|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
doi: 10.1242/10.1242/jcs.00055
Research Article |
1 Department of Plant and Microbial Biology, University of California
Berkeley, Berkeley, CA 94720-3200, USA
2 Department of Molecular and Cell Biology, University of California
Berkeley, Berkeley, CA 94720-3200, USA
* Author for correspondence (e-mail: zcande{at}uclink4.berkeley.edu)
Accepted 14 July 2002
| Summary |
|---|
|
|
|---|
Key words: Bouquet, Telomere cluster, Meiosis, Microtubules, Colchicine, Rye
| Introduction |
|---|
|
|
|---|
One feature of the prophase movement of chromosomes is the formation of the
meiotic bouquet, which is defined by the aggregation of telomeres on a small
region of the nuclear envelope (Cowan et
al., 2001
; Scherthan et al.,
2001
; Zickler and Kleckner,
1998
). Several hypotheses have been proposed to explain how this
clustering contributes to homologous chromosome pairing. For example, the
active movement of telomeres might promote the movement of adjacent
chromosomal regions, `stirring' (Maguire,
1974
) the contents of the meiotic nucleus and increasing the
probability of chromosome contacts. Alternatively, telomere clustering might
promote homologous interactions by juxtaposing the subtelomeric regions of all
chromosomes (Scherthan,
2001
)
The mechanism of bouquet formation is not known. The bouquet appears to
form in two-steps; telomeres first attach to the nuclear envelope at dispersed
sites and subsequently migrate along the nuclear envelope to form the bouquet
(Gelei, 1921
;
Rasmussen and Holm, 1980
;
Scherthan et al., 1996
;
Wilson, 1925
). Telomeres
attach to the inner nuclear envelope via specialized terminal modifications of
the axial elements, protein structures that run along the longitudinal axis of
unpaired meiotic chromosomes, as revealed by electron microscopic analyses in
several animals (Esponda and
Gimenez-Martin, 1972
; Moens,
1969
) and in a few higher plants
(Holm, 1977
). Mutants that
block bouquet formation in either fission or budding yeast appear to affect
steps prior to telomere clustering, but their analysis has not yet lead to a
dissection of the mechanism of telomere clustering
(Cooper et al., 1998
;
Nimmo et al., 1998
;
Trelles-Sticken et al., 2000
).
Recombination proteins are not required for the meiotic bouquet
(Trelles-Sticken et al.,
1999
), and numerous desynaptic mutants display a normal bouquet
(Havekes et al., 1994
) (I.
Golubovskaya and W.Z.C., unpublished). Additionally, bouquet formation occurs
in haploid cells (de Jong et al.,
1991
; Santos et al.,
1994
; Wang,
1988
).
Extensive data accumulated over the last 60 years indicate that the drug
colchicine induces marked defects during meiotic prophase. Treatment of
meiotic tissues with colchicine reduces the frequency of chiasmata
(Barber, 1942
;
Driscoll and Darvey, 1970
;
Shepard et al., 1974
) and
impairs synaptonemal complex formation
(Loidl, 1989
;
Tepperberg et al., 1997
).
Colchicine interferes with microtubule dynamics, promoting microtubule
depolymerization in cells (Wilson and
Jordan, 1994
). It is not known whether the inhibitory effects of
colchicine on meiotic prophase events are caused by microtubule
depolymerization in the highly specialized meiotic cell. Experiments
attempting to deduce the colchicine-sensitive period have pointed to
premeiotic interphase [wheat (Driscoll and
Darvey, 1970
)], early leptotene [garlic
(Loidl, 1989
)] and zygotene
[lily (Shepard et al.,
1974
)].
Because of the proposed role of the bouquet in homolog juxtaposition and
the colchicine-sensitive period coincident with the bouquet stage in some
organisms, it is possible that the colchicine-sensitive process is bouquet
formation. A failure of telomere clustering may result in unpaired chromosomes
and consequently reduce both synapsis and recombination. This hypothesis is
supported by evidence demonstrating that an isochromosome paired and synapsed
normally in the presence of colchicine, although the remainder of chromosomes
remained unpaired (Driscoll and Darvey,
1970
; Driscoll et al.,
1967
; Loidl,
1989
). The isochromosome, two homologous arms connected at the
centromere, was postulated to need no active juxtaposition of homologous
regions, as they are physically connected. It was concluded that only the
movement of homologs into close proximity is sensitive to colchicine
(Driscoll and Darvey, 1970
).
Although these and other experiments give intriguing hints that colchicine may
affect the bouquet (see Zickler and
Kleckner, 1998
) there is no direct evidence to support this
conclusion.
We have developed a new method of culturing Secale cereale (rye)
anthers, the male reproductive organs of the plant, which allows temporal
analysis of meiotic prophase and manipulation of meiotic events by drug
treatments. Rye was chosen for our investigation because its chromosomes
contain large blocks of heterochromatin in their subtelomeric regions
(Lima de Faria, 1952
),
allowing easy identification of telomeres and thus the bouquet. In addition,
S. cereale has readily identifiable meiotic stages through its
chromatin morphology (Darlington,
1933
). We show here that S. cereale meiocytes undergo
normal bouquet formation in anther culture. To gain further insight into the
mechanism of telomere clustering, we treated rye anthers in culture with
microtubule-depolymerizing drugs. We demonstrate that the presence of normal
cytoplasmic microtubule arrays is neither necessary nor sufficient for bouquet
formation. We tested several drugs and found that the clustering of telomeres
on the nuclear envelope is uniquely inhibited by colchicine and its close
chemical relative, podophyllotoxin. Since colchicine's effect of inhibiting
bouquet formation can be separated from its effects on cytoplasmic
microtubules, the colchicine-sensitive target associated with telomere
clustering may be a novel protein or a tubulin-related protein distinct from
ß-tubulin.
| Materials and Methods |
|---|
|
|
|---|
Anther culture
Preliminary anther culture experiments were performed on intact anthers. We
were able to bisect the anthers longitudinally prior to placing them in
culture medium, thereby increasing the starting number of synchronous meiocyte
populations to six. There was no difference in the success rate of anther
cultures performed with whole or halved anthers, and all subsequent
experiments were performed on anther halves.
