|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
doi: 10.1242/10.1242/jcs.00054
Research Article |
1 Department of Plant and Microbial Biology, University of California
Berkeley, Berkeley, CA 94720-3200, USA
2 Department of Molecular and Cell Biology, University of California
Berkeley, Berkeley, CA 94720-3200, USA
* Author for correspondence (e-mail: zcande{at}uclink4.berkeley.edu)
Accepted 14 July 2002
| Summary |
|---|
|
|
|---|
Key words: Bouquet, Telomere clustering, Meiosis, Nuclear pore clustering, Cell polarity
| Introduction |
|---|
|
|
|---|
The meiotic telomere cluster is often compared to another example of
chromosome polarization present in many cell types, the Rabl organization
(Cowan et al., 2001
). The Rabl
organization results from persistence of the chromosome configuration brought
about by spindle forces during mitosis; decondensed interphase chromosomes
retain their anaphase arrangement. The consequence of this organization in
metacentric organisms, including rye, is the formation of a nuclear axis, with
telomeres defining one pole (i.e. the telomere pole) and the centromeres
determining the opposite pole. The meiotic telomere cluster may be a remnant
of the Rabl organization (Zickler and
Kleckner, 1998
); whether bouquet stage and Rabl telomere poles are
similarly oriented with respect to cytoplasmic organelles is not known. As the
nucleus reforms during telophase, the centromeres are adjacent to the
centrosome left over from the previous cell division. By contrast, during the
bouquet stage, the centrosome in animal and yeast cells is adjacent to the
telomere cluster. This suggests that the telomere cluster may have an altered
orientation relative to the pre-existing cell axis when compared with
polarized Rabl telomeres in a premeiotic cell.
Possible extra-chromosomal influences on telomere position during the
bouquet stage have been extensively noted
(Zickler and Kleckner, 1998
).
In animal and fungal cells, there is a marked proximity between the clustered
telomeres and the microtubule organizing center (MTOC; centrosome and spindle
pole body, respectively) during the bouquet stage
(Buchner, 1910
;
Trelles-Sticken et al., 1999
;
Wilson, 1925
;
Zickler and Kleckner, 1998
).
Mitochondria are asymmetrically distributed in meiotic cells; the mitochondria
aggregate adjacent to the nucleus, near the region of telomere clustering
(Wilson, 1925
). A
`mitochondria cloud' has been observed in the animals
(al-Mukhtar and Webb, 1971
;
Church, 1976
;
Holm and Rasmussen, 1980
;
Moens, 1969
;
Rasmussen, 1976
;
Tourte et al., 1981
) and
plants (Hiraoka and Fuchikawa,
1993
) in which it has been investigated, suggesting that it may be
intimately tied to telomere clustering. In addition, many plants exhibit
clustering of plastids near the bouquet-stage nucleus
(Hiraoka, 1949a
;
Hiraoka, 1949b
;
Hiraoka and Fuchikawa, 1993
;
Rodkiewicz et al., 1986
);
however, in Equisetum, the plastids occupy a position diametrically
opposed to the mitochondria cloud (Hiraoka
and Fuchikawa, 1993
). Nuclear pores (NPs) appear to redistribute
around the nuclear envelope when telomere clustering occurs
(Zickler and Kleckner, 1998
).
NPs aggregate into several large regions, often located near the telomeres,
although the immediate site of telomere-nuclear envelope contact is generally
devoid of NPs (Church, 1976
;
Hiraoka and Fuchikawa, 1993
;
Holm, 1977
;
Scherthan et al., 2000
).
Nuclear displacement accompanies bouquet formation in a wide range of
organisms, including representatives of both the plant and animal kingdoms
(Hiraoka, 1952
;
Wilson, 1925
).
The clustering of telomeres into a small area and the polarization of this
cluster along an axis can be regarded as two distinct phenomena. In both
cases, the mechanisms are unknown. Do telomeres respond to a pre-existing cue
in the cell that defines the site of the telomere cluster or is the telomere
cluster initially randomly oriented? Because of the telomere cluster's
proximity to the MTOC during the bouquet stage in many organisms, the question
is most often viewed from the perspective of the MTOC: does the centrosome act
as a telomere attractant or do clustered telomeres recruit the centrosome?
Higher plants do not have focused MTOCs, although most species investigated
display telomere clustering. In plants, the nuclear envelope appears to
organize cytoplasmic MTs during both the somatic
(Baskin and Cande, 1990
;
Stoppin et al., 1994
;
Vantard et al., 1990
;
Zhang et al., 1990
) and
meiotic (Chan and Cande, 1998
)
cell cycles. Is there a relationship between the site of telomere clustering
and cytoplasmic microtubule organization in plants?
