|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
doi: 10.1242/10.1242/jcs.00047
Research Article |
Molecular Medicine Unit, Department of Medicine, Beth Israel, Deaconess Medical Center and Harvard Medical School, Boston, MA 02215, USA
* Author for correspondence (e-mail: schuck{at}caregroup.harvard.edu)
Accepted 7 July 2002
| Summary |
|---|
|
|
|---|
Key words: Green fluorescent protein, Brefeldin A, Non-classical protein secretion, Protein trafficking
| Introduction |
|---|
|
|
|---|
Owing to its intrinsic fluorescence, GFP is commonly used as a molecular
tag to study intracellular protein trafficking. GFP appears to be an inert and
stable molecule localized in the cytosol. Furthermore, it is small enough (29
kDa) to be used as a passenger protein for fusion constructs. In these fusion
proteins, it is assumed that GFP does not contain intrinsic targeting
information. To date, various proteins have been tagged with GFP to study
localization and sorting in compartments such as the mitochondria, nucleus,
chloroplasts, endoplasmic reticulum (ER), Golgi apparatus and plasma membrane
(Chatterjee and Stochaj, 1996
;
Choy et al., 1999
;
Lee et al., 2001
;
Niwa et al., 1999
). GFP-tagged
proteins can be observed and their movement tracked in intact cells simply by
looking for fluorescence at the targeted location.
Protein secretion in mammalian cells generally occurs via the classical
secretory pathway that traverses the ER and Golgi apparatus. Secreted proteins
contain a signal sequence with all the necessary information required to
target them for secretion. A protein that is not normally secreted can be
targeted for secretion by attaching a signal sequence
(Simon et al., 1987
). The
classical secretory pathway is completely inhibited by brefeldin A (BFA),
which causes reversible resorption of the Golgi apparatus back into the ER
(Doms et al., 1989
).
Over the past decade, it has been shown that several proteins are secreted
independently of the ER-Golgi pathway. For example, basic fibroblast growth
factor (FGF), interleukin (IL)-1ß, HIV-tat, galectin-3, and thioredoxin
are secreted in a non-classical manner
(Chang et al., 1997
;
Mehul and Hughes, 1997
;
Mignatti et al., 1992
;
Rubartelli et al., 1992
).
These proteins do not display any signal sequence or protein motif known to
act as a signal for export (for a review, see
Muesch et al., 1990
;
Rubartelli and Sitia, 1997
).
Furthermore, their secretion is not inhibited by the addition of BFA. The
pathways used for the export of these proteins are still poorly understood,
and multiple pathways for non-classical protein secretion may exist in
cells.
In our laboratory, we wished to use GFP as a passenger in a fusion construct to study non-classical secretion by Chinese hamster ovary (CHO) cells. As a control, we expressed GFP alone. To our surprise, most of the GFP expressed in CHO cells is secreted into the medium in a non-classical manner. Many but not all types of cells examined also secrete GFP. We characterized the kinetics, sensitivity to temperature and factors in serum and effects of known specific chemical inhibitors on the export of GFP from transfected CHO cells. In contrast to cytosolic GFP, secreted GFP does not fluoresce, indicating that it is not properly folded.
| Materials and Methods |
|---|
|
|
|---|
Plasmid constructions
The GFP construct used in this study was created as follows. Using the
pQBI25-fN3 plasmid as a template, the forward (encoding a BamHI site,
translation initiation consensus sequence and initiation methionine:
CGGGATCCGCCACCATGGCTAGCAAAGGAGAAGAACTCTTC) and reverse (encoding a stop codon
and XbaI site: CGTCTAGATAGTCAATCGATGTTGTAGAG) primers were used to
amplify the GFP-coding region with Platinum pfx DNA polymerase (Gibco/ Life
Technologies). The PCR product was digested, isolated and subcloned into
pcDNA3 at the BamHI and XbaI site of the multiple cloning
site. A similar method was used to create the preprolactin-myc construct using
the forward (CGGGATCCGCCACCATGGACAGCAAAGGTTCGTCGC) and reverse
(ATAGTTTAGCGGCCGCGCAGTTGTTGTTGTAGATGATTCTGC) primers to amplify the bovine
preprolactin gene from the plasmid pT7-Bprl. The PCR product was isolated and
cloned between the BamHI and NotI sites of pcDNA3 with a
pre-existing myc epitope coding sequence following the NotI site. The
murine dihydrofolate reductase (DHFR)-FLAG mammalian expression construct was
created as follows. Using pDS5/3 plasmid
[(Rassow et al., 1989
) a kind
gift of Elzbieta Glaser] as a template, the DHFR gene was amplified using
forward (CGGGATCCGCCACCATGGAATTCATGGTTCGACCATTG) and reverse
(CCTCTAGATTACTTGTCGTCATCGTCCTTGTAGTCGTCTTTCTTCTCGTAGACTTCAAAC) primers. The
PCR product was digested with BamHI and NotI and subcloned
into pcDNA3 with a pre-existing FLAG-epitope-coding sequence following the
NotI site. The same approach was used to create the Schistosoma
japonicum glutathione S-transferase mammalian expression construct except
that pGEX-3 plasmid (Pharmacia) was used as a template and the different
forward (GGAATTCTATGTCCCCTATACTAGGTTATTGG) and reverse primers
(CCTCTAGATCACGATAAATTCCGGGGATCCC) were used for amplification. All constructs
were verified by DNA sequencing.
