|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
doi: 10.1242/10.1242/jcs.00141
Research Article |
1 Institute of Animal Pathology, University of Bern, Länggassstr. 122, 3012
Bern, Switzerland
2 Max Planck Institute for Immunobiology, PO Box 1169, Stübeweg 51, 7800
Freiburg Zähringen, Germany
3 Max Planck Institute for Developmental Biology, Spemannstr.35, 72076
Tübingen, Germany
* Author for correspondence (e-mail: eliane.mueller{at}itpa.unibe.ch)
Accepted 4 September 2002
| Summary |
|---|
|
|
|---|
Key words: Keratinocytes, Epidermal renewal, Plakoglobin, Wnt signaling
| Introduction |
|---|
|
|
|---|
In epithelia, the role of ß-catenin in cell adhesion and signaling has
been widely investigated. In these tissues two distinct junctional complexes
mediate intercellular adhesion: adherens junctions and desmosomes
(Kowalczyk et al., 1999
;
Green and Gaudry, 2000
). Both
junctions consist of transmembrane cadherins, mainly E-cadherin in adherens
junctions, and desmogleins and desmocollins in desmosomes. The cytoplasmic
tails of these adhesion molecules link to the cytoskeleton via intracellular
plaque proteins. ß-Catenin is one of these plaque proteins, which is
exclusively confined to adherens junctions. In epithelia, evidence exists that
the cell adhesion and signaling roles of ß-catenin are interdependent. In
cultured epithelial cells it was demonstrated that intercellular adhesion
components can interfere with the signaling role of ß-catenin by
sequestering it at the plasma membrane (Simcha et al., 1998;
Sadot et al., 1998
;
Orsulic et al., 1999
;
Gottardi et al., 2001
).
Moreover, evidence has been provided that Wnt signaling promotes assembly of
intercellular junctions (Bradley et al.,
1993
).
In the epidermis, an epithelial tissue of high complexity, Wnt signaling
via ß-catenin was recently implicated in important steps during
morphogenesis, a process that is now widely believed to rely on
differentiation of the epidermal stem cells along hair, sebaceous gland and
epidermal lineages (Fuchs and Segre,
2000
; Lavker and Sun,
2000
; Watt, 2001
;
Huelsken and Birchmeier,
2001
). First indications that ß-catenin signaling can
interfere with stem cell differentiation came from transgenic overexpression
of a N-terminally stabilized mutant of ß-catenin in mouse skin
(Gat et al., 1998
). The
elevated levels of ß-catenin resulted in de novo hair follicle
morphogenesis, in addition to tumor formation. This further correlated with a
high incidence of N-terminally stabilized ß-catenin mutation in hair
follicle tumors in man (Chan et al.,
1999
). Collectively, these findings indicated that ß-catenin
plays a major role during hair development. This hypothesis received key
support by the finding that conditional ablation of the
ß-catenin gene in murine skin abrogated hair formation
(Huelsken et al., 2001
). This
phenotype was further reproduced by transgenic expression of a Lef1 mutant
lacking the ß-catenin-interacting domain
(Merrill et al., 2001
;
Niemann et al., 2002
). Most
surprisingly, despite the important function attributed to ß-catenin in
the formation and renewal of skin appendages, ß-catenin ablation did not
appear to affect the formation of interfollicular epidermis
(Huelsken et al., 2001
). This
was unexpected as c-myc, which can be a target of ß-catenin
(He et al., 1998
), had been
suggested to be essential in promoting epidermal stem cell differentiation
(Gandarillas and Watt, 1997
;
Arnold and Watt, 2001
). In
addition, several Wnts, which can potentially activate ß-catenin
signaling, are expressed in interfollicular murine epidermis
(Reddy et al., 2001
).
Nonetheless, misexpression of Tcf3 in transgenic mouse skin brought additional
support to the hypothesis that ß-catenin signaling via the Tcf/Lef family
members is dispensable for the establishment of the epidermal phenotype
(Merrill et al., 2001
). Tcf3,
which was suggested to inhibit ß-catenin signaling in the epidermal
context, also failed to disturb the epidermal architecture with the exception
of an aberrant expression of some terminal differentiation markers
(Merrill et al., 2001
).
The collective results of ß-catenin gene ablation in
epidermis prompted two hypotheses with respect to ß-catenin adhesion and
signaling. Firstly, that plakoglobin, which binds to the same cytoplasmic
domain in E-cadherin, substitutes for the deficiency of ß-catenin in
adherens junctions and enables the development of an apparently intact
epidermal architecture (Haegel et al.,
1995
). Secondly, the apparently normal epidermis despite impaired
ß-catenin-mediated Wnt signaling suggested that signaling via
ß-catenin is, and must be, shut off to allow normal epidermal
proliferation and differentiation to proceed
(Huelsken et al., 2001
;
Merrill et al., 2001
).
Here we wished to address these two hypotheses and to further elucidate the
contribution of ß-catenin to epidermal keratinocyte biology at the
molecular level. The approach we chose was to establish long-term epidermal
keratinocyte cultures (Caldelari et al.,
2000
) from the skin of conditional ß-catenin knockout mice
[using Cre/LoxP (Brault et al.,
2001
)]. The sequential deletion of the ß-catenin
gene and analysis of wild-type, heterozygous ß-catenin and
ß-catenin-null keratinocytes allowed us to rule out the involvement of
ß-catenin- and Tcf-mediated transcriptional transactivation in
proliferation, as well as in junction assembly and differentiation in
epidermal keratinocytes.
| Materials and Methods |
|---|
|
|
|---|
Antibodies
Primary antibodies used were: E-cadherin (DECMA), ß-catenin and
plakoglobin (Transduction Laboratories, Heidelberg, Germany, Catalog No.