The present study addresses the organizing principles behind telomere clustering. We are concerned with the fundamental question: does the position of the telomere cluster polarize the cell or is there pre-determined, telomere-independent polarity in the meiotic cell? Bouquet-stage rearrangements are not limited to telomere clustering; cytoplasmic microtubules (MTs), NPs and the nucleus change their distribution within the cell. NP, nuclear and telomeric positions exhibit polarization during the bouquet stage. We previously demonstrated that telomere clustering is sensitive to colchicine (Cowan and Cande, 2002), allowing us to determine the consequences of inhibition of telomere clustering on the establishment of bouquet-stage cell polarity. The polarization events we investigated, with the exception of telomere position relative to the cell axis, were unaffected by inhibition of telomere clustering. Our results suggest that polarization of the telomeres occurs in response to a spatial cue provided by the cell, and chromosomal polarity has no apparent influence on cellular polarity during the bouquet stage.
| Materials and Methods |
|---|
|
|
|---|
Anther culture
Upon removing anthers from the floret, the three anthers were
longitudinally cut down the connective tissue joining the locules, giving rise
to six anther halves. Upon bisecting an anther, the two halves were
immediately placed into culture medium. Anther culture was performed as
described elsewhere (Cowan and Cande, 2002).
Colchicine treatment
Colchicine (Sigma) exerted inhibitory effects after 3 hours of treatment;
all experiments discussed were performed for a minimum of 12 hours. Complete
(100% of meiotic cells) inhibition of telomere clustering was found with 75
µM colchicine and higher (Cowan and Cande, 2002). 75 µM colchicine,
however, did not appear to cause complete depolymerization of cytoplasmic MTs,
as judged by tubulin immunofluorescence (data not shown). 250 µM colchicine
was used in experiments examining nuclear displacement, as this concentration
resulted in a more complete depolymerization of cytoplasmic MTs, on the basis
of tubulin immunofluorescence. All media contained 1% DMSO.
Fluorescent in situ hybridization (FISH)
Meiocytes and associated cells were embedded in 5% acrylamide polymerized
between two coverslips. The FISH protocol was based on that of Bass et al.
(Bass et al., 1997
), as
described previously (Cowan and Cande, 2002). Telomeres were detected using a
probe for the telomere repeat (CCCTAAACCCTAAACCCTAAACCCTAAA) with either
5' Cy5 or Texas Red (Genset).
Immunofluorescence
Meiocytes and associated cells were embedded in 5% acrylamide polymerized
between two coverslips. Cell walls were digested with 1.5%
ß-glucuronidase (from Helix pomatia, Sigma) in 1xPBS at
36°C for 15 minutes for MT localization and for 1 hour for NP
localization. Coverslips were washed thoroughly with 1xPBS. Primary
antibody was applied in 1xPBS and incubated at room temperature
overnight. Coverslips were washed in 1xPBS. The secondary antibody was
applied in 1xPBS and incubated overnight at room temperature. Coverslips
were washed in 1x PBS. Chromatin was stained with 3 µg/ml DAPI, and
samples were mounted in glycerol.
Microtubules
Fixation was performed as described previously
(Chan and Cande, 1998
) using a
monoclonal antibody against sea urchin
-tubulin (a gift of D. Asai,
Purdue University) at 1:500 dilution. The primary antibody was visualized with
Alexa-488-conjugated goat anti-mouse IgG (Molecular Probes) at 1:50
dilution.
Nuclear pores
Anthers were fixed in 4% paraformaldehyde in 1x buffer A for 15
minutes at room temperature. NPs were detected using a commercial monoclonal
antibody against rat liver NP proteins (mAb 414; Covance) at 1:250 dilution.
mAb414 recognized a major band of approximately 68 kDa protein on western
blots, as well as minor bands at 93 and 29 kDa (data not shown). The primary
antibody was visualized with either rhodamine-conjugated donkey anti-mouse IgG
(Jackson Immunochemicals) at 1:75 dilution or FITC-conjugated goat anti-mouse
IgG (Cappel) at 1:50 dilution; both secondary antibodies gave similar
results.
Microscopy
Images were acquired with an Applied Precision Delta Vision microscope
system equipped with an Olympus IX70 inverted microscope. A 40x 1.35 NA
UApo oil immersion lens was used for all experiments. Cells were imaged in
three dimensions (xyz); z-axis sections were collected at 0.2 µm spacing.
Images were deconvolved using a standard conservative algorithm
(Chen et al., 1995
). Over 100
cells were examined for each treatment, time point and/or localization,
although only a subset was used for quantitative analyses (described in the
text).
