|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
doi: 10.1242/10.1242/jcs.00169
Research Article |

MRC Centre for Developmental Neurobiology, New Hunt's House, King's
College London, Guy's Campus, London SE1 1UL, UK
* Present address: Wolfson Centre for Age-Related Diseases, King's College
London, Guy's Campus, London SE1 1UL, UK
Author for correspondence (e-mail:
jonathan.corcoran{at}kcl.ac.uk)
Accepted 12 September 2002
| Summary |
|---|
|
|
|---|
. The same receptor deficit is found
in motoneurons from patients suffering from spontaneous amyotrophic lateral
sclerosis. Furthermore, we show that there is a loss of expression of the
retinaldehyde dehydrogenase enzyme II in motoneurons. Therefore, we propose
that a defect in the retinoid signalling pathway is in part be responsible for
some types of motoneuron disease.
Key words: Motoneuron, Retinoic acid, Neurodegeneration
| Introduction |
|---|
|
|
|---|
A feature of ALS is an abnormal accumulation of neurofilaments (NF) in the
cell bodies and axons of motoneurons
(Carpenter, 1968
;
Hirano et al., 1984a
;
Chou and Fakadej, 1971
;
Hirano et al., 1984b
). NF are
members of the family of intermediate filament proteins (IF). NF consist of
three proteins known as light (NF-L, 68kDa), medium (NF-M, 95 kDa) and heavy
(NF-M, 115 kDa). Overexpression of NF-L in mice results in degeneration and
loss of motoneurons (Lee et al.,
1994
), and injection of NF protein into cultured neurons causes
pathological changes that are observed in motoneuron disease
(Straube-West et al., 1996
).
One other pathology that is associated with ALS is reactive astrocytosis.
Astrocytes replicate and express increased amounts of glial fibrillary acidic
protein (GFAP) in response to neuronal damage
(Eddleston and Mucke, 1993
;
Montgomery, 1994
).
One unexplored pathway through which ALS may occur is through a defect in
the retinoid signalling pathway since retinoid-deficient diets can induce
nerve lesions (Hughes et al.,
1924
; Irving and Richards,
1938
). Retinoic acids (RAs) are synthesised in a two-step process.
Firstly alcohol dehydrogenases act on retinols to synthesise retinals
(Duester, 1998
). RAs are then
made from the retinals by retinaldehyde dehydrogenases (Raldhs). Three Raldhs
have being identified that show a restricted tissue distribution in the embryo
(Niederreither et al.,
2002
).
RA is important for the birth, survival and function of neurons
(Wuarin and Sidell, 1991
;
Quinn and De Boni, 1991
). RA
can stimulate both neurite number and length
(Maden, 1998
;
Corcoran and Maden, 1999
;
Corcoran et al., 2000
). The LIM
homeodomain gene islet-1 expressed by motoneurons can be regulated by
RA, and raldh-2 is expressed by these neurons
(Sockanathan and Jessell,
1998
).
Cellular effects of RA are mediated by binding to ligand-activated nuclear
transcription factors. There are two classes of receptors: RA receptors
(RARs), which are activated both by all-trans-RA (tRA) and 9-cis-RA
(9-cis-RA); and the retinoid X receptors (RXRs), which are activated only by
9-cis-RA (Kastner et al.,
1994
; Kliewer et al.,
1994
). There are three subtypes of each receptor:
, ß
and
. In addition, there are multiple isoforms of each subtype owing to
alternative splicing and differential promoter usage
(Leid et al., 1992
). RARs
mediate gene expression by forming heterodimers with RXRs, whereas RXRs can
mediate gene expression either as homodimers or by forming heterodimers with
orphan receptors, which are also members of the nuclear receptor superfamily,
examples of which include LXR and NGFI-B
(Mangelsdorf and Evans,
1995
).
In order to generate retinoid deficiency, the genes that encode the RA
synthesising enzymes can be deleted. However, gene deletion of
raldh-2 results in embryonic lethality
(Niederreither et al., 1999
);
hence the effects of retinoids on motoneuron survival cannot be studied.