Cell culture and transient transfection
CHO, A375, COS, NIH 3T3, HEK-293, MCF-7 and HT-29 cells were maintained at
37°C/5% CO2 in culture medium (DMEM, 10% fetal bovine serum, 1%
penicillin/streptomycin and 1% non-essential amino acids). One day prior to
transfection, the cells were trypsinized and counted. One million cells were
used to seed 60 mm culture dishes and left overnight to form >90% confluent
monolayers. Confluent layers of cells were transiently transfected with
Lipofectamine 2000 according to the manufacturer's instructions. Briefly, 3
µg of plasmid DNA and 15 µl of Lipofectamine 2000 were used for each
transfection. Each of the components were resuspended in 450 µl of
OPTI-MEM, incubated for 5 minutes at room temperature, mixed and incubated for
a further 23 minutes before the addition of 4 ml of OPTI-MEM. The
DNA-Lipofectamine 2000 suspension was then added to the cells (prewashed twice
in PBS to remove residual serum proteins) and incubated at 37°C overnight.
The next day, transfected cells were washed twice in PBS to remove residual
DNA-Lipofectamine 2000 complexes prior to metabolic labeling.
Metabolic labeling with [35S]-methionine
The cells were incubated in 1 ml starving medium (DMEM minus methionine and
cysteine, 5% fetal bovine serum, 1% Glutamax I, 1% non-essential amino acids,
1x penicillin and streptomycin) for 30 minutes at 37°C in 5%
CO2. Metabolic labeling was carried out by the addition of 100
µCi of [35S]-methionine and incubating at 37°C for 30
minutes. At the end of the labeling period, the cells were washed in 1 ml of
chase medium (DMEM, 1x penicillin and streptomycin, 1% non-essential
amino acids) and chased in 800 µl of chase medium for the indicated amount
of time. Some cells were treated with 1 µg/ml BFA during the starvation,
labeling and chase periods.
Immunoprecipitation, SDS-PAGE and phosphor-imaging
For each pulse-chase assay, the medium was collected and cells on the dish
were lyzed by the addition of 1 ml of 1X Triton X-100 salt wash buffer (TXSWB;
1% Triton X-100, 100 mM Tris-HCl pH 8, 100 mM NaCl, 10 mM EDTA) in the
presence of 2 mM PMSF. Both the cell lysate and medium were centrifuged at
16,000 g for 15 minutes to remove cell debris, and the supernatant
was transferred to a fresh 1.5 ml tube. At this point, cleared cell lysate and
medium were used for spectrofluorometric measurements or LDH assays (see
below). For immunoprecipitation, 200 µl of 5x TXSWB (5% Triton X-100,
500 mM Tris-HCl pH 8, 500 mM NaCl, 50 mM EDTA) and 2 mM PMSF were added to the
cleared medium. Either 1 µl of anti-GFP antibodies or 6 µl of anti-myc
antibodies bound to protein G beads was added to each 1 ml of the cell lysate
or medium. The samples were mixed by inversion and incubated at 4°C for 1
hour before addition of 10 µl of a suspension of protein G-agarose beads.
The samples were rotated at 4°C overnight, washed twice in 1x TXSWB
and twice in wash buffer (100 mM Tris-HCl pH8, 100 mM NaCl) and resuspended in
1x SDS-PAGE buffer with 500 mM DTT. The samples were incubated at
37°C for 30 minutes prior to boiling and loaded on a 15% polyacrylamide
gel. At the completion of electrophoresis, the gels were destained for 30
minutes, soaked in 1 M sodium salicylate for 30 minutes and dried. The gels
were exposed to x-ray film for viewing or a phosphor-imaging screen (Molecular
Dynamics) for quantification.
Lactate dehydrogenase assay
Assays for lactate dehydrogenase (LDH) were carried out on 5 µl samples
of cell lysate and medium after the chase period to assess cell lysis. The
TOX7 LDH assay kit (Sigma) was used according to the manufacturer's
instructions.
Spectrofluorometric measurements
200 µl of cleared cell lysate and medium were aliquotted into 96-well
plates with blank 1x TXSWB and fresh chase medium as the respective
controls. The plates were scanned on a Cytofluorescent 2350TM
Fluorescence Measurement System (Millipore) with filter sets covering the GFP
excitation and emission wavelengths (exciation: 485±20 nm; emission:
530±25 nm).
| Results |
|---|
|
|
|---|
|
We also assessed the ability of other commonly used cell lines to secrete
GFP. NIH 3T3 and HEK293 cells transiently transfected with a plasmid encoding
GFP secrete the protein non-classically over 6 hours in the presence of BFA
(Fig. 2, lanes 1 to 4). By
contrast, COS cells secrete GFP poorly over 6 hours
(Fig. 2, lane 5 vs 6). Certain
cancer cells export thioredoxin via a non-classical pathway
(Berggren et al., 1996
).