C1922, C26220),
-catenin (Zymed, San Francisco, USA. Catalog No.
71-1200), plakophilin 1 (kind gift of P. Wheelock, Nebraska Medical Center,
Omaha, NE), plakophilin 3 and desmoglein 1/2 (Progen, Heidelberg, Germany,
Catalog No. 651113, 61002), filaggrin and loricrin (Covance, Richmond, USA,
Catalog No. PRB-417P, PRB-145P), cyclin D1 (Pharmingen, Heidelberg, Germany,
Catalog No. 556470), involucrin (kind gift of F. Watt; Cancer Research UK,
London, UK) and desmoglein3 (kind gift of. J. Stanley, Philadelphia, PA).
Proliferation assay and cell cycle analysis
2.5x105 cells were seeded into 8.8 cm2 culture
dishes in low Ca2+ medium. At 24 hour intervals triplicates were
trypsinized and counted. 96 hours after seeding, cultures were also evaluated
for cyclin D1 expression by western blot analysis of whole cell lysates and
for DNA content by flow cytometry. For the latter analysis, cells were fixed
in 75% ethanol and stained with propidium iodide (0.1% NP40, 3.4 mM Tris pH
7.4, 0.2 mg/ml RNaseA, 20 µg/ml propidium iodide).
Reporter gene assay
Cells were seeded in duplicate in 10 cm2 wells and low
Ca2+ medium. One day later, they were transfected using the
lipid-based SuperFect reagent (Qiagen, Basel, Switzerland) with either 1.875
µg of pTOP-flash (containing triple Tcf/Lef1 binding sites, the basic
thymidine kinase promoter and firefly luciferase reporter gene) or pFOP-flash
(containing mutated Tcf/Lef1 binding sites). When indicated, cells were
co-transfected with 1.875 µg stabilized ß-catenin or Lef or with the
same amount of vector. Plasmids containing Lef1
(Huber et al., 1996
),
N-terminally mutated stabilized ß-catenin [a kind gift from E. R.
Frearon, Ann Arbor, MI (Caca et al.,
1999
)], and pTOP-flash or pFOP-flash reporter constructs have been
described previously [a kind gift of N. Barker and H. Clevers, Utrecht,
Belgium (Molenaar et al.,
1996
)]. All samples were normalized by transfecting 37.5 ng pRL-tk
(renilla luciferase reporter under the control of a constitutively active
thymidine kinase promoter; Promega, Wallisellen, Switzerland; a kind gift of
J-M. Zingg and A. Azzi, University of Berne, Switzerland). 34 hours after
transfection, cells were lysed and firefly and renilla luciferase activity
measured in the same sample with the DualLuciferaseTM Reporter Assay
System (Promega, Wallisellen, Switzerland). This experiment was repeated three
times.
RT-PCR
Using the RNeasy kit (Quiagen, Catalog No. 74104), total RNA was isolated
from cultures grown in low or high Ca2+ medium for 30 hours.
Random-primed cDNA was prepared using standard techniques. Specific primers
for Tcf/Lef family members were adapted from those published for the human
sequences (Brantjes et al.,
2001
): Tcf3: gaaatccccagttacggtg (sense), caggttgggtagagctgc
(antisense); Tcf4: gcaccctccagatatatc (sense), tggagtcctgatgctttg (antisense);
Lef1: ctccacccatcccgagg (sense), gaggcttcacgtgcattag (antisense).
Amplification of GAPDH from the same cDNA was done using gctccttctgctgatgcccc
(sense) and gggtggcagtgatggcatgg (antisense) primers. 30 amplification cycles
were performed for Lef1 and Tcf4, whereas 20, 25 and 30 cycles were done for
Tcf3 (shown are 25 cycles) and 15 for GAPDH to obtain semi-quantitative
results. Control reactions were carried out on either cloned full-length cDNA
of mouse Tcf3, human Tcf4 (kind gifts from N. Barker and H. Clevers,
University Medical Center Utrecht) and mouse Lef1
(Huber et al., 1996
) as well
as on a mix of genomic DNA isolated from these cells or water.
Protein extraction and co-precipitation
Confluent cell cultures were incubated in KSFM containing 1.2 mM
CaCl2 for 30 hours, washed with PBS and incubated with cytoplasmic
extraction buffer (0.015% digitonin, 10 mM PIPES pH 6.8, 300 mM sucrose, 100
mM NaCl, 3 mM MgCl2, 5 mM EDTA, 1 mM PMSF, complete EDTA-free
protease inhibitor cocktail [Roche Diagnostics]) for 10 minutes. Cytoplasmic
extracts were removed and cells were scraped into membrane extraction buffer
(0.5% TritonX-100, 10 mM PIPES pH 6.8, 300 mM sucrose, 50 mM NaCl, 3 mM
MgCl2, 10 mM Na4P2O7, 20 mM NaF, 1
mM Na3Vo4, 0.1mg/ml RNaseA, 0.1 mg/ml DNase 1, 1 mM PMSF
and protease inhibitor cocktail) according to Pasdar et al.
(Pasdar et al., 1995
) with
some modifications (Caldelari et al.,
2001
). The TritonX-100-insoluble fraction was pelleted (20
minutes, 20,000 g) and dissolved by sonication and boiling in
SDS-PAGE buffer. For co-precipitation, 500 µg total protein of the
TritonX-100-soluble fraction were incubated with 2 µg plakoglobin
antibodies, 5 µg rat E-cadherin antibodies or 5 µl Dsg3 polyclonal serum
and processed according to standard protocols. For total lysates, cells were
directly scraped into SDS-PAGE buffer.
