|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
doi: 10.1242/10.1242/jcs.00181
Research Article |



1 Institute of Cell Biology, ETH Hönggerberg, 8093 Zurich,
Switzerland
2 Division of Clinical Chemistry and Biochemistry, Department of Pediatrics,
University of Zurich, 8032 Zurich, Switzerland
* Present address: Dualsystems Biotech AG, Winterthurerstrasse 190, 8057
Zürich, Switzerland
Author for correspondence (e-mail:
jcp{at}cell.biol.ethz.ch)
Accepted 23 September 2002
| Summary |
|---|
|
|
|---|
Key words: LIM domain, Sarcomere, Cardiac cytoarchitecture
| Introduction |
|---|
|
|
|---|
In skeletal muscles and in the heart several LIM domain proteins have been
discovered that participate in muscle differentiation and play important roles
in linking the myofibrils to the surrounding cytoskeleton
(Arber et al., 1994
;
Luo et al., 1997
;
Pomies et al., 1999
;
Zhou et al., 2001
). Mice
deficient in the muscle LIM protein MLP display severe alterations in
intercalated disc structure and ultimately develop dilated cardiomyopathy
(Arber et al., 1997
;
Ehler et al., 2001
). Mice
lacking the
-actinin associated LIM protein Alp show a specific
cardiomyopathy of the right ventricle
(Pashmforoush et al., 2001
).
Ablation of cypher, a striated muscle specific LIM-PDZ domain protein, leads
to congenital myopathy and ventricular dilation in mice
(Zhou et al., 2001
). Elevated
expression levels of N-RAP, an intercalated disc associated LIM-domain
protein, serve as one of the earliest indicators for dilated cardiomyopathy
(Ehler et al., 2001
). These
findings suggest that LIM domain proteins act as adaptors in striated muscle
in general and the heart especially and help to maintain the cytoarchitecture
during contraction. In their absence, decreased power output results, often
followed by dilated cardiomyopathy (reviewed by
Chien, 1999
;
Chien, 2000
).
DRAL/FHL-2 is a member of the four and a half LIM domain protein subfamily
which possesses an N-terminal half LIM domain followed by four complete LIM
domains. Members of this family include FHL-1, DRAL also called FHL-2, FHL-3,
FHL-4 and ACT (Morgan and Madgwick,
1996
; Genini et al.,
1997
; Fimia et al.,
1999
; Morgan and Madgwick,
1999a
). A characteristic property of all FHL proteins is their
tissue-specific expression pattern (Chu et
al., 2000a
). Only FHL-1 is expressed in a broad range of tissues,
ranging from skeletal and heart muscle to kidney, lung and brain
(Fimia et al., 2000
).
DRAL/FHL-2 was discovered in a screen for cancer-related genes that are
downregulated in a rhabdomyosarcoma cell line (hence the name DRAL, for
downregulated rhabdomyosarcoma LIM protein) and was subsequently shown to be
highly expressed in the heart (Genini et
al., 1997
; Chan et al.,
1998
; Chu et al.,
2000a
; Müller et al.,
2000
; Scholl et al.,
2000
; Li et al.,
2001a
). FHL-3 is strongly expressed in skeletal muscle, where it
may serve similar functions as DRAL/FHL-2 in the heart
(Fimia et al., 2000
;
Morgan and Madgwick, 1999b
).
FHL-4 and ACT are different from the other members of the family since they
are not expressed in either heart or skeletal muscles, but in the testis
(Fimia et al., 2000
).
To date, several binding partners of DRAL/FHL-2 have been identified. The
N-terminal fragment of the Alzheimer's disease-associated protein presenilin-2
interacts with DRAL/FHL-2 via its hydrophilic loop region
(Tanahashi and Tabira, 2000
).