Definition of terms and quantification of cell polarity
Several cellular structures were used to assess polarization of the rye
meiotic cell and are summarized in Fig.
1. The cell cortex refers to the periphery of the cell but is not
restricted to the plasma membrane. The short side cell cortex was defined by
the tendency of rye meiotic cells to approximate isosceles triangles in shape
and thus have two long sides and one short side. Telomeres were marked by the
associated subtelomeric heterochromatic regions, as detected by intense DAPI
staining. The nuclear volume was defined by the region occupying DAPI-stained
chromatin, and, likewise, the nuclear periphery was determined by the
outermost chromatin staining. Nuclear pores were detected using an antibody
directed against a component of the nuclear pore complex, as discussed in the
text. The cell center was calculated by finding the center of cell perimeter
models.
|
|
|
|
3DModel data was imported into MATLAB (version 5.1.0.420, The MathWorks,
Inc.) for quantitative analyses. The percentage of the nuclear surface
occupied by NPs was calculated by binning nuclear periphery and NP models to
3x3x3 blocks and taking the ratio of overlapping blocks to total
nuclear periphery blocks. Object centers were found by calculating the mean of
the 3D object models. Random angles were calculated between two random points
in a sphere generated as follows: the azimuth was determined by a uniform
random distribution of points between 0 and 2
; the elevation was
calculated by the inverse sine of random points between -1 and 1. The angle
measurements are not influenced by the radial position and thus the radius was
maintained at 1.
Sample means are described plus/minus the standard deviation. Means were assessed for significant differences at 99% confidence (P<0.01) using an unequal variance Student's t-test. Distance and angle distributions are presented as box-whisker plots. The distribution values are divided into four quartiles, such that the first quartile contains 0-25% of the samples, the second quartile contains 25-50% of the samples, the third quartile contains 50-75 percent of the samples and the fourth quartile contains 75-100% of the samples. The median of the samples determines the boundary between the second and third quartiles. The quartiles are depicted as follows: the first quartile (0-25th percentage) corresponds to the bottom-most vertical single line; the second (25-50th percentage) and third (50-75th percentage) quartiles are contained within a box; the median is the horizontal line through the box and represents the boundary between the second and third quartiles; and the fourth quartile (75-100th percentage) corresponds to the upper-most vertical single line.
To ensure that our assignment of the short side cell cortex in colchicine-treated cells matched that of control cells, we calculated the cell center to cell cortex angle: the angle created between the cell center, the center of the nucleus and the center of the short side cell cortex. The cell center to cell cortex angle did not differ significantly between control and the 250 µM colchicine-treated cells (control, 151°±18°, n=14; colchicine-treated, 131°±35°, n=10).
| Results |
|---|
|
|
|---|
Since it is technically challenging to perform indirect immunofluorescence and FISH on the same cell population, in all experiments using indirect immunofluorescence, we used subtelomeric heterochromatin to monitor telomere positions. Rye heterochromatin was an accurate indicator of telomere position, and the extent of telomere clustering could be judged by heterochromatin distribution. Using FISH on the telomere repeat, we established that the large heterochromatic blocks in rye, revealed as intensely stained DAPI regions, were exclusively associated with telomere FISH signals. In prebouquet stage meiotic cells, when telomeres were dispersed, we were consistently able to recognize spatially distinct heterochromatin blocks (Fig. 2A), minimally representing one quarter of the telomere FISH signals (data not shown). Some heterochromatic regions appeared to represent more than one chromosome end, as indicated by multiple associated telomere signals (Fig. 2A). Fully clustered telomeres in the bouquet stage were visible as one large mass of heterochromatin associated with all telomere signals (Fig. 2B). In post-bouquet-stage nuclei, chromatin condensation masked the appearance of the subtelomeric heterochromatin; chromosome ends appeared to be similar to the rest of the chromatin. We were able to identify post-bouquet meiotic cells by chromosome morphology; they were confirmed using FISH, which marked the dispersed telomeres (data not shown).
|
Rearrangement of the microtubule cytoskeleton coincides with telomere
clustering
We wished to know if there was a higher density of cytoplasmic MTs near the
site of the telomere cluster in rye, as is seen in animal and fungal cells. In
early meiotic prophase, cortical and randomly oriented cytoplasmic MTs were
apparent (Fig. 3A). The cell
shape was generally triangular and the nuclear position in the cell ranged
from central to eccentric. In Fig.