Another approach is to create conditional mutants of raldh-2; however
it cannot be guaranteed that raldh-2 can be deleted in all
motoneurons in which it is expressed, thus raldh-2 expression may
mask any phenotype. Since Raldh-2 requires substrates in order to make RA, an
alternative approach is to deprive the adult of retinoids to prevent formation
of RA, which, in effect, creates the equivalent of a conditional mutant. Thus
Raldh-2 function is compromised in all cells that express it, including
motoneurons, allowing its role to be assessed. Therefore, analogous to a gene
deletion study, any phenotype observed must be a due to a lack of Raldh-2
function. We have generated adult retinoid-deficient rats by a dietary
deficiency of retinoids and investigated whether there is an effect on their
motoneurons. Our results support a role for the retinoid-signalling pathway in
the survival of motoneurons, and a defect in this pathway leads to motoneuron
disease in the adult rat. In patients suffering from spontaneous motoneuron
disease, the retinoid signalling pathway was also found to be defective,
suggesting that it may be one of the causes of the disease.
| Materials and Methods |
|---|
|
|
|---|
Human tissue
Post mortem lumbar spinal cord tissue was obtained from 10 cases of
spontaneous motoneuron disease and 10 aged-matched controls. The tissue was
fixed in 4% PFA, wax embedded and 10 µM sections were cut.
In situ hybridisation
In situ hybridisation was carried out as previously described
(Corcoran et al., 2000
).
RNA-species-specific probes were generated from gene-specific PCR products.
Every fifth slide containing two to three sections and five slides were
analysed for each probe used.
Identification and counting of motoneurons
For both rats and humans, motoneurons were identified and counted as
previously described (Sockanathan and
Jessell, 1998
). Spinal cord sections were examined at 100x
magnification. Images of both left and right ventral horns where the
motoneurons are located were captured and analysed by Image Pro Plus software.
In order to count all the motoneurons, the motoneurons were selected on the
basis of their size (35 µm in diameter and above) and automatically counted
using the Image Pro Plus software. For in situ hybridisation analysis,
motoneurons (35 µm in diameter and above) with a blue signal above
background were selected as positive and automatically counted by Image Pro
Plus software. In addition, for quantitative in situ hybridisation analysis
the above-background digoxigenin signals of raldh-2, RAR
and
islet-1 were measured in the motoneurons compared to the
above-background digoxigenin signal of gapdh in motoneurons using the
Image Pro Plus software. Sigma plot software was used for statistical
analysis.
RT-PCR
RNA was extracted and reverse transcribed as previously described
(Corcoran et al., 2000
).
Quantitative PCR was carried out using species-specific primers on a Roche
Lightcycler. The primers used were human gapdh, forward 211
aagggtcatcatctctgcc 229, and reverse, 376 ttccacgataccaaagttgtc 356; human
Raldh-2, forward 55 gttccctgtctataatccagcc 76, and reverse 204
gtcccctttctgaagcatc 185; human RAR
, forward 84 tctgagagctacacgctgac
103, and reverse 275 cttaatgatgcacttggtggag 254; human islet-1, forward 667
ggtctggtttcaaaacaagcg 687, and reverse 828 ttagcctgtaagccaccgtc 809. Cycling
parameters were: denaturing 95°C, 1 second; annealing 55°C, 1 second;
and extension 72°C 1 second for 30 cycles.
| Results |
|---|
|
|
|---|
|
|
Spinal cord sections were examined by staining for neuronal intermediate filaments with the antibody NF200 and the motoneurons identified by their location in the ventral horns. Neurofilaments had accumulated in the cell body of the motoneurons in the lumbar and cervical regions of retinoid-deficient spinal cords (Fig. 3B,D) compared to the same regions of the spinal cord of the normally fed rat (Fig. 3A,C). Also in the retinoid-deficient lumbar cord there was accumulation of the neurofilament in the axons (Fig. 3B). In the six-month-old retinoid-deficient rats, the motoneurons of the lumbar cord had more vacuolar lesions (Fig. 3B) than the motoneurons located in the cervical cord (Fig. 3D). In the normal rat no vacuolar lesions were seen in the motoneurons at either level of the spinal cord examined (Fig. 3A,C). There were 34% less motoneurons in the lumbar cord of the retinoid-deficient rats compared with the normally fed rats (Fig. 4 columns 1 and 2). Of the surviving motoneurons in the retinoid-deficient rat, 14% had vacuoles (Fig. 4 column 3). There was an increase in reactive astrocytosis in the lumbar cord of the retinoid-deficient rats (Fig. 5B,C, lane 2) compared with the lumbar cord of the normal rat (Fig. 5A,C, lane 1). After 1 year of a retinoid-deficient diet there was a dramatic loss of NF200 expression in the cell bodies of the surviving motoneurons of the retinoid-deficient rat compared with the motoneurons of the normally fed rats (data not shown).