Therefore, we investigated whether thioredoxin-secreting cancer cells, such as
A375, MCF-7 and HT-29, can also efficiently secrete GFP. We observed that GFP
is generally secreted by these cancer cells in the presence of BFA
(Fig. 2, lanes 7-10). One
exception, however, are HT-29 cells, which do not secrete GFP
(Fig. 2A, lanes 11 and 12) yet
export thioredoxin well (Berggren et al.,
1996
). For each cell line tested, no more than 5% of total
cellular LDH was detected in the medium, indicating that very little cell
lysis had occurred. Overall, compared with CHO cells, less GFP is secreted
from the cell lines studied in Fig.
2. Taken together, these results indicate that GFP can be secreted
by some cells via a brefeldin A-resistant pathway that is particularly active
in CHO cells.
|
Kinetics of GFP secretion by transiently transfected CHO cells
We next investigated the kinetics of GFP secretion. CHO cells transfected
with GFP were labeled with [35S]-methionine and chased at 37°C
in medium lacking serum for 2, 4, 6 and 8 hours. After separation by SDS-PAGE,
the protein bands were quantified using a phosphorimager, and the relative
secretion for each time point was calculated
(Fig. 3). The secretion of GFP
is a slow but steady process with up to 60% being secreted into the medium
after 8 hours of chase. The increase in secretion is not caused by cell lysis
since an assay for LDH showed that less than 5% of total cellular LDH was
detected in the medium after the maximum chase time of 8 hours (data not
shown). Since an adequate proportion of GFP is secreted into the medium after
6 hours of chase (Fig. 3, lanes
5 and 6), we chose to use this time point for subsequent assays of GFP
secretion.
|
GFP secretion is altered by temperature
Facilitated protein secretion is generally a temperature-dependent process.
For example, secretion of proteins via the classical ER-Golgi secretory
pathway is affected by alterations in temperature
(Saraste et al., 1986
). On the
other hand, passive diffusion through a pore is not affected by a change in
temperature (Melchior and Gerace,
1995
). We investigated the temperature sensitivity of GFP
secretion to gain insight into whether it is a facilitated or passive process.
CHO cells transfected with GFP were starved, labeled at 37°C and then
incubated in serum-free chase medium at 25°C, 37°C and 42°C for 6
hours. As expected, about 45% of GFP synthesized in the cells is secreted
after 6 hours at 37°C (Fig.
4, lanes 3 and 4). Lowering the chase temperature down to 25°C
drastically inhibits GFP secretion (Fig.
4, lanes 1 and 2). On the other hand, increasing the chase
temperature to 42°C increased the secretion of GFP modestly by 10%
(Fig. 4, lanes 5 and 6).
However, assays of LDH indicated an increase of cell lysis at this temperature
(15% of total cellular LDH detected in the medium), which can account entirely
for the slight increase in GFP detected in the medium.
|
GFP secretion is not affected by the amount of serum in the
media
Some non-classical secretory pathways are sensitive to factors in serum.
For example, the secretion of HIV-tat and IL-1ß is inversely proportional
to the amount of serum in the medium (Chang
et al., 1997
; Rubartelli et
al., 1990
). The secretion of thioredoxin is also reduced with
increasing amounts of serum in the medium (M.T., S.H. and S.L.C.,
unpublished). We investigated whether factors present in fetal bovine serum
also affect the secretion of GFP. CHO cells transfected with the GFP plasmid
were starved, labeled with [35S]-methionine and chased in medium
containing 0%, 5%, 10% and 20% fetal bovine serum
(Fig. 5). Quantification using
a phosphorimager revealed no significant differences in the proportion of
secreted GFP despite increasing concentrations of serum.
|
Various chemicals do not affect GFP secretion
The results above suggest that GFP is secreted by a non-classical secretory
pathway in CHO cells. To investigate whether the pathway for GFP secretion
might be the same as that used by other non-classically secreted proteins, we
tested the effect of various chemical inhibitors on the secretion of GFP
(Table 1)
(Hughes, 1999
;
Mignatti et al., 1992
;
Rubartelli et al., 1990
).
Although some of these compounds alter the non-classical secretion of other
proteins, none appeared to have a significant effect on the secretion of GFP.
For example, methylamine, which inhibits the non-classical secretion of
thioredoxin by blast cells (Rubartelli et
al., 1992
), has no effect on the secretion of GFP. Compounds such
as monensin and A23187, which enhance the release of thioredoxin, IL-1ß
and galectin-3 (Mehul and Hughes,
1997
; Rubartelli and Sitia,
1991
), also have no effect on GFP secretion. These data suggest
that GFP may use a different non-classical secretory pathway.
|
Secreted GFP is not associated with externalized membrane
vesicles
At least one non-classically secreted protein, galectin-3, is secreted via
plasma membrane blebbing (Mehul and
Hughes, 1997
). We studied whether GFP is also secreted in
externalized membrane vesicles. Such a mechanism could enable the
post-translational export of fully folded cytosolic proteins from the cell.