Immunofluorescence microscopy and electron microscopy
Keratinocytes were grown to confluency on coverslips (Lab-TekTM II,
Nunc, Roskilde, Denmark, Catalog No. 154534) and incubated in high
Ca2+ medium for 30 hours. For immunofluorescence analyses, cells
were fixed in 1% paraformaldehyde for 20 minutes, permeabilized with 0.5%
TritonX-100 for 10 minutes prior to incubation with primary and conjugated
secondary antibodies. For electron microscopy, cells were fixed with 4%
formaldehyde, 0.2% glutaraldehyde in 200 mM HEPES pH 7.2 for 20 minutes at
room temperature and overnight at 4°C, postfixed with 1% osmium tetroxide
in PBS for 1 hour on ice, washed with H2O, treated with 1% aqueous
uranyl acetate for 1 hour at 4°C, then dehydrated through a graded series
of ethanol and embedded in Epon. Ultrathin sections were stained with uranyl
acetate and lead citrate and viewed in a Philips CM10 electron microscope at
60 kV using a 30 µm objective aperture.
Adhesion assay
Cells seeded in quadruplicates were switched to high Ca2+ medium
at confluency for 30 hours (cell density
2.5x105/cm2) and intercellular adhesiveness
assessed by a modified protocol (Caldelari
et al., 2001
) originally described by Calautti and colleagues
(Calautti et al., 1998
).
| Results |
|---|
|
|
|---|
|
|
Consequences of ß-catenin gene inactivation on
epidermal keratinocyte proliferation
Elevated cytosolic ß-catenin levels were recently demonstrated to
induce hyperproliferation of cultured epidermal keratinocytes via
ß-catenin/Tcf-mediated upregulation of cyclin D1 and altered cell cycle
progression (Xia et al.,
2001
). It was thus conceivable that the inverse situation, namely
lack of ß-catenin, would impede these essential biological processes in
proliferating keratinocytes. Accordingly we compared the overall proliferative
capacity of the homozygous, heterozygous and ß-catenin-null mutant
keratinocytes. Proliferation curves were established from cultures ranging
from low cell density (proliferative) to high cell density (contact inhibited)
(Fig. 2A). Cells were harvested
at 24 hour intervals and counted. Interestingly, ß-catenin deletion did
not affect the growth rate within each individual culture, nor did it
interfere with contact-induced growth arrest. Culture 3 in general had a
slower growth rate than culture 1 and 2. This effect was, however, independent
of the presence of ß-catenin. In the proliferative phase (96 hours,
Fig. 2A) the cells were also
stained with propidium iodide and subjected to FACS analysis
(Table 1). The proportions of
cells in G1, S or G2/M phase within the corresponding keratinocyte cultures
did not differ. Normal cell cycle progression further correlated with
unaltered cyclin D1 expression and was independent of inactivation of one or
both ß-catenin alleles (Fig.
2B).
|
|
To further assess whether Tcf/Lef1-mediated transcriptional activity was
reduced in the absence of ß-catenin in proliferating keratinocytes, we
transfected cultures 1 (ß-cat+/+ and ß-cat+/-)
and 2 (ß-cat+/- and ß-cat-/-) with TOP-flash
and FOP-flash reporter constructs
(Molenaar et al., 1996
), the
latter containing mutated Tcf/Lef1 binding motives. Strikingly, transfection
of TOP-flash reporter plasmid alone (without addition of ß-catenin or
Lef1) resulted in a markedly lower activation of the TOP-flash promoter as
compared with FOP-flash, and this was independent of the genotype
(Fig. 2C). This situation was
inverted when a N-terminal stabilizing mutant of ß-catenin or Lef1 were
co-transfected, with the TOP-flash activity exceeding that of FOP-flash by up
to 1.87-fold. The finding that ectopic expression of Lef1 conferred
transcriptional transactivation in the absence of ß-catenin was
unexpected and suggests the presence of alternate transactivators in epidermal
keratinocytes as further discussed below. Taken together these results
demonstrated that epidermal keratinocyte proliferation in vitro does not
require ß-catenin, and further revealed that this correlated with
ß-catenin-independent inhibition of Tcf/Lef promoters, an effect that
could be overridden by overexpressed ß-catenin or Lef1.
In epidermal stem cells, ß-catenin-independent inhibition from Tcf/Lef
promoters was suggested to be conveyed by Tcf3 (Merill et al., 2001). To
address such a possibility in our cultured keratinocytes, we assessed
expression of Tcf3 via semi-quantitative RT-PCR along with that of Lef1 and
Tcf4 (Fig. 2D). Expression of
Lef1 has previously been reported in primary epidermal keratinocyte cultures
(Zhou et al., 1995
), and Tcf4
transcription can readily be detected in epidermal extracts (H.P., L.W., D.B.,
R.K. et al., unpublished). In all cultures Tcf3, Tcf4 and Lef1 were present
and persisted during early Ca2+-induced differentiation
(Fig. 2D). The fact that Tcf3
is expressed in these cultures whereas transcriptional transactivation from
Tcf/Lef promoters is inhibited could thus provide a conceivable explanation
for the latter phenomenon.
Consequences of ß-catenin gene deletion for functional
assembly of intercellular adhesion structures
It has been suggested that plakoglobin substitutes for ß-catenin in
adherens junctions of ß-catenin knockout cells and that this may result
in a higher amount of plakoglobin at the plasma membrane
(Haegel et al., 1995
;
Huelsken et al., 2000
;
Huelsken et al., 2001
). We
therefore addressed the effect of ß-catenin depletion on the level and
localization of plakoglobin and also on the functionality of both adherens
junctions and desmosomes.
Differentiation-dependent assembly of adherens junctions and desmosomes was
induced by incubating keratinocytes in high Ca2+ medium for 30
hours (Hennings et al., 1980
;
Caldelari et al., 2000
).