The cytoplasmic domains of several
- and ß-integrins also interact
with DRAL/FHL-2, implicating DRAL/FHL-2 as an adaptor/docking protein involved
in integrin signalling (Wixler et al.,
2000
). DRAL/FHL-2 can form homodimers as well as heterodimers
together with its family member FHL-3
(Wixler et al., 2000
;
Li et al., 2001b
). DRAL/FHL-2
has been identified as a tissue-specific coactivator of the androgen receptor
(Müller et al., 2000
),
and also interacts with insulin-like growth factor-binding protein 5
(Amaar et al., 2002
), the
DNA-binding nuclear protein hNP220 (Ng et
al., 2002
) and the transcription factor CREB
(Fimia et al., 1999
;
Fimia et al., 2000
). CREB is
induced in cardiac cells after ß-adrenergic stimulation
(Goldspink and Russell, 1996
)
and mice bearing a dominant negative isoform of CREB have been shown to
develop dilated cardiomyopathy (Fentzke et
al., 1998
). DRAL/FHL-2 knockout experiments also lend support to a
role for DRAL/FHL-2 as an adaptor protein involved in cardiac stress
management and signalling. Mice lacking DRAL/FHL-2 develop normally but show a
hypertrophic response following ß-adrenergic stimulation, indicating an
involvement of DRAL/FHL-2 in the remodelling mechanisms employed by
cardiomyocytes in response to stress (Kong
et al., 2001
).
In cardiomyocytes, DRAL/FHL-2 is associated with sarcomeres where it is
found in a cross-striated pattern (Scholl
et al., 2000
). Sarcomeres are the contractile units of muscle and
are composed of highly regular, interdigitating arrays of thick and thin
filaments. Two transverse structures, the M-band and the Z-disc, serve as
primary anchor points for the thick and thin filaments, respectively.
Sarcomere assembly and integrity are controlled by the elastic filament system
composed of the giant protein titin. Titin molecules form elastic scaffolding
structures spanning more than 1 µm from a Z-disc to the M-band
(Obermann et al., 1996
;
Fürst et al., 1988
;
Trinick and Tskhovrebova,
1999
). The distinct localisation of DRAL/FHL-2 at the M-band and,
more prominently, around the Z-disc region in cardiomyocytes suggests that it
may link other proteins to the sarcomere. To investigate a potential function
of DRAL/FHL-2 as a sarcomeric adaptor molecule in the heart we searched for
interaction partners that mediate the binding of DRAL/FHL-2 to the sarcomere.
We have identified two different regions in the sarcomeric ruler molecule
titin that act as binding sites for DRAL/FHL-2. In addition, we show an
interaction of DRAL/FHL-2 with the metabolic enzymes creatine kinase,
phosphofructokinase and adenylate kinase. We propose that DRAL/FHL-2 plays a
crucial role in the recruitment of metabolic enzymes to sites of high energy
consumption in the cardiac sarcomere.
| Materials and Methods |
|---|
|
|
|---|
Whole mount staining of rat papillary muscle
Papillary muscle was dissected from adult rat hearts, incubated for 30
minutes in relaxation buffer (7 mM EGTA, 20 mM Imidazol, 1 mM
MgCl2, 14.5 mM creatine phosphate, 4 mM MgATP, 100 mM KCl, pH7.0,
0.1% saponin), tied onto plastic strips at slightly extended length and fixed
in 4% PFA/PBS for 1 hour. Permeabilisation with 0.2% Triton X-100 was carried
out for 30 minutes, subsequently the muscle strips were cut into smaller
pieces and stained as a whole mount as described previously for embryonic
heart whole mount preparations (Ehler et
al., 1999
).