1, we present a diagram of a rye meiocyte in the bouquet stage and
show the cellular components used for assessing changes in cell polarity. The
terms in the diagram are also defined in the Materials and Methods. During the
bouquet stage, identified by the aggregated telomeric heterochromatin, the
majority of MTs were focused toward the nucleus. Roughly two thirds of the
nuclear surface was occupied with these focused MTs
(Fig. 3B); fewer MTs were
observed near the clustered telomeres. Bouquet-stage cells had a pronounced
triangular shape. Nuclei appeared maximally eccentric in bouquet-stage cells
and telomeres faced the cell cortex towards which nuclear displacement had
occurred. After bouquet dissolution, MTs were still associated with a similar
portion of the nuclear surface but now extended uniformly into the cytoplasm
(Fig. 3C). Meiotic cells no
longer appeared triangular but had assumed a rounded shape.
|
Telomeres are polarized relative to the cell during the bouquet
stage
Bouquet-stage nuclei of rye appeared to be asymmetrically positioned in the
cell, and the telomere cluster was oriented in the direction of displacement,
away from the majority of MTs and the larger cytoplasmic volume
(Fig. 3B). To quantify the
polarization of the nuclear position within the cell, we calculated the
distance between the center of the cell and the center of the nucleus (cell
center-nucleus distance) in pre-bouquet, bouquet and post-bouquet cells
(Fig. 4A). Distances were
standardized to the nuclear radius. The mean cell center-nucleus distance was
largest during the bouquet stage, significantly greater than both pre- and
post-bouquet distances, confirming that the visibly eccentric nuclear position
coincided with clustered telomeres. The cell center-nucleus distance values
exhibited a wide range during all stages, perhaps because our calculations did
not take into account cell size and shape.
The asymmetric nuclear positioning at the bouquet stage appeared to result from displacement along the long axis of the meiotic cell. In general, the mid-plane of meiotic cells approximated an isosceles triangle. As described above, the fully clustered telomeres faced the cell cortex towards which nuclear displacement had occurred and thus the short side of the triangular cell. Although we did not investigate cell shape intensively, we were able to identify the short side cell cortex in most cells, which provided a marker of cell asymmetry. To evaluate the position of the telomere cluster relative to the short side cell cortex, we calculated the angle created between the centers of the short side cell cortex, nucleus and telomeres (telomerecell-cortex angle; Fig. 4B). The telomere-cell cortex angle had a mean value of 33°±14° (n=22), which was significantly different from the distribution of random angles through the center of the sphere (90°±41°, n=50). The telomere cluster therefore occupies a specific cellular position relative to the short side cell cortex.
Meiotic telomere polarization relative to the cell axis is not
predicted by the Rabl organization
Rye exhibits a strong Rabl organization in pre-bouquet cells, with
telomeres located in one hemisphere of the nucleus
(Fig. 2A) (Dong and Jiang, 1998
;
Mikhailova et al., 2001
).
Given our finding that telomeres were polarized with respect to the cell
during the bouquet (telomere-cell cortex angle,
Fig. 4B), we next asked whether
the polarized Rabl telomeres were specifically positioned relative to the cell
axis and whether they can be used to predict the position of the bouquet-stage
telomere pole. In pre-bouquet cells, it was difficult to assign a short side
cell cortex, as cells were closer in shape to equilateral triangles
(Fig. 3A). To compare telomere
positioning with the cell axis in pre-bouquet and bouquet-stage cells, the
angle created between the centers of the cell, nucleus and telomeres
(telomere-cell center angle) was calculated and compared with the distribution
of random angles (Fig. 5). The
telomerecell-center angle of pre-bouquet cells was similar to the
random distribution (pre-bouquet, 86°±33°, n=11;
random, 90°±41°, n=50;
Fig. 5), in contrast to the
bouquet-stage telomerecell-center angle (bouquet,
140°±20°, n=14;
Fig. 5), suggesting a
constrained polarization of telomeres relative to the cell during the bouquet
stage. The random orientation of telomeres in pre-bouquet cells suggests that
bouquet-stage telomere polarization relative to the cell axis is not predicted
by the cellular position of the polarized Rabl telomeres in the pre-bouquet
cell.
Nuclear pores and telomeres are diametrically opposed during the
bouquet stage
The highly polarized rye bouquet-stage nucleus provided a unique
opportunity to investigate the spatial relationship between the NPs and
clustered telomeres. Although components of the NP complex in plants have not
been well characterized, we found that an antibody raised against rat liver NP
proteins [mAb414 (Davis and Blobel,
1987
)] was a useful marker in rye nuclei. The antibody was
specific for the nuclear periphery of both somatic and meiotic cells and
appeared to localize outside the chromatin staining, as judged by
immuno-fluorescence (Fig. 6).
Variable nucleolar staining (Fig.