Upon removing anthers from the floret, the three anthers were sequentially cut down the connective tissue joining the locules, giving rise to two anther halves, each consisting of two locules. Upon bisecting an anther, the two halves were immediately placed into culture medium. Anther culture and fixations were performed in flat-bottom 96-well plates, using 50 µl solution per well, and one anther half per well. After all anther sets had been placed into wells, 96-well plates were placed on a rotary shaker at 80 rpm and covered to keep the dishes dark. After the specified culture time at room temperature, anthers were fixed as described below. Anther culture medium consisted of 1x Murashige and Skoog medium (GIBCO), 3% sucrose, and 1x Murashige and Skoog vitamins (Sigma) at pH 7.
Duration of meiotic stages in vivo
Bennett et al. determined the duration of meiotic stages for S.
cereale anthers in vivo (Bennett et
al., 1971
). Anther samples were excised from the plant over a time
course and the meiotic stage determined cytologically. These experiments,
however, were performed on plants growing at 20°C, whereas our anther
culture experiments were conducted at room temperature (25°C) and are thus
not directly comparable. In earlier work, Bennett et al. determined the
duration of meiosis for S. cereale, although not the substages, at
several temperatures (Bennett et al.,
1972
). Additionally, Bennett reported that in the angiosperms,
changes in the total duration of meiosis generally result from proportional
changes in all of the meiotic substages
(Bennett, 1977
). To compare our
timing of leptotene with the work of Bennett et al. (Bennett, 1971), we made
the following calculations on the basis of the above data. At 20°C, S.
cereale meiosis lasted 2. 12 days, whereas at 25°C, meiosis lasted
1.63 days (Bennett et al.,
1972
); thus meiosis proceeds 1.3 times slower at the lower
temperature. Bennett et al. report that leptotene occurs over 20 hours at
20°C (Bennett et al.,
1971
). By dividing this value by the temperature-dependence ratio
above (1.3), we would expect leptotene to last roughly 15.4 hours at
25°C.
Drug treatments
Initial drug concentrations were determined from values reported in the
literature. Concentrations were tested in a spindle-function assay in cultured
anthers. Either tapetal cell nuclear divisions (which occur when pairing is
near completion) or meiosis I or II divisions were observed for accurate
chromosome alignment (metaphase) and segregation (anaphase/telophase) by DAPI
staining. Spindle function was used to determine the time required for drugs
to exert their effects. Colchicine and amiprophos methyl (APM) resulted in
failed mitosis after 3 hours of treatment
(Table 1); all treatments were
performed for a minimum of 6 hours.
|
All drugs were stored as 100x stocks in DMSO at -20°C. Colchicine
(Sigma) stocks ranged from 1 mM to 500 mM. For inhibition of telomere
clustering, 100 µM was consistently used. Efficient MT depolymerization
required at least 1 mM colchicine. ß- and
-lumicolchicine (Sigma),
vinblastine sulfate (CalBiochem), podophyllotoxin (Sigma), trimethoxybenzene
(ACROS) and 2-methoxy estradiol (Sigma) were prepared as 10 mM stocks. APM was
a gift of L. Morejohn (University of Texas, Austin) and stored as a 2.5 mM
stock. Drugs were diluted 1:100 in anther culture medium immediately prior to
use. Control medium contained 1% DMSO.
Fixation
For fluorescent in situ hybridization (FISH) experiments, anthers were
fixed for 1 hour in 4% paraformaldehyde in 1x buffer A (80 mM KCl, 20 mM
NaCl, 0.5 mM EGTA, 2 mM EDTA, 15 mM PIPES, 0.35 M sorbitol, 1 mM DTT, 0.5 mM
spermidine, 0.2 mM spermine, pH 7.0) at room temperature. Anthers were
subsequently washed in 1xbuffer A and stored at 4°C.
For MT fixation, anthers were fixed in 8% paraformaldehyde in 1xPHEMS
(60 mM PIPES, 25 mM Hepes, 10 mM EGTA, 2 mM MgCl2, 0.32 M sorbitol,
pH 6.8) for 2 hours at room temperature
(Chan and Cande, 1998
).
Anthers were subsequently washed in 1xPHEMS and stored at 4°C.
FISH procedure
Meiocytes and associated cells from a single anther or anther half were
embedded in 5% acrylamide polymerized between two coverslips. FISH protocols
were essentially as described previously
(Bass et al., 1997
): prehybe I
(1xSSC, 1xbuffer A, 20% formamide), prehybe II (2xSSC, 35%
formamide), prehybe III (2xSSC, 50% formamide). Coverslips were then
incubated in hybridization solution (prehybe III plus approximately 200 ng
probe) for at least 30 minutes (Bass et
al., 1997
). Coverslips were heated 95°C for 5.5 minutes,
transferred to a humid chamber for incubation overnight at room temperature.
Coverslips were washed in 1xPBS. Chromatin was stained with 3 µg/ml
DAPI in 1xPBS. Coverslips were mounted in glycerol. Telomeres were
detected using a probe to the telomere repeat (CCCTAAACCCTAAACCCTAAACCCTAAA)
with either 5' Cy-5 or FITC label (Genset, Paris).
Microtubule immunofluorescence
Meiocytes and associated cells were embedded in 5% acrylamide polymerized
between two coverslips. Cell walls were then digested with 1.5%
ß-glucuronidase (from Helix promatia, Sigma) in 1xPBS for
15 minutes at 36°C. Coverslips were washed thoroughly with 1xPBS. A
monoclonal antibody against sea urchin
-tubulin (a gift of D. Asai,
Purdue University) was applied in 1xPBS at 1:500 dilution and incubated
at room temperature overnight. Coverslips were washed in 1xPBS.