Eukaryotic expression constructs
The eukaryotic expression vector pMCS-HA was constructed by removal of GFP
in pEGFP (Clontech) with BamHI and NotI and ligation of a
linker encoding the HA epitope followed by a stop codon into the
BamHI and NotI sites. The constructs NF-DRAL/FHL-2 and
DRAL/FHL-2-CF, encoding N- and C-terminally FLAG-tagged DRAL/FHL-2 in the
pcDNA3.1 vector (Invitrogen, Basel, Switzerland) have been described
(Scholl et al., 2000
). The
plasmid pGFP-DRAL/FHL-2 was constructed by excising DRAL/FHL-2 from
DRAL/FHL-2-CF using BamHI and XhoI and subcloning into the
BglII and SalI sites of pEGFP. The constructs GFP-is2 and
MM-CK-HA were made by subcloning is2 and MM-CK from the original yeast
two-hybrid library plasmids into pEGFP and pMCS-HA using EcoRI and
XhoI sites. To create GFP-N2B, the sequence encoding amino acids 3455
to 4427 in the primary sequence of human cardiac titin
(Labeit and Kolmerer, 1995
)
was amplified from embryonic human cardiac RNA with the Qiagen one step RT-PCR
kit (Qiagen, Basel, Switzerland) using the primers n2bfw
(5'gaagatctatggaaggcactggcccaattttcatcaaagaa3') and n2brv
(5'ccgctcgagcactgtcacagttagtgtggctgtacagct3'). Reverse
transcription was carried out using a three step protocol: 50°C for 30
minutes, 60°C for 30 minutes and 95°C for 15 minutes. This was
followed by the amplification step: 35 cycles of 30 seconds at 94°C, 45
seconds at 65°C and 3 minutes at 72°C and a final incubation for 10
minutes at 72°C. The PCR product was subcloned into the BglII and
SalI sites of pEGFP. To construct GFP-tagged adenylate kinase and
phosphofructokinase, the entire open reading frame was amplified using the
primers akfw (5'gaagatctaccatggaagagaagctgaagaaggcc3'), akrv
(5'ccgctcgagcttcagggagtcaagataggtgca3'), pfkfw
(5'gaagatctaccatgacccatgaagagcatcatgc3') and pfkrv
(5'ccgctcgaggacggcggcttctccagaccg3') and subcloned into the Bgl II
and Sal I sites in pEGFP. To construct GFP-tagged Smpx/Csl, the entire open
reading frame was amplified by PCR using the primers cslfw
(5'gaagatctaccatgtcgaagcagccaatttccaat3') and cslrv
(5'ccgctcgagctgttcacctttggggacaaattt3') and subcloned into the
BglII and SalI sites of pEGFP. GFP-N2B deletion mutants were
constructed by removing the fragments indicated in
Fig. 5 using internal
restriction sites. All constructs derived by PCR were fully sequenced on both
strands.
|
Yeast two-hybrid assays
The entire coding region of human DRAL/FHL-2 was amplified by PCR and
cloned into the EcoRI and NotI sites of pGilda
(Gyuris et al., 1993
),
Clontech, Palo Alto, CA). Yeast two-hybrid screening procedures and
ß-galactosidase filter assays were carried out as described by the
manufacturer. The plasmid was transferred into the yeast strain EGY48
(Estojak et al., 1995
), which
was then transformed with an adult human cardiac cDNA library (Clontech).
1x107 primary transformants were screened, resulting in 200
clones that grew on selection plates lacking the amino acids histidine,
tryptophan and leucine and were positive in a ß-galactosidase filter
assay. Library plasmids from positive clones were isolated and sequenced. To
confirm the interaction between DRAL/FHL-2 and either is2 or MM-CK, bait and
library inserts were switched using the EcoRI and XhoI sites
in the bait and prey vectors, cotransformed into EGY48 and assayed for growth
on selective plates and ß-galactosidase activity. To assay the
interaction between DRAL/FHL-2 and N2B, the coding sequence of DRAL/FHL-2 was
subcloned into the EcoRI and XhoI sites of the pLexA bait
vector (Stenmark et al.,
1995
). The sequence encoding N2B was excised from GFP-N2B by
cutting with XhoI, filling of 5' overhangs using Klenow enzyme
and cutting with BamHI and cloned into the BglII and
SmaI sites of the vector pACT2 (Clontech). The two plasmids were
cotransformed into the yeast strain L40
(Vojtek et al., 1993
) and
assayed for growth on selection plates lacking the amino acids tryptophan,
leucine and histidine as well as for ß-galactosidase activity.
Immunofluorescent staining of NRC and sections
Primary cultures of neonatal rat cardiomyocytes were isolated and cultured
as previously described (Auerbach et al.,
1999
). Cells were cultured in Maintenance medium (20% medium M199,
75% DBSS-K, 4% horse serum, 4 mM glutamine, 1% penicillin/streptomycin, 0.1 mM
phenylephrine; DBSS-K: 6.8 g/l NaCl, 0.14 mM NaH2PO4,
0.2 mM CaCl2, 0.2 mM MgSO4, 1 mM dextrose, 2.7 mM
NaHCO3) and transient transfections were carried out after 1 day in
culture using the reagent Escort III (Sigma) according to the manufacturer.