Interestingly, no increase in the steady-state level of plakoglobin was
observed in whole cell lysates of heterozygous or ß-catenin-null mutant
keratinocytes (Fig. 1). We thus
investigated a possible effect of ß-catenin deletion on the subcellular
distribution and relative expression level of plakoglobin and other junctional
components. Cellular lysates were fractionated in cytoplasmic, membrane-bound
TritonX-100-soluble and TritonX-100-insoluble proteins
(Fig. 3A) as described
previously (Pasdar et al.,
1995
). Using this fractionation procedure, the TritonX-100-soluble
fraction contains most of the adherens junction components and desmosomal
proteins not yet assembled into desmosomes, whereas the Triton-insoluble
fraction mainly harbors fully assembled desmosomes
(Pasdar et al., 1995
).
Interestingly, there was no substantial alteration in the steady-state level
and distribution of plakoglobin and the major adherens junction and desmosomal
proteins in case of ß-catenin deletion. Consistent with this finding,
semi-quantitative double-labeling immunofluorescence studies revealed
comparable and linear membrane staining of E-cadherin, plakoglobin or
-catenin, and a similarly organized actin filament network in
ß-catenin-null keratinocytes (Fig.
3B). ß-Catenin deletion did also not alter the membrane
distribution of desmosomal proteins. Furthermore, ultrastructurally desmosomes
and adherens junctions of ß-catenin-null keratinocytes showed the typical
epidermal morphology (Fig. 3C). Also no difference in the number of adherens junctions or desmosomes per cell
was observed between the different genotypes by counting electron microscopic
sections (data not shown). Thus, in the absence of ß-catenin, cultured
keratinocytes appeared to possess normal numbers of correctly assembled
adherens junctions and desmosomes. To address whether these intercellular
junctions were functional in the absence of ß-catenin, we performed an
adhesion assay, which is based on resistance to application of mechanical
stress (Calautti et al., 1998
;
Caldelari et al., 2001
).
Overall we found intercellular adhesive strength to be unchanged between the
individual cultures, despite deletion of the ß-catenin gene
(Fig. 3D). The more substantial
adhesive strength observed in culture 2, which is independent of
ß-catenin, will be discussed below.
We further assessed whether plakoglobin could substitute for the lack of
ß-catenin in adherens junctions, thus explaining the observed undisturbed
intercellular adhesiveness. Coprecipitation studies were performed of the
TritonX-100-soluble protein fractions {which contain most of the adherens
junction components [(Brault et al.,
2001
), see Fig.
3a]} using either E-cadherin or plakoglobin antibodies
(Fig. 4). Clearly more
plakoglobin was associated with E-cadherin in ß-catenin-null
keratinocytes than in those expressing ß-catenin
(Fig. 4, IP:E-cadherin).
Consistently more E-cadherin was coprecipitated with a given amount of
plakoglobin in these cells (Fig.
4, IP:PG). Conversely, slightly less TritonX-100-soluble
desmoglein3 was seen in the precipitates in the absence of ß-catenin. The
subsequent co-precipitation of the same protein fraction with desmoglein3
antibodies revealed comparable amounts of co-precipitating plakoglobin
(Fig. 4, IP:Dsg3). This
indicated that the difference was not due to less plakoglobin associating with
desmoglein3 but was probably due to an altered ratio of E-cadherin versus
desmoglein3 in the immunoprecipitates of ß-catenin-null cells.
|
Collectively these data confirm the hypothesis that plakoglobin substitutes
for the lack of ß-catenin in adherens junctions
(Haegel et al., 1995
;
Huelsken et al., 2000
;
Huelsken et al., 2001
). They
further demonstrate that this substitution does not visibly affect the
steady-state level and compartment distribution of plakoglobin, or its
association partners, in adherens junctions and desmosomes in epidermal
keratinocytes (see also Fig.
5). This finding is consistent with the functionally and
ultrastructurally intact intercellular adhesion structures demonstrated
herein.
|
Consequences of ß-catenin gene deletion on terminal
differentiation
To define the involvement of ß-catenin in the terminal differentiation
capacity of these keratinocytes, expression of several constituents of the
cornified envelope such as involucrin, loricrin and filaggrin were evaluated
during Ca2+-induced differentiation
(Fig. 5). We also addressed the
steady-state level of desmoglein1. Western blot analyses of total extracts
from differentiating keratinocytes (high Ca2+ medium for 130 hours)
showed no obvious differences in the expression levels of desmoglein1 and
involucrin, both markers of early terminal differentiation. Independent of the
presence or absence of ß-catenin, culture 2 showed higher levels of
desmoglein1 expression at that time point compatible with its stronger
adhesion observed in the adhesion assay at 30 hours (see
Fig. 3D). However, differences
were apparent in the steady-state levels of filaggrin and loricrin, two
markers of late terminal differentiation. Both ß-catenin-null cultures
(2-/- and 3-/-) showed lower levels of a partially
cross-linked form of loricrin (Fig.
5, arrow) compared with their heterozygous counterparts, although
this form was not yet detected at that time point in culture 1. Moreover,
filaggrin expression was inconsistent overall. Taken together, these analyses
indicated that expression of early terminal differentiation markers was
similar in all cell cultures, whereas that of loricrin was inconsistent in the
absence of ß-catenin.
| Discussion |
|---|
|
|
|---|
Our biochemical, ultrastructural and functional studies using
ß-catenin-null keratinocytes demonstrate that plakoglobin compensates for
the lack of ß-catenin by binding to E-cadherin. Interestingly, although
this compensation results in a visible change of the amount of plakoglobin at
the plasma membrane in trophectorderm
(Haegel et al., 1995
;
Huelsken et al., 2000
), this
is not the case in the epidermal keratinocytes. The most likely reason for
this phenomenon is the relatively large amount of plakoglobin in epidermal
keratinocytes. This is mainly due to the abundant desmosomes, which are
characteristic of tissues that experience substantial mechanical stress
(Green and Gaudry, 2000
).