6) and pre-bouquet nucleoplasmic background
(Fig. 6A) occurred with the
secondary antibody alone (data not shown).
|
NPs were distributed uniformly around the nuclear surface during early meiotic prophase, and telomeric heterochromatin was dispersed throughout the nuclear periphery (Fig. 6A). When telomeres were fully clustered, as evidenced by the aggregated heterochromatin, NPs were also clustered (Fig. 6B). The NP cluster lay adjacent to the bulk of the cytoplasm (data not shown); the telomere cluster was diametrically opposed to the NPs. NPs occupied 37±7% (n=22) of the nuclear surface during the bouquet stage, in contrast to coverage of the entire nuclear surface in pre-bouquet cells. After telomeres had dispersed from the bouquet, NPs associated with regions of chromatin-nuclear envelope contact; chromatin-free regions of the nuclear periphery did not show NPs (Fig. 6C). At this stage the nuclear envelope is still intact.
To quantify the polarization of the telomere cluster relative to NPs during the bouquet, we calculated the angle created between the centers of the NP-containing region, nucleus and telomeres (Fig. 4B). The telomere-NP angle exhibited little variance among experiments (147°±18°, n=30). We compared this value to the distribution of random angles in a sphere and found the random distribution (90°±41°, n=50) to be significantly different from the observed mean telomere-NP angle (Fig. 4B). The standard deviation of the bouquet-stage telomere-NP angles was less than the standard deviation of random angles, indicating that the bouquet-stage organization of telomeres and NPs was spatially constrained.
Asymmetric nuclear positioning can occur without telomere
clustering
Our finding that telomere clustering could be inhibited experimentally by
colchicine (Cowan and Cande, 2002) allowed us to investigate the influence of
chromosomal organization on cellular architecture. Early meiotic prophase
anthers were treated with 250 µM colchicine. In time 0 meiotic cells,
telomeres were dispersed, MTs were distributed randomly in the cytoplasm, and
nuclei were predominantly central in the cell
(Fig. 7A, time 0). After 8-14
hours in culture, untreated cells reached the bouquet stage: telomeres were
completely clustered, the nucleus was located eccentrically in the cell, the
telomere cluster faced the cell cortex, and MTs were distributed
asymmetrically around the nuclear surface
(Fig. 7A, control).
Colchicine-treated cells exhibited scattered telomeres, and cytoplasmic MTs
were not evident (Fig. 7A, 250
µM colchicine). Nuclear displacement, however, occurred despite the failure
of telomere clustering, and mean cell center-nucleus distances in control and
colchicine-treated cells were similar (Fig.
7B; Table 1).
|
|
We investigated the spatial relationship between the unclustered telomeres and the short side cell cortex in colchicine-treated cells. The telomerecell-cortex angle (see Fig. 4B) differed significantly in colchicine-treated and control cells (Table 1). The distribution of telomere positions relative to the cell cortex in colchicine-treated cells was shifted towards a random distribution (Fig. 7C). Inhibition of telomere clustering by colchicine resulted in telomere misorientation relative to the cell cortex.
Nuclear pore reorganization and polarization can occur independently
of telomere clustering
We wished to determine whether telomere clustering is a prerequisite for NP
reorganization or whether telomeregenerated asymmetry is involved in
positioning the clustered NPs. Early meiotic prophase anthers were treated
with 100 µM colchicine. In time 0 nuclei, telomeres were dispersed and NPs
were uniformly distributed around the nuclear periphery
(Fig. 8A, time 0). After a
sufficient culture period, a single telomere cluster was observed in control
nuclei, whereas in colchicinetreated cells telomeres were dispersed in the
nuclear periphery. NP distribution, however, was identical in
colchicine-treated and control nuclei; NPs were located in a single region of
the nuclear periphery (Fig. 8A,
control and 100 µM colchicine). NPs occupied similar percentages of the
nuclear surface in colchicine-treated and control cells
(Fig. 8B;
Table 1).
In control nuclei, NPs were located strictly opposite the telomere cluster. However, in colchicine-treated nuclei, the position of telomeres relative to the NPs was unconstrained. Partial overlaps of telomeres and NPs were observed occasionally. The NP-telomere angle (Fig. 4B) in colchicinetreated cells was significantly different from that in control cells and exhibited greater variation (Fig. 8C; Table 1). These findings, however, were difficult to interpret, owing to the lack of polarization of unclustered telomeres; the telomerecell-cortex angle differed significantly in control and colchicinetreated cells (Fig. 7C; Table 1).