24-48 hours after transfection, cells were fixed in 4% paraformaldehyde/PBS
for 10 minutes and stained with different antibodies as previously described
(Auerbach et al., 1999
).
Confocal microscopy
The specimen were analysed using confocal microscopy on an inverted
microscope DM IRB/E equipped with a true confocal scanner TCS NT, a PL APO
63x/1.32 oil and a PL APO 100x/1.40 immersion objective (Leica) as
well as an argon-krypton mixed gas laser. Image processing was done on a
Silicon Graphics workstation using Imaris® (Bitplane AG), a 3D
multichannel image processing software specialised for confocal microscopy
data sets (Messerli et al.,
1993
).
Preparation of COS-1 total lysates
COS-1 cells (Gluzman, 1981
)
were cultured in maintenance medium consisting of DMEM, 10% fetal calf serum
and 4 mM glutamine (Gibco, Basel, Switzerland). For transfection, the cells
were grown to 80% confluency in 10 cm dishes, 107 cells were
pelleted, washed twice with PBS and resuspended in 800 µl PBS. 10 µg of
plasmid were added to a 4 mm gap cuvette (BTX, Axon Lab, Baden, Switzerland)
on ice, mixed with 800 µl of cells by tapping and incubated for 5 minutes
on ice. Cells were electroporated in a BTX Electro cell manipulator 600 (BTX)
using the following conditions: capacitance setting 125 µF, voltage 300 V,
resistance 72
. After electroporation, cells were left on ice for 5
minutes, transferred to 10 cm dishes with maintenance medium and incubated for
48-72 hours. Lysates were prepared by washing cells twice with ice-cold PBS,
adding 1 ml of lysis buffer (10 mM HEPES pH 7.9, 100 mM KCl, 5 mM
MgSO4, 50 µM ZnSO4, 1.5% Triton X-100, 1 mM DTT,
protease inhibitors) and incubation for 10 minutes on ice. Cells were scraped
off the plate, transferred to eppendorf tubes and incubated for 10 minutes on
ice. Lysates were sonicated in an ice/water bath (ELMA sonicator, Transsonic
Digitals, Singen, Germany) at maximum setting for 10 minutes and centrifuged
for 5 minutes at 5000 g. The supernatants were transferred to fresh
tubes and stored on ice.
Pull-down assays
A plasmid encoding GST-DRAL/FHL-2 fusion protein
(Genini et al., 1997
) was
transformed into E. coli BL21 Star cells (Invitrogen). The cells were
grown at 37°C in LB supplemented with 50 µM ZnSO4 to an
OD600 of 1.0, induced with 0.2 mM IPTG and grown for another 30
minutes at 37°C. Cells were pelleted and resuspended in 1/25 volume of
lysis buffer (10 mM HEPES pH 7.9, 100 mM KCl, 50 µM ZnSO4, 1%
Triton X-100, 1 mM DTT) supplemented with 0.5 mg/ml lysozyme (Sigma),
incubated for 30 minutes on ice and sonicated 5 times 10 seconds (Branson
Sonifier 250, output setting 6, 60% duty cycle). Cellular debris were removed
by centrifugation for 20 minutes at 15,000 g and GST-fusion protein
was absorbed on beads by incubation with Glutathione-Sepharose 4B beads
(Pharmacia, Uppsala, Sweden) for 30 minutes on ice. The beads were washed four
times in ST buffer and stored on ice. For pull-down assays, defined amounts of
bead-coupled GST-DRAL/FHL-2 or GST alone were washed once in IP buffer (10 mM
HEPES pH 7.9, 100 mM KCl, 5 mM MgSO4, 0.5% NP-40, 50 µM
ZnSO4, 1 mM DTT) supplemented with a protease inhibitor cocktail
(Roche Diagnostics, Rotkreuz, Switzerland) and incubated for 3 hours on ice
with precleared lysates from COS-1 cells expressing the respective binding
partners or controls. Following incubation, the complexes were pelleted by
centrifugation, washed four times in IP buffer, resuspended in SDS-PAGE sample
buffer, boiled and loaded on 12.5% SDS-PAGE gels. The proteins were
transferred to nitrocellulose membranes according to standard procedures and
visualised by immunoblotting as described above.