Accordingly, the additional plakoglobin, which binds to E-cadherin in the
ß-catenin-null cells, appears to be too small to notably change the
already substantial plakoglobin pool at the plasma membrane. This notion is
consistent with our finding that levels of plaque and adhesion molecules in
these cellular fractions remained unchanged and that the stability, assembly
and adhesiveness of the respective intercellular junctions was not altered
detectably. Together with our finding that the expression of early
differentiation markers also remained unchanged, these results demonstrate
that ß-catenin is dispensable during early terminal differentiation.
Consequently, this further rules out any compulsory adhesion or signaling
requirement for ß-catenin during this process.
It has already been discussed that ß-catenin signaling must be
silenced to allow differentiation of stem cells into interfollicular epidermal
keratinocytes (DasGupta and Fuchs,
1999
; Merrill et al.,
2001
; Huelsken et al.,
2001
; Niemann et al.,
2002
). This was suggested to occur by binding of inhibitory Tcf3
to the Tcf/Lef promoter (Merrill et al.,
2001
). Our finding that Tcf3 is transcribed in cultured
keratinocytes whereas Tcf/Lef promoters are repressed, supports such an
inhibitory role by Tcf3. That the repression persists in the cultured
keratinocytes in spite of Tcf4 and Lef1 transcription may have several
reasons. The level of the endogenously expressed Tcf4, Lef1 protein may be too
low. This is probably the case, as evidenced by the finding that ectopically
expressed Lef1 reversed inhibition and supported transcription in the same
cells. A complementary mechanism for Tcf/Lef promoter silencing would comprise
inhibition of the basic transcription machinery by Tcf-binding proteins. This
possibility is suggested by our results: transcriptional activity from the
pTOP-flash was lower than from the pFOP-flash promoter (having mutated Tcf
binding motives). The previously described crosstalk between ß-catenin
and basic transcription could occur via the TATA-box-binding protein
(Hecht et al., 1999
). Even
though this mechanisms is interesting, inhibition of basic transcription from
Tcf/Lef-responsive promoters has so far not been observed in cultured murine
epidermal keratinocytes. Typically however, in the absence of exogenous
factors (for example stabilized ß-catenin), activation was found to be
very low (e.g. Merill et al., 2001; Xia et
al., 2001
). Absence of inhibition of the basic transcription
machinery in the former studies is probably due to the use of alternate
promoters in conjunction with the Tcf/Lef-binding motifs [c-Fos (Merill et
al., 2001; Xia et al., 2001
),
thymidine kinase in this study]. Weak promoters, like the one used in this
study, may be completely repressed by inhibitory proteins binding to the
Tcf-motifs, whereas stronger promoters will still show basic transcriptional
activity. Despite the discrepancy between the former and our results, promoter
analyses consistently showed enhanced transcriptional transactivation when
stabilized ß-catenin was co-expressed. In adult transgenic mice, the same
transgene can promote tumor formation in the epidermis
(Gat et al., 1998
), although
it drives differentiating cultured epidermal keratinocytes back into the
putative stem cell compartment (Zhu and
Watt, 1999
). These findings emphasize the necessity of a tight
control of ß-catenin signaling during epidermal keratinocyte
proliferation and differentiation. To fully understand this control and in
particular ß-catenin silencing in epidermal keratinocytes, it will be
necessary to address the highly orchestrated interplay between transcription
factors, transactivators and inhibitors in addition to repressor proteins like
Groucho (Barker et al., 2000
)
or CtBP (Chinnadurai,
2002
).
As already mentioned, silencing of ß-catenin signaling is required to
allow epidermal differentiation (DasGupta
and Fuchs, 1999
; Huelsken and
Birchmeier, 2001
; Merrill et
al., 2001
). The opposite appears to occur in skin appendages,
where ß-catenin was found to be operative and required for lineage
differentiation (Merrill et al.,
2001
). Silencing of ß-catenin signaling in one case but not
in the other, provides a likely explanation for how the many Wnts that are
expressed in neonatal skin (Reddy et al.,
2001
) are selective for either tissue compartment. The observation
that conditional gene ablation of ß-catenin failed to affect
interfollicular epidermal morphogenesis
(Huelsken et al., 2001
) could
even suggest that Wnt signals are not required to drive differentiation of
stem cells along the interfollicular epidermal lineage. The expression of
different Wnts in this tissue nevertheless raises the possibility that these
potent activators do signal, but through alternative pathways that do not
involve ß-catenin stabilization (Kuhl
et al., 2000
; Huelsken and
Birchmeier, 2001
; Malbon et
al., 2001
). Nonetheless, this possibility fails to explain
activation of the c-myc promoter. This promoter was found to be crucial during
epidermal differentiation (Gandarillas and
Watt, 1997
; Arnold and Watt,
2001
) and can be modulated by Tcf/Lef enhancers
(He et al., 1998
). This could
suggest that other factors are more potent than the `silenced' ß-catenin
in trans-activating these specific promoters. In this respect it is
interesting to mention that plakoglobin was suggested to be a stronger
transactivator of the c-myc promoter than ß-catenin
(Kolligs et al., 2000
). Even
though signaling via plakoglobin awaits more in-depth analyses, it is
noteworthy that ectopically expressed Lef1 was found in this study to override
transcriptional inhibition of Tcf/Lef promoters in wild-type but also in the
ß-catenin-null cells. As complete depletion of ß-catenin
gene and protein had been confirmed in the knockout cells, this activation
strongly points towards the presence of alternate transactivators than
ß-catenin in epidermal keratinocytes. The hypothesis that plakoglobin
fulfills this role in the epidermis certainly awaits further proof. So far
only indirect evidence has been provided that this protein exerts the
signaling function in the epidermis
(Charpentier et al., 2000
),
which has been demonstrated in yeast expression (Hecht et al., 2000).