CHO cells transfected with the GFP plasmid were subjected to a 6 hour
pulse-chase assay. At the end of the chase, the medium was clarified by
low-speed centrifugation followed by high-speed centrifugation to pellet
membrane vesicles in the medium (Mehul and
Hughes, 1997
). However, after immunoprecipitation, no GFP protein
was detected in the pellet recovered after the high-speed centrifugation
(Fig. 6, lane 4). Indeed, all
of the GFP still remained in the supernatant fraction
(Fig. 6, lane 3) and in similar
amounts to that detected in the medium after low-speed centrifugation
(Fig. 6, lane 2). This result
suggests that GFP is not secreted into the medium via membrane blebbing.
|
Improperly folded GFP is secreted
GFP is a stable molecule that is resistant to spontaneous unfolding or
degradation in the cell (Bokman and Ward,
1981
). By fluorescence microscopy, GFP-transfected CHO cells are
brightly fluorescent (data not shown) indicating that some of the GFP is
folded properly in these cells. However, a loosely folded or unfolded
conformation is generally required for protein translocation through channels
(Schatz and Dobberstein,
1996
). Since the structure of fluorescent GFP is a bulky beta
barrel, it would seem likely that the protein must be at least partly unfolded
for export through a channel. We investigated whether GFP is secreted as an
unfolded molecule by assessing its fluorescence in the medium. First, we
assessed the quantities of unlabeled GFP secreted into the media relative to
the cell by carrying out a western blot analysis. Untransfected and
transfected CHO cells were placed in serum-free medium for 6 hours. At the end
of the incubation, the medium and cell lysate were harvested, aliquots were
saved for spectrofluorometric assays and the rest of the samples were
subjected to immunoprecipitation, separated by SDS-PAGE and immunoblotted with
anti-GFP antibodies (Fig. 7A).
As expected, no GFP was detected in untransfected CHO cells and medium
(Fig. 7A, lanes 1 and 2). GFP
was detected in comparable amounts in the cells and medium of transfected
cells by immunoblotting (Fig.
7A, lanes 3 and 4). We then carried out the spectrofluorometric
assay on aliquots of the same samples used for the western blot. Very little
auto-fluorescence was detected in the cell lysate or medium of untransfected
CHO cells (Fig. 7B, CHO). On
the other hand, the cell lysate of GFP-transfected CHO cells showed a large
increase in fluorescence in agreement with the fluorescence seen by microscopy
(Fig. 7B, CHO+GFP). However, no
change in fluorescence was seen in the medium despite significant secretion of
GFP (Fig. 7A).
|
We ruled out two possible artifacts that might account for the lack of fluorescence in the media. First, to test whether the lack of GFP fluorescence was caused by quenching by components in the medium, we carried out a 1:1 dilution of cell lysate with fresh medium or phosphate-buffered saline (PBS). The relative fluorescence detected in the sample diluted with fresh medium was half that of the undiluted sample and similar in value to the fluorescence measured when PBS was used as a diluent, indicating that the medium does not quench GFP fluorescence (Fig. 7B, CHO+GFP lysate diluted). Second, we examined whether the lack of fluorescence in the medium results from GFP becoming non-fluorescent after export into the medium. CHO cells expressing GFP were lyzed in fresh medium containing 1% Triton X-100. After clarification by centrifugation, the medium containing released cytosolic GFP was incubated at 37°C for 0, 3 and 6 hours, and the fluorescence was measured at each time point. Fluorescence remained virtually constant over 6 hours of incubation in medium (Fig. 7C). Thus, the lack of fluorescence in the medium is not caused by inactivation or unfolding of functional GFP once it is exported. From these results, we conclude that secreted GFP is not folded properly and therefore not fluorescent.
Two different forms of GFP are present in CHO cells but only the
improperly folded form is secreted
The secretion of unfolded, non-fluorescent GFP could result from either of
two possible models. In the first model, all cytosolic GFP is fluorescent, and
to be exported it must first be unfolded prior to or during secretion. This
implies that the reduction in intracellular GFP would be reflected by a
similar reduction in fluorescence under conditions where no new GFP molecules
are synthesized. In the second model, GFP is present in the cell in two
different forms as either a properly folded, fluorescent molecule that is not
secreted or as an unfolded protein that can be secreted. In this model, the
fluorescence from cellular GFP would remain constant despite a decrease in the
total cytosolic GFP.
We investigated these two models of GFP secretion. CHO cells transiently transfected with GFP were placed in medium supplemented with cycloheximide to a final concentration of 100 µM, which is sufficient to inhibit protein synthesis (data not shown). The cells were incubated at 37°C in this medium for 0 or 6 hours, and the media and cell lysates were harvested. Aliquots were saved for spectrofluorometric assays, and the rest of the samples were analyzed by western blotting (Fig. 8A). As expected, initially all of the GFP synthesized is present in the cell (Fig. 8A, lane 1) and not in the medium (Fig. 8A, lane 2). This data correlated with the spectrofluorometric result that showed that all of the fluorescence is associated in the cell lysate and none is detected in the medium (Fig. 8B, 0 hours chase, cell lysate versus medium). After 6 hours of chase, the immunoblot showed that approximately one third of the synthesized GFP is present in the medium (Fig. 8A, lanes 4), with a similar reduction of GFP in the cell lysate (Fig. 8A, lane 3). The relative amount of GFP secreted into the medium is similar to the secretion observed in the absence of cycloheximide (Fig. 7A), indicating that the protein synthesis inhibitor did not affect the non-classical export of GFP. Assays for LDH confirmed that the GFP dectected in the medium does not result from lysis caused by cycloheximide (data not shown). However, the fluorescence in the cell lysate after 6 hours is virtually identical to that at the outset (Fig. 8B, 6 hours, cell lysate) whereas no significant fluorescence is detected in the medium despite the significant secretion of GFP protein (Fig. 8B, 6 hours, medium). These data strongly support the second model. Thus, GFP exists in two different pools in transiently transfected CHO cells a pool of properly folded, fluorescent molecules, and a pool of unfolded, non-fluorescent proteins and only the second form can be secreted (Fig. 9).
|
|
| Discussion |
|---|
|
|
|---|
It is surprising that GFP is secreted from transiently transfected cells.