Secondary antibody, Alexa488-conjugated goat anti-mouse IgG (Molecular Probes)
at 1:50 dilution, was applied in 1xPBS and incubated overnight at room
temperature. Coverslips were washed in 1xPBS. Chromatin was stained with
3 µg/ml DAPI, and samples were mounted in glycerol.
Microscopy
All images were acquired with an Applied Precision DeltaVision microscope
system equipped with an Olympus IX70 inverted microscope. A 40x 1.35 NA
UApo oil immersion lens was used for all experiments. Cells were imaged in
three dimensions (xyz); z-axis sections were collected at 0.2 µm spacing.
Images were deconvolved using a standard conservative algorithm
(Chen et al., 1995
).
Modeling and quantification
Models of nuclei were created using the DeltaVision/softWoRx 3DModel
program. The nuclear periphery was modeled on the outer edge of DAPI-stained
chromatin. A single point was picked for each telomere detected by FISH; we
attempted to pick the peak intensity of the signal. 3DModel data were imported
into MATLAB (version 5.1.0.420, The MathWorks, Inc.) for analyses. Two
measurements were calculated to determine the degree of telomere clustering:
(1) all pairwise telomere-to-telomere distances, which are referred to as
telomere distances; and (2) the minimum of all possible telomere-to-telomere
distances for each telomere, which are referred to as nearest neighbor
distances. Nearest neighbor distances were used to judge small changes in
telomere distributions. All distance measurements were normalized to the
nuclear radius.
Telomere and nearest neighbor distances are presented as the distribution of means from individual nuclei in a given sample. All possible distances were calculated for a single nucleus, the mean of the distances for a single nucleus was obtained, and the mean distances from all nuclei in a sample were combined. Distributions (box-whisker plots) or means (t-test) are presented. Sample means (the mean of the mean distances) are described plus or minus the standard deviation. Differences were assessed at 99.9% confidence (P=0.001) using an unequal variance Student's t-test, unless indicated otherwise.
| Results |
|---|
|
|
|---|
|
|
Premeiotic interphase nuclei (Fig. 1a) have uncondensed chromatin, unfused nucleoli and polarized but dispersed telomeres. Telomere polarization, perhaps indicative of a Rabl chromosome configuration, was suggested by telomeres that resided in one nuclear hemisphere and were located in the nuclear periphery. Premeiotic nuclei could be distinguished from somatic nuclei in the anther because the diameter of the premeiotic nuclei was several micrometers greater than the diameter of somatic nuclei. Nuclei were defined as leptotene if they contained visible chromatin threads (Fig. 1b) of irregular widths. Telomeres were scattered in one half of the nuclear periphery in leptotene nuclei and nucleoli were unfused.
Nuclei were classified as zygotene if they contained two types of chromatin
fibers (Fig. 1c): one regular
chromatin thread with clearly visible edges, which is likely to represent the
paired homologous chromosomes and a second fuzzy-edged chromatin thread of
irregular width, similar to leptotene chromosomes. Fully clustered telomeres
were found predominantly during zygotene. The delineated chromosome threads
were located in the nuclear hemisphere containing the bouquet, whereas the
leptotene-like chromatin threads were found away from the telomere cluster
site. This is a classic example of zygotene
(Wilson, 1925
), the chromatin
thread morphologies most probably representing paired and unpaired chromosome
territories. Nucleolar fusion appeared to take place during zygotene;
nucleolar number varied during this stage even among meiotic cells from a
single anther.
In pachytene nuclei (Fig. 1d), the chromosome threads were distinct throughout the nucleus, being both of equal width and regularly spaced. The telomere cluster was dispersed in pachytene, and telomeric heterochromatin was barely distinguishable from the rest of the chromosome, probably due to continued chromatin condensation.
In our analyses of meiosis in S. cereale cv. `Blanco', we
established that the bouquet is present during zygotene
(Fig. 1c), as defined by the
appearance of the chromosome fibers. Classic examples of the bouquet in
organisms such as lily and salamander as well as more recent studies using
model genetic organisms such as Saccharomyces cerevisiae and maize
demonstrate that the telomere cluster is generally seen during zygotene
(Scherthan, 2001
). However,
Mikhailova et al., studying a different inbred line of rye, place the
formation of the telomere cluster in premeiotic interphase (Mikhailova, 2001).
It is possible that either strain variations or the different fixation methods
employed could account for this temporal discrepancy within S.
cereale.
Telomere clustering can proceed in an in vitro anther culture
system
There are three anthers in each S. cereale floret
(Fig. 2a), and each single
anther contains several hundred meiotic cells. In rye, as in many grasses, the
meiotic cells of a single anther are developmentally synchronous throughout
meiosis (Fig. 2b); the three
anthers of one floret are also meiotically synchronous
(Fig. 2a). To establish the
starting stage, one anther half was fixed immediately (time 0). The remaining
anther halves were allowed to progress through meiosis in culture.
Experiments were initially evaluated for success by examining the chromatin morphology at time 0 and after various time periods of in vitro culture. Experiments were assessed for progression in meiotic stage between time 0 and the end of the culture period. Nuclei were scored for chromatin appearance, nucleolar number and relative nuclear diameter. Additionally, mitosis in the tapetal cells was monitored.