Interestingly, although ß-catenin signaling appears to be dispensable
during proliferation and early terminal differentiation, its role in late
terminal differentiation of epidermal keratinocytes remains puzzling. We
observed inconsistent expression of late differentiation markers such as
filaggrin and loricrin in homozygous, heterozygous and null mutant
keratinocytes. It is presently unclear what the reason underlying this
inconsistency might be. Most interestingly however, transgenic mouse epidermis
with misexpression of Tcf3, which as discussed was postulated to inhibit
ß-catenin-mediated Wnt signaling, had a similar epidermal phenotype
(Merrill et al., 2001
).
In summary, our results provide the molecular proof that proliferation of cultured epidermal keratinocytes and the establishment of the epidermal phenotype in vitro do not require ß-catenin. Evidence obtained herein further points towards the possibility that ß-catenin signaling is inhibited in these cells by Tcf3 at the level of the Tcf/Lef promoters. This inhibition might prevent inadequate transactivation by ß-catenin, which could trigger proliferation at the expense of differentiation, hamper the exit from the putative stem cell compartment and ultimately lead to tumorigenesis.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Arnold, I. and Watt, F. M. (2001). c-Myc activation in transgenic mouse epidermis results in mobilization of stem cells and differentiation of their progeny. Curr. Biol. 11,558 -568.[CrossRef][Medline]
Barker, N., Morin, P. J. and Clevers, H. (2000). The Yin-Yang of TCF/ß-catenin signaling. Adv. Cancer Res. 77,1 -24.[Medline]
Behrens, J., von Kries, J. P., Kuhl, M., Bruhn, L., Wedlich, D., Grosschedl, R. and Birchmeier, W. (1996). Functional interaction of ß-catenin with the transcription factor LEF-1. Nature 382,638 -642.[CrossRef][Medline]
Bienz, M. and Clevers, H. (2000). Linking colorectal cancer to Wnt signaling. Cell 103,311 -320.[CrossRef][Medline]
Bradley, R. S., Cowin, P. and Brown, A. M. C.
(1993). Expression of Wnt-1 in PC12 cells results in
modulation of plakoglobin and E-cadherin and increased cellular adhesion.
J. Cell Biol. 123,1857
-1865.
Brantjes, H., Roose, J., van de Wetering, M. and Clevers, H.
(2001). All Tcf HMG box transcription factors interact with
Groucho-related co-repressors. Nucleic Acids Res.
29,1410
-1419.
Brault, V., Moore, R., Kutsch, S., Ishibashi, M., Rowitch, D. H., McMahon, A. P., Sommer, L., Boussadia, O. and Kemler, R. (2001). Inactivation of the ß-catenin gene by Wnt1-Cre-mediated deletion results in dramatic brain malformation and failure of craniofacial development. Development 128,1253 -1264.[Abstract]
Caca, K., Kolligs, F. T., Ji, X., Hayes, M., Qian, J., Yahanda,
A., Rimm, D. L., Costa, J. and Fearon, E. R. (1999). Beta-
and gamma-catenin mutations, but not E-cadherin inactivation, underlie T-cell
factor/lymphoid enhancer factor transcriptional deregulation in gastric and
pancreatic cancer. Cell Growth Differ.
10,369
-376.
Calautti, E., Cabodi, S., Stein, P. L., Hatzfeld, M., Kedersha,
N. and Dotto, G. P. (1998). Tyrosine phosphorylation and
Src-family kinases control keratinocyte cell-cell adhesion. J. Cell
Biol. 141,1449
-1465.
Caldelari, R., Suter, M. M., Baumann, D., de Bruin, A. and Müller, E. (2000). Long-term culture of murine epidermal keratinocytes. J. Invest. Dermatol. 114,1064 -1065.[CrossRef][Medline]
Caldelari, R., de Bruin, A., Baumann, D., Suter, M. M.,
Bierkamp, C., Balmer, V. and Müller, E. (2001). A
central role for the armadillo protein plakoglobin in the autoimmune disease
pemphigus vulgaris. J. Cell Biol.
153,823
-834.
Chan, E. F., Gat, U., McNiff, J. M. and Fuchs, E. (1999). A common human skin tumour is caused by activating mutations in ß-catenin. Nat. Genet. 21,410 -413.[CrossRef][Medline]
Charpentier, E., Lavker, R. M., Acquista, E. and Cowin, P.
(2000). Plakoglobin suppresses epithelial proliferation and hair
growth in vivo. J. Cell Biol.
149,503
-520.
Cheon, S. S., Cheah, A. Y., Turley, S., Nadesan, P., Poon, R.,
Clevers, H. and Alman, B. A. (2002). Beta-catenin
stabilization dysregulates mesenchymal cell proliferation, motility, and
invasiveness and causes aggressive fibromatosis and hyperplastic cutaneous
wounds. Proc. Natl. Acad. Sci. USA
99,6973
-6978.
Chinnadurai, G. (2002). CtBP, an unconventional transcriptional corepressor in development and oncogenesis. Mol. Cell 9,213 -224.[CrossRef][Medline]
DasGupta, R. and Fuchs, E. (1999). Multiple roles for activated LEF/TCF transcription complexes during hair follicle development and differentiation. Development 126,4557 -4568.[Abstract]
Fuchs, E. and Segre, J. A. (2000). Stem cells: a new lease on life. Cell 100,143 -155.[CrossRef][Medline]
Gandarillas, A. and Watt, F. M. (1997). c-Myc
promotes differentiation of human epidermal stem cells. Genes
Dev. 11,2869
-2882.