In an attempt to resolve whether the induced loss of NP-telomere polarity was a result of the mislocalization of telomeres alone or of both NPs and telomeres, we examined the positioning of the NP cluster relative to the cell cortex towards which nuclear displacement had occurred. NP position in the cell was assessed by determining the angle between the centers of the NP-containing region, nucleus and cell cortex (Fig. 8C). The mean NPcell-cortex angle was not significantly different in control and colchicine-treated cells, and both these angles were different from random expectations (Fig. 8C; Table 1), suggesting that NP position was not affected by the inhibition of telomere clustering.
| Discussion |
|---|
|
|
|---|
The use of colchicine provided important insights into the hierarchy of cellular polarization in the meiotic cell, although numerous questions arise from its effect on telomere clustering. The concentrations of colchicine used in these experiments (100 and 250 µM) had different effects on cytoplasmic MTs, as judged by tubulin immunofluorescence (data not shown). Telomere clustering, however, was unambiguously inhibited. Furthermore, other MT-depolymerizing drugs do not affect telomere clustering (Cowan and Cande, 2002). The focus of this discussion is on the interdependence of telomere clustering and cellular organization during the bouquet stage. Colchicine's mode of action in inhibiting telomere clustering is the subject of an accompanying paper, pp. 3749-3753.
Animal and fungal bouquet-stage cells show a clear proximity between the
clustered telomeres and the MTOC (Buchner,
1910
; Trelles-Sticken et al.,
1999
; Wilson,
1925
; Zickler and Kleckner,
1998
). The majority of cytoplasmic MTs in rye meiotic cells were
focused toward the nuclear envelope, but their highest density was away from
the position of the clustered telomeres. Although MT organization during early
meiotic prophase in plants has not been previously investigated, MTOC activity
during the bouquet stage appears to be favored in regions of the nuclear
envelope not associated with the telomeres. In Saccharomyces
cerevisiae, approximately one fifth of bouquet-stage nuclei exhibit
clustered telomeres that are not associated with the spindle pole body
(Trelles-Sticken et al.,
1999
). Thus positioning of telomeres in close proximity to the
MTOC may not be a requirement for successful telomere clustering but rather
may be evidence of an overall bouquet-stage cell polarity.
During the bouquet stage, the region of the nuclear envelope that had the highest density of MTs faced away from the short side cell cortex towards the bulk of the cytoplasm. Likewise, the nucleus was displaced to the region of the cell containing the largest volume of cytoplasm. The polarization of MT distribution on the nuclear envelope and nuclear position may be related by indirect means, for instance, a possible preference of both the nucleus and nuclear envelope MTOCs to be associated with organelles that are more highly represented in the bulk cytoplasm. The nuclear pores also exhibited a tendency to face away from the short side cell cortex toward the cell center during the bouquet stage. However, clustered telomeres were distinctly located away from the bulk of the cytoplasm during the bouquet, in close association with the short side cell cortex (Fig. 1).
Telomeres and NPs underwent two reorganizations: clustering and
polarization. Numerous hypotheses have been proposed regarding the role of
telomere clustering (Zickler and Kleckner,
1998
), including the juxtaposition of homologous chromosomes,
synaptonemal complex installation and initiation of recombination. NP
clustering, by contrast, may be an indirect consequence of the requirement for
telomere motility on the nuclear envelope
(Scherthan et al., 2000
). Why
the telomere and NP clusters are specifically positioned in the meiotic cell
is an intriguing question, and their localization perhaps suggests a more
active role for the NP cluster in bouquet-stage events.
NP clustering during meiosis may reflect an overall reorganization of the
nuclear envelope/lamina. Elimination of the single nuclear lamin in
Caenorhabditis elegans using RNA-mediated interference results in NP
clustering (Liu et al., 2000
);
likewise, NP clustering occurs in Drosophila melanogaster lamin
Dm0 mutants (Lenz-Boehme et
al., 1997
). These data suggest that the `default' organization of
NPs is to be clustered and that distribution of NPs throughout the nuclear
envelope requires structural components, the lamins. It is possible that a
reorganization of the nuclear lamina is a prerequisite for telomere
motility.
The strict polarization of telomeres and NPs relative to each other as well
as to the cell axis requires communication of positional information. Two
models can be considered: first, cell polarity or NP position dictates
telomere polarization. Alternatively, telomere positioning dictates NP
position and cell polarity. We found that inhibition of telomere clustering
did not affect either NP positioning relative to the cell axis or nuclear
displacement toward the cell cortex, suggesting that clustered telomeres do
not determine NP or cell polarization. Additionally, pre-bouquet telomeres
were randomly oriented with respect to the cell axis. Thus, we can rule out
the possibility that polarization of unclustered telomeres owing to the Rabl
configuration is what determines the later axis of bouquet stage cell
polarity. Cell shape was asymmetric in pre-meiotic cells (data not shown),
suggesting that polarization cues may be present before the onset of meiotic
prophase. Evidence from Xenopus
(al-Mukhtar and Webb, 1971
;
Tourte et al., 1981
) and
locusts (Moens, 1969
)
indicates that meiotic cellular asymmetry exists prior to meiosis:
mitochondria are positioned to one side of the nucleus as early as pre-meiotic
interphase. It has been proposed that in mice and wheat
(Riley and Flavell, 1977
), the
transition from a mitotic to meiotic cell cycle may occur during the several
cell divisions preceding meiotic prophase; thus, cell polarity may be
established well in advance of meiotic prophase.