|
|
|
We next investigated which components of the retinoid signalling pathway
were perturbed. In situ hybridisation with the three RARs, and three
raldhs showed that only RAR
and raldh-2 were
expressed in the motoneurons. Although RAR
was depleted in the
motoneurons of the lumbar cord of the 6-month-old retinoid-deficient rats
compared to the equivalent regions of the cord in the control rats
(Fig. 6A,B,E, columns 1 and 2)
raldh-2 did not vary between the normally fed and retinoid-deficient
rats (Fig. 6C-E, columns 1 and
2). Similar results were obtained from the 6 month cervical cord and the 1
year cords of both normal and retinoid-deficient rats (data not shown). This
suggests that although a loss in RAR
expression is due to a
lack of retinoids, the enzyme that makes these retinoids is not itself
regulated by RA in the motoneurons.
|
We next analysed the components of the retinoid signalling pathway
identified in the retinoid-deficient rats in post mortem lumbar spinal cord
tissue from spontaneous cases of motoneuron disease. Using real time RT-PCR,
we quantified the amount of RAR
, RA enzymes and
islet-1 expression compared with gapdh in human lumbar
spinal cord from motoneuron-diseased and normal patients. All three
transcripts were depleted in the diseased compared with the normal cord:
RAR
, 37%; Raldh-2, 22%; islet-1, 42%;
P<0.01. In order to count the number of motoneurons expressing
these transcripts and the level of their expression in situ hybridisation was
performed using gene-species-specific probes
(Fig. 7A-F). The percentage of
motoneurons in control and diseased patients expressing islet-1 was
61% and 48%, respectively (Fig.
6, columns 1 and 2). There was a 37% loss of motoneurons
expressing RAR
in patients suffering from the disease compared
with normal samples (Fig. 8,
columns 3 and 4). We finally asked if there was a defect in the expression of
raldh-2. In the non-diseased patients 56% of the motoneurons
expressed this enzyme (Fig. 8,
column 5) compared with 16% of the motoneurons in the diseased patients
(Fig. 8, column 6), suggesting
a decrease in expression of the enzyme in the diseased state.
|
|
Lastly, we quantified the in situ hybridisation signal of the transcripts
in the surviving motoneurons to answer the question of whether the
retinoid-signalling pathway was depleted in them. Islet-1 expression
was decreased by 56%, RAR
by 31% and raldh-2 by 49%
in the diseased motoneurons compared with their expression in non-diseased
motoneurons, P<0.05 (Fig.
9 columns 1-6).
|
| Discussion |
|---|
|
|
|---|
Disruption of the retinoid signalling pathway in the adult rat leads
to a loss of motoneurons
The major retinoid signalling pathway defect in the retinoid deficient rat
is the loss of RAR
expression in the motoneurons: no
expression of either RARß or RAR
was detected by
in situ analysis or RT-PCR. RA has been shown to regulate RAR
(Leroy et al., 1991
) and
appears to be critical for the survival of the motoneurons. The data presented
here shows that the retinoid signalling pathway is critical for the survival
of neurons of the adult CNS. This has been previously shown for the embryonic
CNS, where in addition it is required for the differentiation of neurons
(Wuarin and Sidell, 1991
;
Quinn and De Boni, 1991
).
Therefore, the role of the retinoid signalling pathway in neuron survival in
the embryonic CNS is conserved in the adult CNS.
Motoneuron defects have not been reported in RAR
-null
mutant mice but to our knowledge such analysis has not been carried out.
However, one of the major problems with such studies has been the functional
redundancy between the receptors, thus masking their potential role in
development and as well as their functions in the adult. The approach we have
taken to overcome such functional redundancy is to create retinoid-deficient
animals by a dietary deficiency of retinoids. This has a distinct advantage
over the RAR gene deletion studies because the receptors are normally
expressed during development when the embryos receive adequate amounts of
retinoids, hence development is not perturbed. However, once the animals are
retinoid-deprived, only the retinoid signalling pathway that is normally
expressed in cells is altered. At such a late developmental stage it is
unlikely that one receptor can substitute for another.