Co-immunoprecipitation
COS cells were co-transfected with GFP-N2B
5 and DRAL/FHL-2-FLAG and
lysed as described above. After preclearing by incubation with Protein G
Plus/Protein A agarose (Oncogene) diluted in IP buffer (see above), the
lysates were incubated with the monoclonal mouse anti-FLAG antibody at 4°C
overnight. Then Protein G Plus/Protein A agarose was added and incubated for 3
hours at 4°C. Following several washes with IP buffer, the beads were
processed for an SDS sample and immunoblotting with the Horse radish
peroxidase-conjugated polyclonal rabbit anti-GFP antibody (Clontech) was
carried out as described above.
Antibodies
Monoclonal mouse antibodies against
-cardiac actin were obtained
from Progen (Heidelberg, Germany), monoclonal mouse antibodies against FLAG M2
were from Sigma (Buchs, Switzerland), monoclonal mouse anti-GFP (clones 7.1
and 13.1) and monoclonal rat anti-HA tag (clone 3F10) antibodies were from
Roche Diagnostics (Rotkreuz, Switzerland) and polyclonal Horse radish
peroxidase-conjugated rabbit anti-GFP antibodies were from Clontech.
Polyclonal rabbit antibodies against DRAL/FHL-2 were produced in the lab
(Scholl et al., 2000
),
polyclonal rabbit antibodies against the titin m8 epitope and monoclonal mouse
antibodies against the titin N2B epitope (clone I19) were generously donated
by Mathias Gautel (King's College London, UK). Polyclonal chicken antibodies
against N2A were a kind gift from Carol Gregorio (University of Arizona,
Tucson, AZ) and monoclonal mouse anti-titin T12 epitope antibodies were
generously provided by Dieter Fürst (University of Potsdam, Germany). The
monoclonal mouse anti-titin 9D10 epitope antibody was obtained from the
Developmental Studies Hybridoma Bank, University of Iowa, USA.
As secondary antibodies FITC-conjugated anti-rabbit and anti-mouse Igs were employed (Cappel, via ICN Germany). Cy3-conjugated anti-mouse Igs, Cy3-conjugated anti-rat Igs (mouse Ig absorbed), Cy5-conjugated anti-rabbit and anti-mouse Igs, Cy5-conjugated anti-mouse Igs (rat Ig absorbed) were all purchased from Jackson Immunochemicals via Milan (La Roche, Switzerland). FITC anti-mouse IgM was from Sigma, FITC anti-chicken IgY was from The Binding Site Ltd (University of Birmingham, UK). Horse radish peroxidase-conjugated anti-rabbit Igs were from Calbiochem (Luzern, Switzerland), horse radish peroxidase-conjugated anti-mouse and anti-rat Igs were from DAKO (Zug, Switzerland).
| Results |
|---|
|
|
|---|
-cardiac actin to
demonstrate that the increase in DRAL/FHL-2 expression levels is not due to
differences in the number of differentiated cardiomyocytes in the extracts
(Fig. 1B, bottom). Whereas
-cardiac actin expression levels remained unchanged, DRAL/FHL-2 was
found to be upregulated during late fetal development. Thus, we confirm
earlier reports that DRAL/FHL-2 is expressed only in significant amounts in
the heart and is absent from skeletal muscle. In addition, DRAL/FHL-2 is
expressed comparatively late during embryonic heart development, at a time
when contracting sarcomeres have already been formed, and is upregulated
significantly during prenatal muscle development.