Our analyses of the cellular and nuclear rearrangements, which occur in early meiotic prophase, reveal that extensive polarization of the cell as well as the chromosomes exists during the bouquet stage. Telomere clustering represents only one example of bouquet-stage polarity, and we have found that meiotic cell polarization can occur independently of telomere clustering. Thus, an understanding of the mechanism of formation of the telomere cluster must begin with an understanding of the origin of polarity in the meiotic cell as a whole.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
al-Mukhtar, K. A. and Webb, A. C. (1971). An ultrastructural study of primordial germ cells, oogonia and early oocytes in Xenopus laevis. J. Embryol. Exp. Morphol. 26,195 -217.[Medline]
Baskin, T. I. and Cande, W. Z. (1990). The structure and function of the mitotic spindle in flowering plants. Annu. Rev. Plant Physiol. Plant Mol. Biol. 41,277 -315.[CrossRef]
Bass, H. W., Marshall, W. F., Sedat, J. W., Agard, D. A. and
Cande, W. Z. (1997). Telomeres cluster de novo before the
initiation of synapsis: A three-dimensional spatial analysis of telomere
positions before and during meiotic prophase. J. Cell
Biol. 137,5
-18.
Buchner, P. (1910). Von den Beziehungen zwischen Centriol und Bukettstadium. Arch. Zellforsch. 5, 215-228.
Chan, A. and Cande, W. Z. (1998). Maize meiotic spindles assemble around chromatin and do not require paired chromosomes. J. Cell Sci. 111,3507 -3515.[Abstract]
Chen, H., Swedlow, J. R., Grote, M. A., Sedat, J. W. and Agard, D. A. (1995). The collection, processing, and display of digital three-dimensional images of biological specimens. In Handbook of Biological Confocal Microscopy (ed. J. B. Pawley), pp. 197-210. New York: Plenum Press.
Church, K. (1976). Arrangement of chromosome ends and axial core formation during early meiotic prophase in the male grasshopper Brachystola magna by 3D, E.M. reconstruction. Chromosoma 58,365 -376.[CrossRef][Medline]
Cowan, C. R., Carlton, P. M. and Cande, W. Z.
(2001). The polar arrangement of telomere in interphase and
meiosis. Rabl organization and the bouquet. Plant
Physiol. 125,532
-538.
Darlington, C. D. (1933). The origin and behaviour of chiasmata. VIII. Secale cereale (n, 8). Cytologia (Tokyo) 4,444 -452.
Davis, L. I. and Blobel, G. (1987). Nuclear
pore complex contains a family of glycoproteins that includes p62:
glycosylation through a previously unidentified cellular pathway.
Proc. Natl. Acad. Sci. USA
84,7552
-7556.
Dong, F. and Jiang, J. (1998). Non-Rabl patterns of centromere and telomere distribution in the interphase nuclei of plant cells. Chromosome Res. 6, 551-558.[CrossRef][Medline]
Hiraoka, T. (1949a). Observational and experimental studies of meiosis with special reference to the bouquet stage. I. Cell polarity in the bouquet stage as revealed by the behaviour of plastids. Bot. Mag. Tokyo 62, 19-23.
Hiraoka, T. (1949b). Observational and experimental studies of meiosis with special reference to the bouquet stage. II. Cell polarity in the bouquet stage as revealed by the behaviour of amyloplasts and fat granules. Bot. Mag. Tokyo 62,121 -125.
Hiraoka, T. (1952). Observational and experimental studies of meiosis with special reference to the bouquet stage. XIV. Some considerations on a probable mechanism of the bouquet formation. Cytologia (Tokyo) 17,292 -299.
Hiraoka, T. and Fuchikawa, Y. (1993). An electronmicroscopic and morphometric analysis on the cell polarity in the synaptic stage of meiosis. Cytologia (Tokyo) 58, 77-84.
Holm, P. B. (1977). Three-dimensional reconstruction of chromosome pairing during the zygotene stage of meiosis in Lilium longiflorum (Thunb.) Carlsberg Res. Commun. 42,103 -151.