GFP is a cytosolic protein with no known targeting signal. The intrinsic
targeting of GFP for non-classical export might not have been observed
previously because the molecule is often targeted to a specific location in
cells. To our knowledge, this is the first report of GFP secretion by
mammalian cells. In yeast, GFP can be localized to the vacuole presumably
through a cryptic targeting signal (Kunze
et al., 1999
). Previously assumed to be an inert molecule, GFP has
other unanticipated effects on cells. For example, transgenic mice that
express GFP in the heart develop cardiomyopathy
(Huang et al., 2000
).
Furthermore, prolonged overexpression of GFP triggers apoptosis in cells
(Liu et al., 1999
). Many
visual applications, such as fluorescence microscopy, may not be sensitive to
minor toxic effects that go unnoticed
(Schmitz and Bereiter-Hahn,
2001
). Taken together, the unanticipated effects and secretion of
GFP raise doubts regarding the inertness of this molecule.
Our experiments indicate that the secretion of GFP is not simply due to cell lysis caused by either a cytotoxic effect of GFP or liposome-mediated transfection (Fig. 1C). GFP but not mDHFR is secreted from CHO cells that are co-transfected with cDNA encoding both proteins. If GFP or liposome-mediated transfection caused cell lysis, both expressed proteins would be found in the media. Furthermore, CHO cells, when transfected using calcium phosphate instead of a lipsosome formulation, also secrete GFP (data not shown). Finally, only non-fluorescent GFP is secreted (Fig. 7). If released by cell lysis, both fluorescent and non-fluorescent GFP would be expected in the media. Hence, the export process can discriminate between properly and improperly folded forms. This specificity indicates that GFP is not released by cell lysis.
Although GFP can diffuse through the nuclear pore into the nucleus
(Chatterjee and Stochaj, 1996
;
Chatterjee and Stochaj, 1998
),
we believe that the export of GFP is not caused by non-selective diffusion for
several reasons. First, lowering the chase temperature to 25°C
significantly inhibits GFP secretion (Fig.
4). Low temperatures inhibit a variety of facilitated
translocation processes but not diffusion
(Melchior and Gerace, 1995
).
Second, GFP is poorly secreted from certain cell lines such as COS and HT-29
(Fig. 2, lanes 6 and 12). This
result suggests that certain cellular factors or machinery are required for
GFP export and that export of GFP is not caused by non-specific diffusion of a
molten globule isoform through the plasma membrane as has been suggested for
other proteins (Bychkova et al.,
1988
). Such translocation machinery has been characterized in the
ER, mitochondria and chloroplasts (Chen et
al., 2000
; Johnson and van
Waes, 1999
; Rehling et al.,
2001
). Finally, the pathway used by GFP for export appears to be
selective since other heterologous, cytosolic proteins overexpressed in CHO
cells are not secreted (Fig.
1B,C). This selectivity implies that a specific region of the GFP
protein may behave as a cryptic targeting signal as has been demonstrated in
yeast (Kunze et al., 1999
).
Thus, the non-classical secretion of GFP is selective and not universal among
mammalian cells.
Little is known about non-classical secretory pathways in eukaryotes.
Several proteins such as basic FGF, IL-1ß, HIV-Tat, thioredoxin and
galectin-3 are secreted in a non-classical manner
(Cleves, 1997
;
Rubartelli and Sitia, 1997
).
However, only a few of these pathways have been studied, and their exact
mechanisms have not been identified. For example, the
Na+/K+ ion channel has been implicated in the secretion
of basic FGF (Florkiewicz et al.,
1998
), whereas an ATP-binding cassette (ABC) transporter appears
to be involved in the export of IL-1ß
(Andrei et al., 1999
).
Galectin-3 is secreted in vesicles from membrane blebbing; this pathway
appears to be capable of post-translational export of fully folded proteins
(Hughes, 1999
). We failed to
detect any GFP associated with vesicles. Furthermore, factors in serum and
various chemical inhibitors that affect the secretion of other non-classically
secreted proteins have no apparent effect on GFP secretion. Our data suggest
the existence of another non-classical export pathway in eukaryotic cells
capable of secreting unfolded GFP.
Protein translocation across membranes generally requires proteins to be in
a loosely folded or unfolded conformation. One exception is the prokaryotic
twin arginine translocase (Tat), which is capable of exporting fully folded
proteins including GFP into the periplasm
(Berks et al., 2000
;
Thomas et al., 2001
). In our
studies, the GFP secreted from CHO cells is not fluorescent and therefore not
properly folded. Perhaps the GFP is loosely folded or unfolded as a condition
for secretion. Once secreted, GFP does not fold into a fluorescent
conformation because of the absence of chaperone proteins
(Feilmeier et al., 2000
;
Sacchetti et al., 2001
). By
contrast, GFP secreted via the ER-Golgi pathway is fluorescent in the medium
because proper folding is maintained during secretion
(Laukkanen et al., 1996
).
