9): 3603 - 3608. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Boateng, X. Yang, F. Dong, H. A. Owen, and C. A. Makaroff SWI1 Is Required for Meiotic Chromosome Remodeling Events Mol Plant, July 1, 2008; 1(4): 620 - 633. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Liu and L.-J. Qu Meiotic and Mitotic Cell Cycle Mutants Involved in Gametophyte Development in Arabidopsis Mol Plant, July 1, 2008; 1(4): 564 - 574. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Riehs, S. Akimcheva, J. Puizina, P. Bulankova, R. A. Idol, J. Siroky, A. Schleiffer, D. Schweizer, D. E. Shippen, and K. Riha Arabidopsis SMG7 protein is required for exit from meiosis J. Cell Sci., July 1, 2008; 121(13): 2208 - 2216. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Phillips, E. I. Mikhailova, L. Timofejeva, J. L. Mitchell, O. Osina, S. P. Sosnikhina, R. N. Jones, and G. Jenkins Dissecting Meiosis of Rye using Translational Proteomics Ann. Bot., April 1, 2008; 101(6): 873 - 880. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. E. Stronghill and C. A. Hasenkampf Analysis of substage associations in prophase I of meiosis in floral buds of wild-type Arabidopsis thaliana (Brassicaceae) Am. J. Botany, December 1, 2007; 94(12): 2063 - 2067. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Sanchez-Moran, J.-L. Santos, G. H. Jones, and F. C. H. Franklin ASY1 mediates AtDMC1-dependent interhomolog recombination during meiosis in Arabidopsis Genes & Dev., September 1, 2007; 21(17): 2220 - 2233. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Pradillo, E. Lopez, C. Romero, E. Sanchez-Moran, N. Cunado, and J. L. Santos An Analysis of Univalent Segregation in Meiotic Mutants of Arabidopsis thaliana: A Possible Role for Synaptonemal Complex Genetics, February 1, 2007; 175(2): 505 - 511. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. I. Mikhailova, D. Phillips, S. P. Sosnikhina, A. V. Lovtsyus, R. N. Jones, and G. Jenkins Molecular Assembly of Meiotic Proteins Asy1 and Zyp1 and Pairing Promiscuity in Rye (Secale cereale L.) and Its Synaptic Mutant sy10 Genetics, November 1, 2006; 174(3): 1247 - 1258. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. N. Golubovskaya, O. Hamant, L. Timofejeva, C.-J. R. Wang, D. Braun, R. Meeley, and W. Z. Cande Alleles of afd1 dissect REC8 functions during meiotic prophase I J. Cell Sci., August 15, 2006; 119(16): 3306 - 3315. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Kerzendorfer, J. Vignard, A. Pedrosa-Harand, T. Siwiec, S. Akimcheva, S. Jolivet, R. Sablowski, S. Armstrong, D. Schweizer, R. Mercier, et al. The Arabidopsis thaliana MND1 homologue plays a key role in meiotic homologous pairing, synapsis and recombination J. Cell Sci., June 15, 2006; 119(12): 2486 - 2496. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. M McInnis, D. C Emery, R. Porter, R. Desikan, J. T Hancock, and S. J Hiscock The role of stigma peroxidases in flowering plants: insights from further characterization of a stigma-specific peroxidase (SSP) from Senecio squalidus (Asteraceae) J. Exp. Bot., May 1, 2006; 57(8): 1835 - 1846. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Hall, A. R. Evans, H. J. Newbury, and J. Pritchard Functional analysis of CHX21: a putative sodium transporter in Arabidopsis J. Exp. Bot., March 1, 2006; 57(5): 1201 - 1210. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-I. Nonomura, M. Nakano, M. Eiguchi, T. Suzuki, and N. Kurata PAIR2 is essential for homologous chromosome synapsis in rice meiosis I J. Cell Sci., January 15, 2006; 119(2): 217 - 225. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Martinez-Perez and A. M. Villeneuve HTP-1-dependent constraints coordinate homolog pairing and synapsis and promote chiasma formation during C. elegans meiosis Genes & Dev., November 15, 2005; 19(22): 2727 - 2743. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Higgins, E. Sanchez-Moran, S. J. Armstrong, G. H. Jones, and F. Chris. H. Franklin The Arabidopsis synaptonemal complex protein ZYP1 is required for chromosome synapsis and normal fidelity of crossing over Genes & Dev., October 15, 2005; 19(20): 2488 - 2500. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Chelysheva, S. Diallo, D. Vezon, G. Gendrot, N. Vrielynck, K. Belcram, N. Rocques, A. Marquez-Lema, A. M. Bhatt, C. Horlow, et al. AtREC8 and AtSCC3 are essential to the monopolar orientation of the kinetochores during meiosis J. Cell Sci., October 15, 2005; 118(20): 4621 - 4632. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-H. Jung, M.-J. Han, Y.-S. Lee, Y.-W. Kim, I. Hwang, M.-J. Kim, Y.-K. Kim, B. H. Nahm, and G. An Rice Undeveloped Tapetum1 Is a Major Regulator of Early Tapetum Development PLANT CELL, October 1, 2005; 17(10): 2705 - 2722. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Trelles-Sticken, C. Adelfalk, J. Loidl, and H. Scherthan Meiotic telomere clustering requires actin for its formation and cohesin for its resolution J. Cell Biol., July 18, 2005; 170(2): 213 - 223. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. A Wilson and C. Yang Plant gametogenesis: conservation and contrasts in development Reproduction, November 1, 2004; 128(5): 483 - 492. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Sanchez-Moran, G. H. Jones, F. C. H. Franklin, and J. L. Santos A Puromycin-Sensitive Aminopeptidase Is Essential for Meiosis in Arabidopsis thaliana PLANT CELL, November 1, 2004; 16(11): 2895 - 2909. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Higgins, S. J. Armstrong, F. C. H. Franklin, and G. H. Jones The Arabidopsis MutS homolog AtMSH4 functions at an early step in recombination: evidence for two classes of recombination in Arabidopsis Genes & Dev., October 15, 2004; 18(20): 2557 - 2570. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-I. Nonomura, M. Nakano, T. Fukuda, M. Eiguchi, A. Miyao, H. Hirochika, and N. Kurata The Novel Gene HOMOLOGOUS PAIRING ABERRATION IN RICE MEIOSIS1 of Rice Encodes a Putative Coiled-Coil Protein Required for Homologous Chromosome Pairing in Meiosis PLANT CELL, April 1, 2004; 16(4): 1008 - 1020. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. P. Pawlowski, I. N. Golubovskaya, L. Timofejeva, R. B. Meeley, W. F. Sheridan, and W. Z. Cande Coordination of Meiotic Recombination, Pairing, and Synapsis by PHS1 Science, January 2, 2004; 303(5654): 89 - 92. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. K. Kato and R. G. Palmer Molecular Mapping of the Male-Sterile, Female-Sterile Mutant Gene (st8) in Soybean J. Hered., September 1, 2003; 94(5): 425 - 428. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Mercier, Susan. J. Armstrong, C. Horlow, N. P. Jackson, C. A. Makaroff, D. Vezon, G. Pelletier, G. H. Jones, and F. C. H. Franklin The meiotic protein SWI1 is required for axial element formation and recombination initiation in Arabidopsis Development, July 15, 2003; 130(14): 3309 - 3318. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. J. Armstrong and G. H. Jones Meiotic cytology and chromosome behaviour in wild-type Arabidopsis thaliana J. Exp. Bot., January 1, 2003; 54(380): 1 - 10. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. Caryl, G. H. Jones, and F. C. H. Franklin Dissecting plant meiosis using Arabidopsis thaliana mutants J. Exp. Bot., January 1, 2003; 54(380): 25 - 38. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||