Gat, U., Das Gupta, R., Degenstein, L. and Fuchs, E. (1998). De novo hair follicle morphogenesis and hair tumors in mice expressing a truncated ß-catenin in skin. Cell 95,605 -614.[CrossRef][Medline]
Gottardi, C. J., Wong, E. and Gumbiner, B. M.
(2001). E-cadherin suppresses cellular transformation by
inhibiting ß-catenin signaling in an adhesion-independent manner
J. Cell Biol. 153,1049
-1060.
Green, K. J. and Gaudry, C. A. (2000). Are desmosomes more than tethers for intermediate filaments? Nat. Rev. Mol. Cell. Biol. 1,208 -216.[CrossRef][Medline]
Gumbiner, B. M. (1996). Cell adhesion: the molecular basis of tissue architecture and morphogenesis. Cell 84,345 -357.[CrossRef][Medline]
Haegel, H., Larue, L., Ohsugi, M., Fedorov, L., Herrenknecht, K. and Kemler, R. (1995). Lack of ß-catenin affects mouse development at gastrulation. Development 121,3529 -3537.[Abstract]
He, T. C., Sparks, A. B., Rago, C., Hermeking, H., Zawel, L., da
Costa, L. T., Morin, P. J., Vogelstein, B. and Kinzler, K. W.
(1998). Identification of c-MYC as a target of the APC pathway.
Science 281,1509
-1512.
Hecht, A., Litterst, C. M., Huber, O. and Kemler, R.
(1999). Functional characterization of multiple transactivating
elements in beta-catenin, some of which interact with the TATA-binding protein
in vitro. J. Biol. Chem.
274,18017
-18025.
Hennings, H., Michael, D., Cheng, C., Steinert, P., Holbrook, K. and Yuspa, S. H. (1980). Calcium regulation of growth and differentiation of mouse epidermal cells in culture. Cell 19,245 -254.[CrossRef][Medline]
Huber, O., Korn, R., McLaughlin, J., Ohsugi, M., Herrmann, B. G. and Kemler, R. (1996). Nuclear localization of ß-catenin by interaction with transcription factor LEF-1. Mech. Dev. 59,3 -10.[CrossRef][Medline]
Huelsken, J. and Birchmeier, W. (2001). New aspects of Wnt signaling pathways in higher vertebrates. Curr. Opin. Genet. Dev. 11,547 -553.[CrossRef][Medline]
Huelsken, J., Vogel, R., Brinkmann, V., Erdmann, B., Birchmeier,
C. and Birchmeier, W. (2000). Requirement for ß-catenin
in anterior-posterior axis formation in mice. J. Cell
Biol. 148,567
-578.
Huelsken, J., Vogel, R., Erdmann, B., Cotsarelis, G. and Birchmeier, W. (2001). ß-Catenin controls hair follicle morphogenesis and stem cell differentiation in the skin. Cell 105,533 -545.[CrossRef][Medline]
Kolligs, F. T., Kolligs, B., Hajra, K. M., Hu, G., Tani, M.,
Cho, K. R. and Fearon, E. R. (2000). Gamma-Catenin is
regulated by the APC tumor suppressor and its oncogenic activity is distinct
from that of beta-catenin. Genes Dev.
14,1319
-1331.
Kowalczyk, A. P., Bornslaeger, E. A., Norvell, S. M., Palka, H. L. and Green, K. J. (1999). Desmosomes: intercellular adhesive junctions specialized for attachment of intermediate filaments. Int. Rev. Cytol. 185,237 -302.[Medline]
Kuhl, M., Sheldahl, L. C., Park, M., Miller, J. R. and Moon, R. T. (2000). The Wnt/Ca2+ pathway: a new vertebrate Wnt signaling pathway takes shape. Trends Genet. 16,279 -283.[CrossRef][Medline]
Lavker, R. M. and Sun, T. T. (2000). Epidermal
stem cells: properties, markers, and location. Proc. Natl. Acad.
Sci. USA 97,13473
-13475.
Malbon, C. C., Wang, H. and Moon, R. T. (2001). Wnt signaling and heterotrimeric G-proteins: strange bedfellows or a classic romance? Biochem. Biophys. Res. Commun. 287,589 -593.[CrossRef][Medline]
Merrill, B. J., Gat, U., DasGupta, R. and Fuchs, E.
(2001). Tcf3 and Lef1 regulate lineage differentiation of
multipotent stem cells in skin. Genes Dev.
15,1688
-1705.
Molenaar, M., van de Wetering, M., Ousterwegel, M., Peterson-Manduro, J., Godsave, S., Korinek, V., Roose, J., Destrée, O. and Clevers, H. (1996). XTcf-3 transcription factor mediates ß-catenin-induced axis formation in Xenopus embryos. Cell 86,391 -399.[CrossRef][Medline]
Niemann, C., Owens, D. M., Hulsken, J., Birchmeier, W. and Watt,
F. M. (2002). Expression of DeltaNLef1 in mouse epidermis
results in differentiation of hair follicles into squamous epidermal cysts and
formation of skin tumours. Development
129,95
-109.