Indicators of unsuccessful anther culture were micronuclei, collapsed or
shrunken nuclei, burst nuclei or aberrant chromatin appearance, most often
decondensed chromatin. Distinguishing successful anther culture experiments
was straightforward, as gross abnormalities were easily detected at the light
microscope level. Anthers that were cultured for longer than 36 hours very
rarely yielded normal-appearing nuclei in preliminary experiments; hence all
experimental results described here were from experiments of 24 hours or less
in duration. Since meiosis in S. cereale is more than one and a half
days in duration at 25°C (Bennett et
al., 1971
), we were unable to obtain a complete meiotic sequence
in any one experiment. However, the interval from premeiotic interphase to
zygotene could be completed within 10-16 hours in our in vitro culture system
(for example, Figs 3 and
6) (C.R.C. and W.Z.C.,
unpublished), and thus bouquet formation could be studied readily in cultured
anthers.
|
|
Over the course of 95 experiments using optimized medium conditions and
culture periods less than 24 hours, 29 successful experiments were performed,
giving a success rate of approximately 30%. Successful anther culture
experiments accurately approximated in vivo meiotic progression. Meiotic
chromosome morphology of cells from cultured anthers appeared to be identical
to that of meiotic cells from anthers taken directly from the plant (compare
Fig. 3 control with
Fig. 5 time 0). Meiotic cells
of a single cultured anther (or anther half) remained synchronous throughout
the culture period, evidenced both cytologically (data not shown) and by the
small standard deviations for telomere distance measurements (discussed
below). Failed anther culture experiments may result from mishandling of the
tissue, leading to damage and general necrosis, or may be correlated with some
unknown environmental factor, such as growth conditions in the greenhouse that
affect general anther health. The failure of meiotic progression in such cases
appears to be an all or nothing response, affecting the entire meiotic cell
population of an anther as opposed to a subset of cells. Our anther culture
experiments suggested that the interval between premeiotic interphase and the
bouquet stage, corresponding to leptotene, could be completed in 10-16 hours
(see above). Importantly, the duration of leptotene we determined is in
agreement with that obtained previously
(Bennett et al., 1971
) for the
duration of S. cereale meiotic stages in vivo (15.4 hours; see
Materials and Methods).
|
The drugs we initially tested in our investigation are known MT-depolymerizing agents, and monitoring spindle function provided a straightforward means of testing drug effectiveness. Anthers were split and the halves were placed in control or drug-containing medium. After 0.5, 1, 2, 3, 4 or 5 hours in culture, anthers were fixed and examined for indications of MT function. Colchicine and APM inhibited cell division after 3 hours of culture, as indicated by the failure of metaphase chromosomes to align in the spindle midzone or undergo anaphase chromosome separation in the drug-treated cells (Table 1). Control cells either exhibited normal metaphase alignment or had already completed division (Table 1).
Colchicine inhibits meiotic telomere clustering
We investigated the effect of colchicine on bouquet formation. Colchicine
is an effective MT depolymerizing agent in plants at millimolar or greater
concentrations (Morejohn,
1991
), while at 100 µM, its effects on MTs are less pronounced
or undetectable (Liu et al.,
1995
). Previous experiments examining the effect of colchicine on
meiotic prophase have used high colchicine concentrations (1-25 mM), which
have the potential of toxic side effects. We assessed the concentration
dependence of the effect of colchicine on bouquet formation in the range from
25 µM-5 mM (data not shown). Colchicine was effective in inhibiting
telomere clustering at concentrations as low as 25 µM in anther culture,
although only a subset of cells were affected. All meiotic cells in an anther
were affected at concentrations greater than 75 µM, and thus 100 µM
colchicine was used in all subsequent experiments examining bouquet formation.
Anthers containing premeiotic interphase or early leptotene cells were
cultured in colchicine for 10-16 hours, allowing sufficient time for bouquet
formation (Fig. 3). At the
beginning of these experiments, all meiotic cells exhibited dispersed
telomeres. The telomeres were associated with the nuclear periphery and were
polarized within the nucleus. At the end of the culture period, untreated
nuclei showed a prominent telomere cluster, indicated by closely associated
telomere FISH signals. Nuclei treated with either 5 mM or 100 µM colchicine
did not form a bouquet; telomeres remained dispersed. The telomere
distribution in colchicine-treated cells was similar to that observed in time
0 cells; the peripheral localization and polarization of telomeres within the
nucleus were retained after colchicine treatment. The results were similar for
both colchicine concentrations.
Telomere distributions in colchicine-treated nuclei were analyzed by calculating mean telomere and nearest neighbor distances (see Materials and Methods) (Fig. 4a,b). The telomere distance (Fig. 4a) in nuclei treated with 100 µM colchicine for 10-16 hours (1.13±0.07, n=20) was not significantly different from telomere distances in time 0 nuclei (1.15±0.09, n=26). The mean nearest neighbor distance (Fig. 4b), however, differed slightly but significantly between time 0 (0.30±0.05, n=26) and 100 µM colchicine-treated (0.26±0.05, n=20) nuclei after 10-16 hours, indicating that limited telomere juxtaposition occurred in colchicine-treated cells.
|
Colchicine does not inhibit telomere dispersal from the bouquet
To determine whether colchicine affected telomere dispersal as cells enter
pachytene, anthers containing bouquet-stage cells were cultured with 100 µM
colchicine for 14-18 hours, allowing sufficient time for telomere migration
out of the bouquet (Fig. 5).
Time 0 anthers showed a prominent telomere cluster. At the end of the culture
period, both untreated and colchicine-treated nuclei were marked by dispersed
telomeres. Thus, telomere movement resulting in bouquet dissolution did not
appear to be affected by colchicine.
Depolymerization of cytoplasmic microtubules does not inhibit
telomere clustering
We wished to determine whether colchicine's inhibitory effect on bouquet
formation was a result of cytoplasmic MT depolymerization. The concentration
of colchicine that exerts a maximal effect on bouquet formation (100 µM)
was much lower than the concentrations commonly employed to affect MTs in
plants (Morejohn, 1991
), and
cytoplasmic MT arrays were present in the meiocytes. However it was possible
that these arrays were subtlety disturbed. Thus, we used APM, a highly
effective MT depolymerizing agent in higher plants
(Bajer and Mole-Bajer, 1986
)
and green algae (Collis and Weeks,
1978
), to assess whether cytoplasmic microtubules were required
for bouquet formation.