Furthermore we are asking which RARs are involved in the survival of normal
adult motoneurons, since other RARs may be involved in the survival of
developing motoneurons. Such dual functions of the same molecule have been
shown before. For instance, in the developing nervous system, NGF is required
for the survival of the developing peripheral neurons, whereas in the adult
the peripheral neurons do not require NGF for their survival but it has been
shown to be involved in neurite outgrowth
(Lindsay, 1988
). Hence, the
generation of retinoid-deficient animals may lead to the discovery of novel
roles for other retinoid receptors in the adult.
A retinoid signalling defect is present in patients with spontaneous
motoneuron disease
In human spontaneous motoneuron disease, by counting the number of
motoneurons, we found a decrease in the number of RAR
-positive
neurons and raldh-2-positive neurons in the diseased state compared
with control samples. As well as the loss of motoneurons, all three
transcripts assayed, RAR
, islet-1 and raldh-2, were
dramatically reduced in the diseased motoneurons compared with the control
tissue samples. The same loss in RAR
in motoneurons of
diseased patients was observed as in retinoid-deficient rats. In addition
there was a loss of islet-1 expression in the motoneurons, suggesting
that, as in the embryonic CNS, RA regulates this gene in the adult.
Therefore, our results suggest that a cause of the disease in humans is
retinoid signalling defect. This is further supported by our observations that
motoneuron disease in the rat is a consequence of a retinoid signalling
pathway defect since the animals were fed a retinoid-deficient diet, thus the
loss of motoneurons must be a consequence of lack of retinoids. The loss of
motoneurons does not precede the loss of retinoid signalling. Most if not all
the motoneurons in the retinoid-deficient rat had lost RAR
expression. This loss of expression included those motoneurons that had
vacuolations and were therefore destined to undergo cell death. Also if the
defect in the retinoid signalling pathway was a consequence of motoneuron
disease then in the surviving motoneurons of both the retinoid-deficient rat
and human motoneuron-diseased samples, there would be a downregulation of both
RAR
and raldh-2 compared with the controls. However,
it is only in the human-diseased samples that both transcripts are
downregulated.
RA synthesis may be a key factor in motoneuron disease
The sequence of events leading to motoneuron disease is likely to be loss
of raldh-2 expression, followed by the depletion of cellular
retinoids. This would result in the loss of RAR
activation and
expression. Eventually a downregulation of islet-1 would occur, which
is either before or after, an increase in neurofilament expression and the
consequent motoneuron cell death. It is unlikely that RAR
can
regulate raldh-2 expression since it makes the ligand, which
RAR
requires in order to activate gene transcription. Indeed
it has already been shown that raldh-2 slightly precedes the
expression of RARß in differentiating limbs
(Niederreither et al.,
1997
).
Factors that regulate raldh-2 may be associated with motoneuron
disease. One of the factors is unlikely to be RA itself, since in the
retinoid-deficient rat model there was no difference in the levels of
raldh-2 in their motoneurons compared with the normally fed rats.
This suggests that RA does not regulate raldh-2 expression in the
adult rat motoneurons. Therefore, in both the retinoid deficient and normally
fed rats, the factors that regulate raldh-2 are probably still
present. By contrast, in human motoneuron disease it is these factors that
regulate raldh-2 that are absent since the enzyme is downregulated in
diseased motoneurons compared with normal samples. What may these factors be?
Interestingly it has been proposed that neurotrophins such as NT-3 may be
useful for treating motoneuron disease
(Haase et al., 1998
;
Haase et al., 1997
;
Sagot et al., 1998
), and we
have already shown that a related neurotrophin, NGF, can activate
raldh-2 transcription (Corcoran
and Maden, 1999
). It will be of great interest to identify the
factors that regulate raldh-2 expression and to see if these are also
deficient in motoneuron disease patients. Since the same pathology is seen in
spontaneous and familial cases of motoneuron disease, it will also be of
interest to ask if retinoids can regulate genes involved in familial forms of
the disease. Recently it has been shown that the SOD1 promoter contains a
binding site for the orphan receptor peroxisome proliferator-activated
receptor (PPAR), which can be induced to bind to the promoter by both RA and
9-cis RA (Yoo et al., 1999
).
This provides further support for the involvement of the retinoid signalling
pathway in human motoneuron disease.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Carpenter, S. (1968). Proximal axonal
enlargement in motor neuron disease. Neurology
18,841
-851.