Holm, P. B. and Rasmussen, S. W. (1980). Chromosome pairing, recombination nodules and chiasma formation in diploid Bombyx males. Carlsberg Res. Commun. 45,483 -548.[CrossRef]
Lenz-Boehme, B., Wismar, J., Fuchs, S., Reifegerste, R.,
Buchner, E., Betz, H. and Schmitt, B. (1997). Insertional
mutational of the Drosophila nuclear lamin Dm0 gene
results in defective nuclear envelopes, clustering of nuclear pore complexes,
and accumulation of annulate lamellae. J. Cell Biol.
137,1001
-1016.
Lima de Faria, A. (1952). Chromomere analysis of the chromosome complement of rye. Chromosoma 5, 1-68.[CrossRef][Medline]
Liu, J., Ben-Shahar, T. R., Riemer, D., Treinin, M., Spann, P.,
Weber, K., Fire, A. and Gruenbaum, Y. (2000). Essential roles
for Caenorhabditis elegans lamin gene in nuclear organization, cell
cycle progression, and spatial organization of nuclear pore complexes.
Mol. Biol. Cell 11,3937
-3947.
Mikhailova, E., Sosnikhina, S., Kirillova, G., Tikholiz, O., Smirnov, V., Jones, R. and Jenkins, G. (2001). Nuclear dispositions of subtelomeric and pericentromeric chromosomal domains during meiosis in asynaptic mutants of rye (Secale cereale L.). J. Cell Sci. 114,1875 -1882.[Abstract]
Moens, P. B. (1969). The fine structure of meiotic chromosome polarization and pairing in Locusta migratoria spermatocytes. Chromosoma 28, 1-25.[CrossRef][Medline]
Rasmussen, S. W. (1976). The meiotic prophase in Bombyx mori females analyzed by three dimensional reconstructions of synaptonemal complexes. Chromosoma 54,245 -293.[CrossRef][Medline]
Riley, R. and Flavell, R. B. (1977). A first view of the meiotic process. Phil. Trans. R. Soc. Lond. B Biol. Sci. 277,191 -199.[CrossRef][Medline]
Rodkiewicz, B., Bednara, J., Mostowska, A., Duda, E. and Stobiecka, H. (1986). The change in disposition of plastids and mitochondria during microsporogenesis and sporogenesis in some higher plants. Acta Bot. Neerl. 35,209 -215.
Scherthan, H., Jerratsch, M., Li, B. B., Smith, S., Hulten, M.,
Lock, T. and de Lange, T. (2000). Mammalian meiotic
telomeres: Protein composition and redistribution in relation to nuclear
pores. Mol. Biol. Cell
11,4189
-4203.
Stoppin, V., Vantard, M., Schmit, A.-C. and Lambert, A.-M. (1994). Isolated plant nuclei nucleate microtubule assembly: The nuclear surface in higher plants has centrosome-like activity. Plant Cell 6,1099 -1106.[Abstract]
Tourte, M., Mignotte, F. and Mounolou, J.-C. (1981). Organization and replication activity of the mitochondrial mass of oogonia and previtellogenic oocytes in Xenopus laevis. Dev. Growth Differ. 23, 9-21.
Trelles-Sticken, E., Loidl, J. and Scherthan, H. (1999). Bouquet formation in budding yeast: Initiation of recombination is not required for meiotic telomere clustering. J. Cell Sci. 112,651 -658.[Abstract]
Vantard, M., Levilliers, N., Hill, A.-M., Adoutee, A. and
Lambert, A.-M. (1990). Incorporation of Paramecium axonemal
tubulin into higher plant cells reveals functional sites of microtubule
assembly. Proc. Natl. Acad. Sci. USA
87,8825
-8829.
Wilson, E. B. (1925). The cell in development and heredity. New York: Macmillan.
Zhang, D., Wadsworth, P. and Hepler, P. K.
(1990). Microtubule dynamics in living dividing plant cells:
confocal imaging of microinjected fluorescent brain tubulin. Proc.
Natl. Acad. Sci. USA 87,8820
-8824.
Zickler, D. and Kleckner, N. (1998). The leptotene-zygotene transition of meiosis. Annu. Rev. Genet. 32,619 -697.[CrossRef][Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
Related articles in JCS:
This article has been cited by other articles:
![]() |
P. M. Carlton, C. R. Cowan, and W. Z. Cande Directed Motion of Telomeres in the Formation of the Meiotic Bouquet Revealed by Time Course and Simulation Analysis Mol. Biol. Cell, July 1, 2003; 14(7): 2832 - 2843. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. R. Cowan and W. Z. Cande Meiotic telomere clustering is inhibited by colchicine but does not require cytoplasmic microtubules J. Cell Sci., January 10, 2002; 115(19): 3747 - 3756. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||