To investigate the effect of MT depolymerization on telomere clustering, anthers in early meiotic prophase were cultured with 25 µM APM for 12-16 hours, allowing for meiotic progression (Fig. 6). Time 0 nuclei displayed unclustered telomeres; telomeres were distributed over approximately half of the nuclear surface. Telomeres were fully clustered in both untreated and APM-treated nuclei after culture (Fig. 6). To determine whether colchicine and APM depolymerized cytoplasmic MTs during meiotic prophase at the concentrations used, we observed the organization of MTs after 15 hours of treatment with colchicine or APM (Fig. 7). Untreated meiotic cells exhibited an array of MTs asymmetrically distributed around the nucleus (Fig. 7a). Cells treated with 5 mM colchicine (Fig. 7c) or 25 uM APM did not have visible MTs (Fig. 7b). Cells treated with 100 µM colchicine (Fig. 7d) appeared to contain a normal MT array, although a few cells within the sample (less than 10%) appeared to have aberrant MT distributions (data not shown). We conclude that cytoplasmic MT arrays are not required for telomere clustering. This suggests that the inhibitory effects of colchicine on bouquet formation may not be mediated through cytoplasmic MT depolymerization.
|
Bouquet inhibition is specific to colchicine and podophyllotoxin
We tested compounds structurally related to colchicine and additional
MT-depolymerizing drugs for effects on the bouquet. The selected drugs
(Table 2) were used to address
three questions. (1) Are the bouquet target and tubulin pharmacologically
identical? The ß-tubulin molecule contains several distinct binding sites
for anti-mitotic drugs. Colchicine and podophyllotoxin bind to one site,
whereas vinblastine binds to another site
(Wilson and Jordan, 1994
;
Hamel, 1996
). (2) Is the
colchicine A-ring sufficient for bouquet inhibition? Colchicine and
podophyllotoxin contain identical methoxybenzene rings, and we wished to
determine whether this ring was the only requirement for bouquet inhibition.
3-methoxy estradiol and trimethoxybenzene share the conserved ring, and
3-methoxy estradiol binds weakly to the colchicine-binding site on
ß-tubulin (Hamel, 1996
).
(3) Do toxic colchicine side effects, for example, interactions with
membranes, result in a failure of bouquet formation? Lumicolchicine is a
non-MT binding derivative of colchicine, with similar lipophilic properties,
which should act as a control for the potential membrane-disrupting actions of
colchicine.
|
Anthers containing meiotic cells in early prophase were treated separately
with the various drugs and cultured for 12-18 hours. Telomere distribution was
determined by heterochromatin; MTs were judged by immunofluorescence, as
described in Fig. 7. Time 0
anthers contained meiotic nuclei with dispersed telomeres. Untreated nuclei
that exhibited clustered telomeres were compared with the drug-treated nuclei
to determine the presence or absence of the bouquet and cytoplasmic
microtubules. Of the drugs tested, we found that only colchicine and the
related compound podophyllotoxin inhibited telomere clustering. The remaining
drugs had no obvious effects on bouquet formation even though several of the
drugs disrupted cytoplasmic microtubules
(Table 2). Importantly, the
non-MT depolymerizing derivatives of colchicine, ß- and
-lumicolchicine, did not affect telomere clustering, suggesting that
lipophylic-based side effects are an unlikely cause of bouquet inhibition.
| Discussion |
|---|
|
|
|---|
Our experiments demonstrate that telomere clustering is sensitive to
colchicine, although the failure of telomere clustering cannot be a direct
consequence of the drug's effects on the cytoplasmic MTs. MT depolymerization
and bouquet inhibition showed distinct differences in their
concentration-dependent response to colchicine. Bouquet inhibition was
observed with concentrations of colchicine (100 µM) that did not appear to
affect the cytoplasmic MT organization in the meiotic cell. This distinction
is only possible because of the relative insensitivity of plant MTs to
colchicine (Morejohn, 1991
),
and thus experiments in animals would be unlikely to reveal this important
detail. Further evidence of the independence of telomere clustering and the MT
cytoskeleton was revealed by the finding that APM and vinblastine sulfate did
not inhibit telomere clustering at concentrations that lead to microtubule
deploymerization.
Colcemid, a colchicine derivative, inhibits meiotic prophase chromosome
movements (Salonen et al.,
1982
). Zygotene chromosomes in rat spermatocytes exhibit
oscillatory and rotational movements
(Parvinen and Soderstrom,
1976
); however, these movements do not occur in the presence of
colcemid (Salonen et al.,
1982
). The chromosome movement was unaffected by vinblastine. The
drug sensitivity of zygotene chromosome movements in the rat is similar to our
observations regarding the specificity of the inhibition of telomere
clustering by colchicine-related drugs. This observation suggests that the
colcemid-sensitive chromosome movements in rat spermatocytes at zygotene are
likely to be related to the chromosome movements associated with telomere
clustering.
Prior to our study, there was intriguing evidence that colchicine inhibited
premeiotic telomere clustering in S. cereale
(Bowman and Rajhathy, 1976
).
The fusion of large subtelomeric heterochromatic regions of the rye
chromosomes was blocked in early premeiotic interphase by 5 mM colchicine
treatment. The authors found, however, that bouquet formation was unaffected
(Bowman and Rajhathy, 1976
).
The different fixation methods employed or alternative staging criteria might
have lead to this discrepency. We detected no evidence of premeiotic telomere
clustering in S. cereale (other than a persistent telomere
polarization; Fig. 1) and
conclude that colchicine exclusively blocked formation of the zygotene bouquet
in our analyses.
Only colchicine and the related compound podophyllotoxin appeared to
inhibit bouquet formation, whereas vinblastine and APM caused MT
depolymerization but did not affect telomere clustering. Colchicine and
podophyllotoxin have been shown to bind to the same site on ß-tubulin,
whereas vinblastine and APM bind elsewhere on the tubulin dimer
(Morejohn, 1991
;
Wilson and Jordan, 1994
). The
non-MT binding derivatives of colchicine, ß- and
-lumicolchicine,
and 2-methoxy estradiol and trimethoxybenzene, which share part of the ring
structure of colchicine and podophyllotoxin, did not affect telomere
clustering, suggesting that a specific colchicine-binding target with
similarities to ß-tubulin is required.