Chou, S. M. and Fakadej, A. V. (1971). Ultrastructure of chromatolytic motoneurons and anterior spinal roots in a case of Werdnig-Hoffmann disease. J. Neuropathol. Exp. Neurol. 30,368 -379.[Medline]
Corcoran, J. and Maden, M. (1999). Nerve growth factor acts via retinoic acid synthesis to stimulate neurite outgrowth. Nat. Neurosci. 2,307 -308.[CrossRef][Medline]
Corcoran, J., Shroot, B., Pizzey, J. and Maden, M. (2000). The role of retinoic acid receptors in neurite outgrowth from different populations of embryonic mouse dorsal root ganglia. J. Cell Sci. 113,2567 -2574.[Abstract]
Corcoran, J. P. and Ferretti, P. (1999). RA regulation of keratin expression and myogenesis suggests different ways of regenerating muscle in adult amphibian limbs. J. Cell Sci. 112,1385 -1394.[Abstract]
Delisle, M. B. and Carpenter, S. (1984). Neurofibrillary axonal swellings and amyotrophic lateral sclerosis. J. Neurol. Sci. 63,241 -250.[CrossRef][Medline]
Deng, H. X., Hentati, A., Tainer, J. A., Iqbal, Z., Cayabyab,
A., Hung, W. Y., Getzoff, E. D., Hu, P., Herzfeldt, B. and Roos, R. P.
(1993). Amyotrophic lateral sclerosis and structural defects in
Cu,Zn superoxide dismutase. Science
261,1047
-1051.
Duester, G. (1998). Alcohol dehydrogenase as a critical mediator of retinoic acid synthesis from vitamin A in the mouse embryo. J. Nutr. 128,459S -462S.
Eddleston, M. and Mucke, L. (1993). Molecular profile of reactive astrocytesimplications for their role in neurologic disease. Neuroscience 54, 15-36.[CrossRef][Medline]
Haase, G., Kennel, P., Pettmann, B., Vigne, E., Akli, S., Revah, F., Schmalbruch, H. and Kahn, A. (1997). Gene therapy of murine motor neuron disease using adenoviral vectors for neurotrophic factors. Nat. Med. 3,429 -436.[CrossRef][Medline]
Haase, G., Pettmann, B., Vigne, E., Castelnau-Ptakhine, L., Schmalbruch, H. and Kahn, A. (1998). Adenovirus-mediated transfer of the neurotrophin-3 gene into skeletal muscle of pmn mice: therapeutic effects and mechanisms of action. J. Neurol. Sci. 160 Suppl. 1,S97 -105.
Hirano, A., Donnenfeld, H., Sasaki, S. and Nakano, I. (1984a). Fine structural observations of neurofilamentous changes in amyotrophic lateral sclerosis. J. Neuropathol. Exp. Neurol. 43,461 -470.[Medline]
Hirano, A., Nakano, I., Kurland, L. T., Mulder, D. W., Holley, P. W. and Saccomanno, G. (1984b). Fine structural study of neurofibrillary changes in a family with amyotrophic lateral sclerosis. J. Neuropathol. Exp. Neurol. 43,471 -480.[Medline]
Hughes, J. S., Lienhardt, H. F. and Aubel, C. E. (1924). Nerve degeneration resulting from avitaminosis A. J. Nutrition 2,183 -186.
Irving, J. T. and Richards, M. B. (1938). Early lesions of vitamin A deficiency. J. Physiol. 94,307 -321.
Jackson, C. E. and Bryan, W. W. (1998). Amyotrophic lateral sclerosis. Semin. Neurol. 18, 27-39.[Medline]
Kastner, P., Chambon, P. and Leid, M. (1994). Role of nuclear retinoic acid receptors in the regulation of gene expression. In Vitamin A in Health and Disease (R. Blomhoff ed.), pp. 189-238. New York: Marcel Dekker Inc.
Kliewer, S. A., Umesono, K., Evans, R. M. and Mangelsdorf, D. J. (1994). The retinoid X receptors: modulators of multiple hormonal signalling pathways. In Vitamin A in Health and Disease (R. Blomhoff ed.), pp. 239-255. New York: Marcel Dekker Inc.