GFP is fluorescent in the cytoplasm of transfected cells, indicating that
some of the protein is properly folded. The GFP in the medium, however, is not
fluorescent (Fig. 7B). Thus, to
be secreted by CHO cells, GFP must be in an unfolded conformation. Two models
could account for this unfolding. In the first model, fully folded GFP must be
unfolded prior to or during its export. In the second model, not all of the
GFP synthesized in the cytosol is folded to the fluorescent conformation. This
pool of nascent, unfolded GFP might remain associated with chaperones in the
cytosol to maintain a loosely folded or unfolded conformation. This scenario
is much more likely for post-translationally translocated proteins
(Schatz and Dobberstein,
1996
). The prolonged but efficient secretion of GFP despite
treatment with cycloheximide (Fig.
8) suggests that export occurs post-translationally. We discovered
that the pool of intracellular, fluorescent GFP did not decrease over 6 hours,
whereas a substantial fraction was secreted into the medium
(Fig. 8). This result indicates
that the second model is correct: two separate pools of nascent GFP
one folded and fluorescent, the other unfolded, non-fluorescent and able to be
secreted exist in cells (see model in
Fig. 9). Being a protein of
jellyfish origin, GFP does not always fold properly at 37°C
(Ogawa et al., 1995
;
Patterson et al., 1997
;
Siemering et al., 1996
;
Tsien, 1998
). Thus, the two
pools of GFP in CHO cells probably arise from an inefficiency in proper
folding even though we used an engineered form of GFP. Our data does not
indicate the relative size of these two pools, although the high proportion
that is secreted over several hours (Fig.
3) suggests that the pool of unfolded, non-fluorescent GFP
consists of at least half the newly synthesized GFP. The pool of unfolded GFP
does not appear to localize in aggresomes formed by aggregates of misfolded
proteins in the cytosol (Garcia-Mata et
al., 1999
; Garcia-Mata et al.,
2002
). We observed a diffuse pattern of GFP fluorescence
throughout the cytosol as is typically observed
(Garcia-Mata et al., 1999
;
Kain et al., 1995
). By
immunofluorescence microscopy, an identical pattern of GFP staining is seen in
the cytosol of these cells (data not shown). Thus, in cells, two overlapping
pools of GFP can be found throughout the cytosol.
Since GFP is not present endogenously in CHO cells, the physiological substrate for this non-classical pathway remains to be identified. To be active extracellularly, proteins secreted via this pathway must be able to attain the proper conformation outside the cell in the absence of chaperone proteins. Alternatively, this non-classical secretory pathway might be a means to dispose of improperly folded proteins from the cytosol.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Andrei, C., Dazzi, C., Lotti, L., Torrisi, M. R., Chimini, G.
and Rubartelli, A. (1999). The secretory route of the
leaderless protein interleukin 1beta involves exocytosis of
endolysosome-related vesicles. Mol. Biol. Cell
10,1463
-1475.
Berggren, M., Gallegos, A., Gasdaska, J. R., Gasdaska, P. Y., Warneke, J. and Powis, G. (1996). Thioredoxin and thioredoxin reductase gene expression in human tumors and cell lines, and the effects of serum stimulation and hypoxia. Anticancer Res. 16,3459 -3466.[Medline]
Berks, B. C., Sargent, F. and Palmer, T. (2000). The Tat protein export pathway. Mol. Microbiol. 35,260 -274.[CrossRef][Medline]
Bokman, S. H. and Ward, W. W. (1981). Renaturation of Aequorea greefluorescent protein. Biochem. Biophys. Res. Commun. 101,1372 -1380.[CrossRef][Medline]
Bychkova, V. E., Pain, R. H. and Ptitsyn, O. B. (1988). The `molten globule' state is involved in the translocation of proteins across membranes? FEBS Lett. 238,231 -234.[CrossRef][Medline]
Chalfie, M. (1995). Green fluorescent protein. Photochem. Photobiol. 62,651 -656.[Medline]
Chang, H. C., Samaniego, F., Nair, B. C., Buonaguro, L. and Ensoli, B. (1997). HIV-1 Tat protein exits from cells via a leaderless secretory pathway and binds to extracellular matrix-associated heparan sulfate proteoglycans through its basic region. Aids 11,1421 -1431.[Medline]
Chatterjee, S. and Stochaj, U. (1996). Monitoring nuclear transport in HeLa cells using the green fluorescent protein. Biotechniques 21, 62-63.[Medline]
Chatterjee, S. and Stochaj, U. (1998). Diffusion of proteins across the nuclear envelope of HeLa cells. Biotechniques 24,668 -674.[Medline]
Chen, K., Chen, X. and Schnell, D. J. (2000). Mechanism of protein import across the chloroplast envelope. Biochem. Soc. Trans. 28,485 -491.[Medline]
Choy, E., Chiu, V. K., Silletti, J., Feoktistov, M., Morimoto, T., Michaelson, D., Ivanov, I. E. and Philips, M. R. (1999). Endomembrane trafficking of ras: the CAAX motif targets proteins to the ER and Golgi. Cell 98,69 -80.[CrossRef][Medline]
Cinelli, R. A., Ferrari, A., Pellegrini, V., Tyagi, M., Giacca, M. and Beltram, F. (2000). The enhanced green fluorescent protein as a tool for the analysis of protein dynamics and localization: local fluorescence study at the single-molecule level. Photochem. Photobiol. 71,771 -776.[CrossRef][Medline]
Cleves, A. E. (1997). Protein transports: the nonclassical ins and outs. Curr. Biol. 7,R318 -320.[CrossRef][Medline]
Doms, R. W., Russ, G. and Yewdell, J. W.