The results presented suggest the colchicine target involved in telomere
clustering is not the cytoplasmic MT cytoskeleton. It is necessary to consider
other potential targets. The similarity in specificity of colchicine for
ß-tubulin and the bouquet target suggests that the bouquet target may be
a specialized non-MT tubulin, such as membrane-associated tubulin
(Stephens, 1986
) or a
tubulin-related protein. Palmitylation of tubulin promotes tubulin association
with membranes (Stephens,
1986
); however, this process in vitro is inhibited by many drugs
that promote microtubule depolymerization, including not only colchicine but
also vinblastine and nocodazole (Caron,
1997
). The drug sensitivity and the roles of the recently
identified
-,
-,
- and
-tubulins
(Dutcher, 2001
) remain to be
elucidated, especially in the context of the meiotic cell cycle. One of these
proteins may be involved in bouquet formation and be sensitive to colchcine.
Finally, it is possible that the target is not related to tubulin. Although
colchicine disruption of non-microtubule targets and processes are usually
also affected by lumicolchicine, Weiner et al. have recently demonstrated that
colchicine but not lumicolchicine is an antagonist of gamma-amino-butyric acid
(GABA) A receptor function (Weiner et al.,
1998
). This is an example of a non-tubulin target with
drug-binding specificity similar to that of bouquet inhibition.
Colchicine-induced non-specific membrane damage or changes in nuclear
architecture are unlikely to be the cause of bouquet inhibition. Although
colchicine binds to cellular membranes at high concentrations
(Stadler and Franke, 1974
),
the bouquet formed normally in lumicolchicine-treated cells, suggesting that
the effect of colchicine was specific and not a result of its lipophilic
properties. Bouquet dispersal proceeded normally in colchicine-treated cells,
demonstrating that colchicine does not affect all telomere movements on the
nuclear envelope. By light microcopy, there were no cytological indications of
damage after colchicine treatment.
An early step in bouquet formation is a rearrangement of nuclear pores
around the nuclear envelope. This has been demonstrated in a variety of
meiotic cells, including mouse and human
(Scherthan et al., 2000
) and
lily (Holm, 1977
) cells. We
have shown that the spatial redistribution of nuclear pores around the nuclear
envelope that accompanies bouquet formation in S. cereale occurs
normally in meiotic cells treated with 100 µM colchicine
(Cowan et al., 2002
). It
appears, therefore, that colchicine targets a specific step in telomere
clustering rather than other changes in nuclear envelope architecture that may
accompany or be required for telomere movement
Telomeres in colchicine-treated nuclei were located in the nuclear
periphery, and thus colchicine appeared to block the lateral movement of
telomeres on the nuclear envelope rather than alter their association with the
nuclear envelope. However, the persistent Rabl organization of S.
cereale chromosomes and the large blocks of subtelomeric heterochromatin
may predispose rye telomeres to reside near or on the nuclear envelope even in
the presence of colchicine (Hochstrasser
et al., 1986
). Our finding that minimal telomere clustering
appeared in colchicine-treated nuclei, as shown by the formation of telomere
miniclusters and by the shift to smaller nearest neighbor distances
(Fig. 4b), suggests that some
telomere movement occurs despite the ultimate failure of bouquet formation.
The formation of miniclusters, small groups of telomeres, was also observed in
untreated leptotene nuclei (Fig.
1b). We suspect that minicluster forrmation observed in
colchicine-treated cells represents an intermediate in bouquet formation. We
have not determined whether the miniclusters are random telomere associations
or reflect a step in homologous chromosome recognition.
In summary, we have demonstrated that colchicine specifically inhibits bouquet formation. Since colchicine has been shown in many different meitoic cells to disrupt the pairing of homologous chromosomes and their subsequent synapsis, our results strongly suggest that the clustering of telomeres on the nuclear envelope during meiotic prophase plays an essential role in homologous chromosome pairing. By bringing homologs into proximity with an appropriate alignment, the bouquet is likely to promote timely synapsis. The mechanism of telomere movement on the nuclear envelope during bouquet formation is unknown; however, our analyses demonstrate that bouquet formation can occur in the absence of cytoplasmic microtubules. Our observations suggest that the mechanism for generating the chromosome movements associated with bouquet formation may be autonomous to the nucleus rather than being generated by the cytoplasmic cytoskeleton.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Bajer, A. S. and Mole-Bajer, J. (1986). Drugs with colchicine-like effects that specifically disassemble plant but not animal microtubules. Ann. NY Acad. Sci. 466,767 -784.[CrossRef][Medline]
Barber, H. N. (1942). The experimental control of chromosome pairing in Fritillaria. Genetics 43,359 -374.
Bass, H. W., Marshall, W. F., Sedat, J. W., Agard, D. A. and
Cande, W. Z. (1997). Telomeres cluster de novo before the
initiation of synapsis: A three-dimensional spatial analysis of telomere
positions before and during meiotic prophase. J. Cell
Biol. 137,5
-18.
Bass, H. W., Riera-Lizarazu, O., Ananiev, E. V., Bordoli, S. J., Rines, H. W., Phillips, R. L., Sedat, J. W., Agard, D. A. and Cande, W. Z. (2000). Evidence for the coincident initiation of homolog pairing and synapsis during the telomere-clustering (bouquet) stage of meiotic prophase. J. Cell Sci. 113,1033 -1042.[Abstract]
Bennett, M. D. (1977). The time and duration of meiosis. Phil. Trans. R. Soc. Lond. B 277,201 -226.[Medline]
Bennett, M. D., Chapman, V. and Riley, R.
(1971). The duration of meiosis in pollen mother cells of wheat,
rye and Triticale. Proc. R. Soc. Lond. B
178,259
-275.