Orsulic, S., Huber, O., Aberle, H., Arnold, S. and Kemler, R. (1999). E-cadherin binding prevents beta-catenin nuclear localization and beta-catenin/LEF-1-mediated transactivation. J. Cell. Sci. 112,1237 -1245.[Abstract]
Pasdar, M., Li, Z. and Chlumecky, V. (1995). Plakoglobin: kinetics of synthesis, phosphorylation, stability, and interactions with desmoglein and E-cadherin. Cell Motil. Cytoskeleton 32,258 -272.[CrossRef][Medline]
Reddy, S., Andl, T., Bagasra, A., Lu, M. M., Epstein, D. J., Morrisey, E. E. and Millar, S. E. (2001). Characterization of Wnt gene expression in developing and postnatal hair follicles and identification of Wnt5a as a target of Sonic hedgehog in hair follicle morphogenesis. Mech. Dev. 107, 69-82.[CrossRef][Medline]
Sadot, E., Simcha, I., Shtutman, M., Ben-Ze'ev, A. and Geiger,
B. (1998). Inhibition of beta-catenin-mediated
transactivation by cadherin derivatives. Proc. Natl. Acad. Sci.
USA 95,15339
-15344.
Saitou, M., Sugai, S., Tanaka, T., Shimouchi, K., Fuchs, E., Narumiya, S. and Kakizuka, A. (1995). Inhibition of skin development by targeted expression of a dominant-negative retinoic acid receptor. Nature 374,159 -162.[CrossRef][Medline]
Simcha, I., Shtutman, M., Salomon, D., Zhurinsky, J., Sadot, E.,
Geiger, B. and Ben-Ze'ev, A. (1989). Differential nuclear
translocation and transactivation potential of beta-catenin and plakoglobin.
J. Cell Biol. 141,1433
-1448.
Stappert, J. and Kemler, R. (1994). A short core region of E-cadherin is essential for catenin binding and is highly phosphorylated. Cell Adhes. Commun. 2, 319-327.[Medline]
Vleminckx, K. and Kemler, R. (1999). Cadherins and tissue formation: integrating adhesion and signaling. Bioessays 21,211 -220.[CrossRef][Medline]
Watt, F. M. (2001). Stem cell fate and patterning in mammalian epidermis. Curr. Opin. Genet. Dev. 11,410 -417.[CrossRef][Medline]
Willert, K. and Nusse, R. (1998). ß-Catenin: a key mediator of Wnt signaling. Curr. Opin. Genet. Dev. 8,95 -102.[CrossRef][Medline]
Xia, X., Qian, S., Soriano, S., Wu, Y., Fletcher, A. M., Wang,
X. J., Koo, E. H., Wu, X. and Zheng, H. (2001). Loss of
presenilin 1 is associated with enhanced ß-catenin signaling and skin
tumorigenesis. Proc. Natl. Acad. Sci. USA
98,10863
-10868.
Zhang, Z. H., Hartmann, H., Do, V. M., Abramowski, D., Sturchler-Pierrat, C., Staufenbiel, M., Sommer, B., van de Wetering, M., Clevers, H., Saftig, P. et al. (1998). Destabilization of ß-catenin by mutations in presenilin-1 potentiates neuronal apoptosis. Nature 395,698 -702.[CrossRef][Medline]
Zhou, P., Byrne, C., Jacobs, J. and Fuchs, E.
(1995). Lymphoid enhancer factor 1 directs hair follicle
patterning and epithelial cell fate. Genes Dev.
9, 700-713.
Zhu, A. J. and Watt, F. M. (1999). ß-Catenin signalling modulates proliferative potential of human epidermal keratinocytes independently of intercellular adhesion. Development 126,2285 -2298.[Abstract]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
T. Grigoryan, P. Wend, A. Klaus, and W. Birchmeier Deciphering the function of canonical Wnt signals in development and disease: conditional loss- and gain-of-function mutations of {beta}-catenin in mice Genes & Dev., September 1, 2008; 22(17): 2308 - 2341. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Xie and D. D. Bikle The Recruitment of Phosphatidylinositol 3-Kinase to the E-cadherin-Catenin Complex at the Plasma Membrane Is Required for Calcium-induced Phospholipase C-{gamma}1 Activation and Human Keratinocyte Differentiation J. Biol. Chem., March 23, 2007; 282(12): 8695 - 8703. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Cheon, Q. Wei, A. Gurung, A. Youn, T. Bright, R. Poon, H. Whetstone, A. Guha, and B. A. Alman Beta-catenin regulates wound size and mediates the effect of TGF-beta in cutaneous healing FASEB J, April 1, 2006; 20(6): 692 - 701. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yin, S. Getsios, R. Caldelari, L. M. Godsel, A. P. Kowalczyk, E. J. Muller, and K. J. Green Mechanisms of Plakoglobin-dependent Adhesion: DESMOSOME-SPECIFIC FUNCTIONS IN ASSEMBLY AND REGULATION BY EPIDERMAL GROWTH FACTOR RECEPTOR J. Biol. Chem., December 2, 2005; 280(48): 40355 - 40363. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Teuliere, M. M. Faraldo, M. Shtutman, W. Birchmeier, J. Huelsken, J. P. Thiery, and M. A. Glukhova {beta}-Catenin-Dependent and -Independent Effects of {Delta}N-Plakoglobin on Epidermal Growth and Differentiation Mol. Cell. Biol., October 1, 2004; 24(19): 8649 - 8661. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Cattelino, S. Liebner, R. Gallini, A. Zanetti, G. Balconi, A. Corsi, P. Bianco, H. Wolburg, R. Moore, B. Oreda, et al. The conditional inactivation of the {beta}-catenin gene in endothelial cells causes a defective vascular pattern and increased vascular fragility J. Cell Biol., September 15, 2003; 162(6): 1111 - 1122. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. G. Lampugnani, A. Zanetti, M. Corada, T. Takahashi, G. Balconi, F. Breviario, F. Orsenigo, A. Cattelino, R. Kemler, T. O. Daniel, et al. Contact inhibition of VEGF-induced proliferation requires vascular endothelial cadherin, {beta}-catenin, and the phosphatase DEP-1/CD148 J. Cell Biol., May 26, 2003; 161(4): 793 - 804. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||