(1989). Brefeldin A redistributes resident and itinerant Golgi
proteins to the endoplasmic reticulum. J. Cell Biol.
109, 61-72.
Evan, G. I., Lewis, G. K. and Bishop, J. M.
(1984). Isolation of monoclonal antibodies specific for products
of avian oncogene myb. Mol. Cell. Biol.
4,2843
-2850.
Feilmeier, B. J., Iseminger, G., Schroeder, D., Webber, H. and
Phillips, G. J. (2000). Green fluorescent protein functions
as a reporter for protein localization in Escherichia coli. J.
Bacteriol. 182,4068
-4076.
Florkiewicz, R. Z., Anchin, J. and Baird, A.
(1998). The inhibition of fibroblast growth factor-2 export by
cardenolides implies a novel function for the catalytic subunit of
Na+,K+-ATPase. J. Biol. Chem.
273,544
-551.
Garcia-Mata, R., Bebok, Z., Sorscher, E. J. and Sztul, E. S.
(1999). Characterization and dynamics of aggresome formation by a
cytosolic GFP-chimera. J. Cell Biol.
146,1239
-1254.
Garcia-Mata, R., Gao, Y. S. and Sztul, E. (2002). Hassles with taking out the garbage: aggravating aggresomes. Traffic 3,388 -396.[CrossRef][Medline]
Huang, W. Y., Aramburu, J., Douglas, P. S. and Izumo, S. (2000). Transgenic expression of green fluorescence protein can cause dilated cardiomyopathy. Nat. Medicine 6, 482-483.[CrossRef][Medline]
Hughes, R. C. (1999). Secretion of the galectin family of mammalian carbohydrate-binding proteins. Biochim. Biophys. Acta. 1473,172 -185.[Medline]
Johnson, A. E. and van Waes, M. A. (1999). The translocon: a dynamic gateway at the ER membrane. Annu. Rev. Cell Dev. Biol. 15,799 -842.[CrossRef][Medline]
Kain, S. R., Adams, M., Kondepudi, A., Yang, T. T., Ward, W. W. and Kitts, P. (1995). Green fluorescent protein as a reporter of gene expression and protein localization. Biotechniques 19,650 -655.[Medline]
Kunze, I. I., Hensel, G., Adler, K., Bernard, J., Neubohn, B., Nilsson, C., Stoltenburg, R., Kohlwein, S. D. and Kunze, G. (1999). The green fluorescent protein targets secretory proteins to the yeast vacuole. Biochim. Biophys. Acta. 1410,287 -298.[Medline]
Laukkanen, M. L., Oker-Blom, C. and Keinanen, K. (1996). Secretion of green fluorescent protein from recombinant baculovirus-infected insect cells. Biochem. Biophys. Res. Commun. 226,755 -761.[CrossRef][Medline]
Lee, Y. J., Kim, D. H., Kim, Y. W. and Hwang, I.
(2001). Identification of a signal that distinguishes between the
chloroplast outer envelope membrane and the endomembrane system in vivo.
Plant Cell 13,2175
-2190.
Liu, H. S., Jan, M. S., Chou, C. K., Chen, P. H. and Ke, N. J. (1999). Is green fluorescent protein toxic to the living cells?. Biochem. Biophys. Res. Commun. 260,712 -717.[CrossRef][Medline]
Mehul, B. and Hughes, R. C. (1997). Plasma membrane targetting, vesicular budding and release of galectin 3 from the cytoplasm of mammalian cells during secretion. J. Cell Sci. 110,1169 -1178.[Abstract]
Melchior, F. and Gerace, L. (1995). Mechanisms of nuclear protein import. Curr. Opin. Cell Biol. 7, 310-318.[CrossRef][Medline]
Mignatti, P., Morimoto, T. and Rifkin, D. B. (1992). Basic fibroblast growth factor, a protein devoid of secretory signal sequence, is released by cells via a pathway independent of the endoplasmic reticulum-Golgi complex. J. Cell Physiol. 151,81 -93.[CrossRef][Medline]
Muesch, A., Hartmann, E., Rohde, K., Rubartelli, A., Sitia, R. and Rapoport, T. A. (1990). A novel pathway for secretory proteins? Trends Biochem. Sci. 15, 86-88.[CrossRef][Medline]
Niwa, Y., Hirano, T., Yoshimoto, K., Shimizu, M. and Kobayashi, H. (1999). Non-invasive quantitative detection and applications of non-toxic, S65T-type green fluorescent protein in living plants. Plant J. 18,455 -463.[CrossRef][Medline]
Ogawa, H., Inouye, S., Tsuji, F. I., Yasuda, K. and Umesono,
K. (1995). Localization, trafficking, and
temperature-dependence of the Aequorea green fluorescent protein in cultured
vertebrate cells. Proc. Natl. Acad. Sci. USA
92,11899
-11903.