Bennett, M. D., Smith, J. B. and Kemble, R. (1972). The effect of temperature on meiosis and pollen development in wheat and rye. Can. J. Genet. Cytol. 14,615 -624.
Bhojwani, S. S. and Razdan, M. K. (eds) (1996). Plant Tissue Culture: Theory and Practice, a Revised Edition. Amsterdam: Elsevier Science.
Bowman, J. G. and Rajhathy, T. (1976). Fusion of chromocenters in premeiotic interphase of Secale cereale and its possible relationship to chromosome pairing. Can. J. Genet. Cytol. 19,313 -321.
Caron, J. M. (1997). Posttranslational modification of tubulin by palmitoylation: I. In vivo and cell-free studies. Mol. Biol. Cell 8,621 -636.[Abstract]
Chan, A. and Cande, W. Z. (1998). Maize meiotic spindles assemble around chromatin and do not require paired chromosomes. J. Cell Sci. 111,3507 -3515.[Abstract]
Chen, H., Swedlow, J. R., Grote, M., Sedat, J. W. and Agard, D. A. (1995). The collection, processing, and display of digital three-dimensional images of biological specimens. In Handbook of Biological Confocal Microscopy, (ed. J. B. Pawley), pp.197 -210. New York: Plenum Press.
Collis, P. S. and Weeks, D. P. (1978).
Selective inhibition of tubulin synthesis by amiprophos methyl during
flagellar regeneration in Chlamydomonas reinhardi.Science 202,440
-442.
Cooper, J. P., Watanabe, Y. and Nurse, P. (1998). Fission yeast Taz1 protein is required for meiotic telomere clustering and recombination. Nature 392,828 -831.[CrossRef][Medline]
Cowan, C. R., Carlton, P. M. and Cande, W. Z.
(2001). The polar arrangement of telomeres in interphase and
meiosis. Rabl organization and the bouquet. Plant
Physiol. 125,532
-538.
Cowan, C. R., Carlton, P. M. and Cande, W. Z.
(2002). Reorganization and polarization of the meiotic
bouquet-stage cell can be uncoupled from telomere clustering. J.
Cell Sci. 115,3757
-3766.
Darlington, C. D. (1933). The origin and behaviour of chiasmata. VIII Secale cereale (n, 8). Cytologia 4,444 -452.
de Jong, J. H., Hawekes, F. W., Roca, A. and Naranjo, T. (1991). Synapsis and chiasma formation in a ditelo-substituted haploid of rye. Genome 34,109 -120.
Driscoll, C. and Darvey, N. (1970). Chromosome pairing: effect of colchicine on an isochromosome. Science 169,687 -688.
Driscoll, C., Darvey, N. and Barber, H. (1967). Effect of colchicine on meiosis of hexaploid wheat. Nature 216,687 -688.[CrossRef]
Dutcher, S. K. (2001). The tubulin fraternity: alpha to eta. Curr. Opin. Cell Biol. 13, 49-54.[CrossRef][Medline]
Esponda, P. and Gimenez-Martin, G. (1972). The attachment of the synaptonemal complex to the nuclear envelope. An ultrastructural and cytochemical analysis. Chromosoma 38,405 -417.[CrossRef][Medline]
Gelei, J. (1921). Weitere Studien uber die Oogenese des Dendrocoelum lacteum. II. Die Langskonjugation der Chromosomen. Archiv Zellforschung 16,88 -169.
Hamel, E. (1996). Antimitotic natural products and their interactions with tubulin. Med. Res. Rev. 16,207 -231.[CrossRef][Medline]
Havekes, F. W. J., de Jong, J. H., Heyting, C. and Ramanna, M. S. (1994). Synapsis and chiasma formation in four meiotic mutants of tomato (Lycopersicon esculentum). Chromosome Res. 2,315 -325.[CrossRef][Medline]
Hochstrasser, M., Mathog, D., Gruenbaum, Y., Saumweber, H. and
Sedat, J. W. (1986). Spatial organization of chromosomes in
the salivary gland nuclei of Drosophila melanogaster. J. Cell
Biol. 102,112
-123.
Holm, P. B. (1977). Three dimensional reconstruction of chromosome pairing during the zygotene stage of meiosis in Lilium longiflorum (Thunb.). Carlsberg Res. Commun. 42,103 -151.
Ito, M. and Stern, H. (1967). Studies of meiosis in vitroI. In vitro culture of meiotic cells. Dev. Biol. 16,36 -53.[CrossRef][Medline]
Lima de Faria, A. (1952). Chromomere analysis of the chromosome complement of rye. Chromosoma 5, 1-68.[CrossRef][Medline]
Liu, B., Joshi, H. C. and Palevitz, B. A. (1995). Experimental manipulation of gamma-tubulin distribution in Arabidopsis using anti-microtubule drugs. Cell Motil. Cytoskeleton. 31,113 -129.[CrossRef][Medline]
Loidl, J. (1989). Colchicine action at meiotic prophase revealed by SC-spreading. Genetica 78,195 -203.[CrossRef]
Loidl, J. (1990). The initiation of meiotic chromosome pairing: the cytological view. Genome 33,759 -778.[Medline]
Maguire, M. (1974). A new model for homologous chromosome pairing. Caryologia 27,349 -357.
Mikhailova, E. I., Sosnikhina, S. P., Kirillova, G. A., Tikholiz, O. A., Smirnov, V. G., Jones, R. N. and Jenkins, G. (2001). Nuclear dispositions of subtelmeric and pericentromeric chromosomal domains during meiosis in asynaptic mutants of rye (Secale cereale L.). J. Cell Sci. 114,1875 -1882.[Abstract]
Moens, P. B. (1969). The fine structure of meiotic chromosome polarization and pairing in Locusta migratiriaspermatocytes. Chromosoma 28, 1-25.[CrossRef][Medline]
Morejohn, L. C. (1991). The molecular pharmacology of plant tubulin and microtubules. In The cytoskeletal basis of plant growth and form (ed. C. Lloyd), pp.29 -43. London: Academic Press.