Lee, M. K., Marszalek, J. R. and Cleveland, D. W. (1994). A mutant neurofilament subunit causes massive, selective motor neuron death: implications for the pathogenesis of human motor neuron disease. Neuron 13,975 -988.[CrossRef][Medline]
Leid, M., Kastner, P. and Chambon, P. (1992). Multiplicity generates diversity in the retinoic acid signalling pathways. Trends Biochem. Sci. 17,427 -433.[CrossRef][Medline]
Leroy, P., Krust, A., Zelent, A., Mendelsohn, C., Garnier, J. M., Kastner, P., Dierich, A. and Chambon, P. (1991). Multiple isoforms of the mouse retinoic acid receptor alpha are generated by alternative splicing and differential induction by retinoic acid. EMBO J. 10,59 -69.[Medline]
Lindsay, R. M. (1988). Nerve growth factors (NGF, BDNF) enhance axonal regeneration but are not required for survival of adult sensory neurons. J. Neurosci. 8,2394 -2405.[Abstract]
Maden, M. (1998). The role of retinoids in developmental mechanisms in embryos. Subcell. Biochem. 30, 81-111.[Medline]
Mangelsdorf, D. J. and Evans, R. M. (1995). The RXR heterodimers and orphan receptors. Cell 83,841 -850.[CrossRef][Medline]
Montgomery, D. L. (1994). Astrocytes: form, functions, and roles in disease. Vet. Pathol. 31,145 -167.[Abstract]
Mulder, D. W., Kurland, L. T., Offord, K. P. and Beard, C. M. (1986). Familial adult motor neuron disease: amyotrophic lateral sclerosis. Neurology 36,511 -517.[Abstract]
Niederreither, K., McCaffery, P., Drager, U. C., Chambon, P. and Dolle, P. (1997). Restricted expression and retinoic acid-induced downregulation of the retinaldehyde dehydrogenase type 2 (RALDH-2) gene during mouse development. Mech. Dev. 62, 67-78.[CrossRef][Medline]
Niederreither, K., Subbarayan, V., Dolle, P. and Chambon, P. (1999). Embryonic retinoic acid synthesis is essential for early mouse post-implantation development. Nat. Genet. 21,444 -448.[CrossRef][Medline]
Niederreither, K., Fraulob, V., Garnier, J. M., Chambon, P. and Dolle, P. (2002). Differential expression of retinoic acid-synthesizing (RALDH) enzymes during fetal development and organ differentiation in the mouse. Mech. Dev. 110,165 -171.[CrossRef][Medline]
Quinn, S. D. and de Boni, U. (1991). Enhanced neuronal regeneration by retinoic acid of murine dorsal root ganglia and of fetal murine and human spinal cord in vitro. In Vitro Cell Dev. Biol. 27,55 -62.[Medline]
Rosen, D. R. (1993). Mutations in Cu/Zn superoxide dismutase gene are associated with familial amyotrophic lateral sclerosis. Nature 364,362 .[Medline]
Rouleau, G. A., Clark, A. W., Rooke, K., Pramatarova, A., Krizus, A., Suchowersky, O., Julien, J. P. and Figlewicz, D. (1996). SOD1 mutation is associated with accumulation of neurofilaments in amyotrophic lateral sclerosis. Ann. Neurol. 39,128 -131.[CrossRef][Medline]
Sagot, Y., Rosse, T., Vejsada, R., Perrelet, D. and Kato, A.
C. (1998). Differential effects of neurotrophic factors on
motoneuron retrograde labeling in a murine model of motoneuron disease.
J. Neurosci. 18,1132
-1141.
Shibata, N., Asayama, K., Hirano, A. and Kobayashi, M. (1996). Immunohistochemical study on superoxide dismutases in spinal cords from autopsied patients with amyotrophic lateral sclerosis. Dev. Neurosci. 18,492 -498.[Medline]
Sockanathan, S. and Jessell, T. M. (1998). Motor neuron-derived retinoid signaling specifies the subtype identity of spinal motor neurons. Cell 94,503 -514.[CrossRef][Medline]
Straube-West, K., Loomis, P. A., Opal, P. and Goldman, R. D. (1996). Alterations in neural intermediate filament organization: functional implications and the induction of pathological changes related to motor neuron disease. J. Cell Sci. 109,2319 -2329.[Abstract]
Wuarin, L. and Sidell, N. (1991). Differential susceptibilities of spinal cord neurons to retinoic acid- induced survival and differentiation. Dev. Biol. 144,429 -435.[CrossRef][Medline]
Yoo, H. Y., Chang, M. S. and Rho, H. M. (1999). Induction of the rat Cu/Zn superoxide dismutase gene through the peroxisome proliferator-responsive element by arachidonic acid. Gene 234,87 -91.[CrossRef][Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||