Patterson, G. H., Knobel, S. M., Sharif, W. D., Kain, S. R. and Piston, D. W. (1997). Use of the green fluorescent protein and its mutants in quantitative fluorescence microscopy. Biophys. J. 73,2782 -2790.[Medline]
Rassow, J., Guiard, B., Wienhues, U., Herzog, V., Hartl, F. U.
and Neupert, W. (1989). Translocation arrest by reversible
folding of a precursor protein imported into mitochondria. A means to
quantitate translocation contact sites. J. Cell Biol.
109,1421
-1428.
Rehling, P., Wiedemann, N., Pfanner, N. and Truscott, K. N. (2001). The mitochondrial import machinery for preproteins. Crit. Rev. Biochem. Mol. Biol. 36,291 -336.[CrossRef][Medline]
Rubartelli, A. and Sitia, R. (1991). Interleukin 1 beta and thioredoxin are secreted through a novel pathway of secretion. Biochem. Soc. Trans. 19,255 -259.[Medline]
Rubartelli, A. and Sitia, R. (1997). Secretion of mammalian proteins that lack a signal sequence. In Unusual Secretory Pathways: From Bacteria to Man. (ed. K. Kuchler, A. Rubartelli and B. Hollan), pp. 87-114. New York: R.G. Landes Company.
Rubartelli, A., Cozzolino, F., Talio, M. and Sitia, R. (1990). A novel secretory pathway for interleukin-1 beta, a protein lacking a signal sequence. EMBO J. 9,1503 -1510.[Medline]
Rubartelli, A., Bajetto, A., Allavena, G., Wollman, E. and
Sitia, R. (1992). Secretion of thioredoxin by normal and
neoplastic cells through a leaderless secretory pathway. J. Biol.
Chem. 267,24161
-24164.
Sacchetti, A., Cappetti, V., Marra, P., Dell'Arciprete, R., El Sewedy, T., Crescenzi, C. and Alberti, S. (2001). Green Fluorescent Protein variants fold differentially in prokaryotic and eukaryotic cells. J. Cell. Biochem. 81,117 -128.[CrossRef]
Saraste, J., Palade, G. E. and Farquhar, M. G.
(1986). Temperature-sensitive steps in the transport of secretory
proteins through the Golgi complex in exocrine pancreatic cells.
Proc. Natl. Acad. Sci. USA
83,6425
-6429.
Schatz, G. and Dobberstein, B. (1996). Common principles of protein translocation across membranes. Science 271,1519 -1526.[Abstract]
Schmitz, H. D. and Bereiter-Hahn, J. (2001). GFP associates with microfilaments in fixed cells. Histochem. Cell Biol. 116,89 -94.[Medline]
Siemering, K. R., Golbik, R., Sever, R. and Haseloff, J. (1996). Mutations that suppress the thermosensitivity of green fluorescent protein. Curr. Biol. 6,1653 -1663.[CrossRef][Medline]
Simon, K., Perara, E. and Lingappa, V. R.
(1987). Translocation of globin fusion proteins across the
endoplasmic reticulum membrane in Xenopus laevis oocytes.
J. Cell Biol. 104,1165
-1172.
Thomas, J. D., Daniel, R. A., Errington, J. and Robinson, C. (2001). Export of active green fluorescent protein to the periplasm by the twin- arginine translocase (Tat) pathway in Escherichia coli. Mol. Microbiol. 39,47 -53.[CrossRef][Medline]
Tsien, R. Y. (1998). The green fluorescent protein. Annu. Rev. Biochem. 67,509 -544.[CrossRef][Medline]
This article has been cited by other articles:
![]() |
S. Shulga-Morskoy and B.E. Rich Bioactive IL7-diphtheria fusion toxin secreted by mammalian cells Protein Eng. Des. Sel., January 1, 2005; 18(1): 25 - 31. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. D. Bendtsen, L. J. Jensen, N. Blom, G. von Heijne, and S. Brunak Feature-based prediction of non-classical and leaderless protein secretion Protein Eng. Des. Sel., April 1, 2004; 17(4): 349 - 356. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Ghosh, S. Hevi, and S. L. Chuck Regulated secretion of glycosylated human ferritin from hepatocytes Blood, March 15, 2004; 103(6): 2369 - 2376. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. Joshi, K. Venkatesh, R. Srinivas, S. Nair, and G. Hasan Genetic Dissection of itpr Gene Function Reveals a Vital Requirement in Aminergic Cells of Drosophila Larvae Genetics, January 1, 2004; 166(1): 225 - 236. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Prudovsky, A. Mandinova, R. Soldi, C. Bagala, I. Graziani, M. Landriscina, F. Tarantini, M. Duarte, S. Bellum, H. Doherty, et al. The non-classical export routes: FGF1 and IL-1{alpha} point the way J. Cell Sci., December 15, 2003; 116(24): 4871 - 4881. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Tanudji, S. Hevi, and S. L. Chuck The nonclassic secretion of thioredoxin is not sensitive to redox state Am J Physiol Cell Physiol, May 1, 2003; 284(5): C1272 - C1279. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. K. Shin, H. Wang, A. M. Yim, F. Le Naour, F. Brichory, J. H. Jang, R. Zhao, E. Puravs, J. Tra, C. W. Michael, et al. Global Profiling of the Cell Surface Proteome of Cancer Cells Uncovers an Abundance of Proteins with Chaperone Function J. Biol. Chem., February 21, 2003; 278(9): 7607 - 7616. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||