Nimmo, E. R., Pidoux, A. L., Perry, P. E. and Allshire, R. C. (1998). Defective meiosis in telomere-silencing mutants of Schizosaccharomyces pombe. Nature 392,825 -828.[CrossRef][Medline]
Parvinen, M. and Soderstrom, K. O. (1976). Chromosome rotation and formation of synapsis. Nature 260,534 -535.[CrossRef][Medline]
Rasmussen, S. W. and Holm, P. B. (1980). Mechanics of meiosis. Hereditas 93,187 -216.[Medline]
Salonen, K., Paranko, J. and Parvinen, M. (1982). A colcemid-sensitive mechanism invovled in regulation of chromosome moevements during meiotic prophase. Chromosoma 85,611 -618.[CrossRef][Medline]
Santos, J. L., Jimenez, M. M. and Diez, M. (1994). Meiosis in haploid rye: Extensive synapsis and low chiasma frequency. Heredity 73,580 -588.
Scherthan, H. (2001). A bouquet makes ends meet. Nat. Rev. Mol. Cell Biol. 2, 621-627.[CrossRef][Medline]
Scherthan, H., Jerratsch, M., Li, B., Smith, S., Hulten, M.,
Lock, T. and de Lange, T. (2000). Mammalian meiotic
telomeres: Protein composition and redistribution in relation to nuclear
pores. Mol. Biol. Cell.
11,4189
-4203.
Scherthan, H., Liebe, B. and Trelles-Sticken, E. (2001). Chromosome topology before and during first meiotic prophase. Chromosome Res. 9, 18.
Scherthan, H., Weich, S., Schwegler, H., Heyting, C., Haerle, M.
and Cremer, T. (1996). Centromere and telomere movements
during early meiotic prophase of mouse and man are associated with the onset
of chromosome pairing. J. Cell Biol.
134,1109
-1125.
Shepard, J., Boothroyd, E. R. and Stern, H. (1974). The effect of colchicine on synapsis and chiasma formation in microsporocytes of Lilium. Chromosoma 44,423 -437.
Stadler, J. and Franke, W. W. (1974).
Characterization of the colchicine binding of membrane fractions from rat and
mouse liver. J. Cell Biol.
60,297
-303.
Stephens, R. E. (1986). Membrane tubulin. Biol. Cell. 57,95 -109.[Medline]
Tepperberg, J. H., Moses, M. J. and Nath, J. (1997). Colchicine effects on meiosis in the male mouse. Chromosoma 106,183 -192.[CrossRef][Medline]
Trelles-Sticken, E., Loidl, J. and Scherthan, H. (1999). Bouquet formation in budding yeast: Initiation of recombination is not required for meiotic telomere clustering. J. Cell Sci. 112,651 -658.[Abstract]
Trelles-Sticken, E., Dresser, M. E. and Scherthan, H.
(2000). Meiotic telomere protein Ndj1p is required for
meiosis-specific telomere distribution, bouquet formation and efficient
homologue pairing. J. Cell Biol.
151,95
-106.
Wang, X. (1988). Chromosome pairing analysis in haploid wheat by spreading of meiotic nuclei. Carlsberg Res. Commun. 53,135 -166.
Weiner, J. L., Buhler, A. V., Whatley, V. J., Harris, R. A. and
Dunwiddie, T. V. (1998). Colchicine is a competitive
antagonist at human recombinant gamma-aminobutyric acidA receptors.
J. Pharmacol. Exp. Therap.
284,95
-102.
Westergaard, M. and von Wettstein, D. (1972). The synaptonemal complex. Annu. Rev. Genet. 6, 71-110.[CrossRef][Medline]
Wilson, E. B. (1925). The cell in development and heredity New York: Macmillan.
Wilson, L. and Jordan, M. A. (1994). Pharmacological probes of microtubule function. In Microtubules. Vol. 13 (eds J. S. Hyams and C. W. Lloyd), pp. 59-83. New York: Wiley-Liss, Inc.
Zickler, D. and Kleckner, N. (1998). The leptotene-zygotene transition of meiosis. Annu. Rev. Genet. 32,619 -697.[CrossRef][Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
Related articles in JCS:
This article has been cited by other articles:
![]() |
D. Y. Lui, T. L. Peoples-Holst, J. Chang Mell, H.-Y. Wu, E. W. Dean, and S. M. Burgess Analysis of Close Stable Homolog Juxtaposition During Meiosis in Mutants of Saccharomyces cerevisiae Genetics, July 1, 2006; 173(3): 1207 - 1222. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Trelles-Sticken, C. Adelfalk, J. Loidl, and H. Scherthan Meiotic telomere clustering requires actin for its formation and cohesin for its resolution J. Cell Biol., July 18, 2005; 170(2): 213 - 223. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Harper, I. Golubovskaya, and W. Z. Cande A bouquet of chromosomes J. Cell Sci., August 15, 2004; 117(18): 4025 - 4032. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. M. Carlton, C. R. Cowan, and W. Z. Cande Directed Motion of Telomeres in the Formation of the Meiotic Bouquet Revealed by Time Course and Simulation Analysis Mol. Biol. Cell, July 1, 2003; 14(7): 2832 - 2843. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Trelles-Sticken, J. Loidl, and H. Scherthan Increased ploidy and KAR3 and SIR3 disruption alter the dynamics of meiotic chromosomes and telomeres J. Cell Sci., June 15, 2003; 116(12): 2431 - 2442. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. N. Golubovskaya, L. C. Harper, W. P. Pawlowski, D. Schichnes, and W. Z. Cande The pam1 Gene Is Required for Meiotic Bouquet Formation and Efficient Homologous Synapsis in Maize (Zea mays L.) Genetics, December 1, 2002; 162(4): 1979 - 1993. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||