|
DRAL/FHL-2 localises to specific regions in the cardiac
sarcomere
Initial studies have shown that ectopically expressed DRAL/FHL-2 as well as
endogenous DRAL/FHL-2 is localised in a cross-striated pattern at two distinct
sites in sarcomeres of cultured neonatal rat cardiomyocytes. DRAL/FHL-2 is
found in broad striations at the Z-disc and in fainter striations at the
M-band region (Scholl et al.,
2000
). In order to precisely identify the region near the Z-disc
where DRAL/FHL-2 is bound, double labeling experiments with antibodies
directed against DRAL/FHL-2 together with antibodies directed against
different epitopes of the sarcomeric ruler titin were performed
(Fig. 2). We employed
antibodies against the T12 epitope, which is located at the outer edge of the
Z-disc region of titin, against the I-band epitopes N2B and N2A and against
the 9D10 epitope located in the extensible PEVK region
(Fig. 2A). The signal for
DRAL/FHL-2 was compared with the signals of the different titin epitopes
obtained with myofibrils in different states of contraction
(Fig. 2B). In relaxed
sarcomeres, DRAL/FHL-2 was consistently found as a narrow doublet flanking the
Z-disc and in very faint striations at the M-band
(Fig. 2Bc'). In contrast,
the T12 epitope, which denotes the border of the Z-disc, could not be resolved
into a doublet. This finding suggests that DRAL/FHL-2 is located outside of
the Z-disc. Comparison of the other two titin epitopes with DRAL/FHL-2 showed
that DRAL/FHL-2 colocalised with the N2B epitope independently of the
contraction state, whereas the N2A and PEVK epitopes were always located
further towards the M-band than DRAL/FHL-2
(Fig. 2B). These results
suggest that DRAL/FHL-2 is bound at or very near the N2B region of cardiac
titin.
|
Identification of DRAL/FHL-2 binding partners by yeast two hybrid
assay
The sarcomeric localisation of DRAL/FHL-2 at the Z-disc and at the M-band
cannot be explained by any of its interaction partners that have been
identified so far. For this reason, a yeast two-hybrid screen was carried out
to identify sarcomeric proteins that bind to DRAL/FHL-2 and that may serve to
anchor it to the sarcomere. Full-length DRAL/FHL-2 was used to screen an adult
human cardiac cDNA library. Out of 1x107 primary
transformants, 200 clones were isolated that survived selection and were
positive in a ß-galactosidase assay. Of these, one clone encoded a region
of titin termed is2 (Labeit and Kolmerer,
1995
) and five clones encoded the entire open reading frame of the
muscle isoform of creatine kinase (MM-CK)
(Ordahl et al., 1984
;
Wallimann et al., 1992
). The
interaction between DRAL/FHL-2 and either is2 or MM-CK was reproducible
regardless of whether DRAL/FHL-2 or its interacting partners were fused to the
DNA-binding domain or to the activation domain (data not shown). The is2
region is situated in the M-band region of titin
(Labeit and Kolmerer, 1995
)
and MM-CK, despite being a cytosolic enzyme, is found at distinct sites near
the M-band and near the Z-disc (Wallimann
et al., 1992
). For this reason, is2 and MM-CK represent potential
binding partners for DRAL/FHL-2.
No clones were isolated in our yeast two-hybrid screen that would explain the localisation of DRAL/FHL-2 in the Z-disc region. Since DRAL/FHL-2 colocalises exactly with the N2B titin epitope, we reasoned that it may be bound to this region of titin. The direct interaction of DRAL/FHL-2 and N2B was investigated in a yeast two-hybrid assay. As shown in Fig. 3, the entire N2B region of titin interacts strongly and specifically with DRAL/FHL-2. N2B does not bind the LexA DNA-binding domain alone, and it does not interact with an unrelated bait (Fig. 3). In summary, the yeast two-hybrid assays demonstrate an interaction of DRAL/FHL-2 with the is2 and N2B regions of titin, and with the metabolic enzyme MM-CK. The interaction with two distinct regions of titin may thus serve to anchor DRAL/FHL-2 to the sarcomere.
|
Confirmation of the interactions by colocalisation and pull-down
assays
Next, we sought to confirm the interaction of DRAL/FHL-2 with titin in an
in vivo environment. Primary cultures of neonatal rat cardiomyocytes were
cotransfected with constructs encoding FLAG-tagged DRAL/FHL-2 in combination
with GFP-tagged is2 or GFP-tagged N2B segments of titin. In cotransfected
cardiomyocytes, DRAL/FHL-2 was found in a doublet flanking the Z-disc and in a
faint striation in the M-band (Fig.
4A), colocalising exactly with transfected N2B. An identical
pattern was observed in cells cotransfected with DRAL/FHL-2 and is2: both
proteins were found in a doublet flanking the Z-disc and in a weaker striation
at the M-band (Fig. 4A). The
finding that exogenously expressed N2B was also localised at the M-band,
whereas is2 was also found in a doublet flanking the Z-disc strongly suggests
that these fragments are targeted to the sites by means of their interaction
with DRAL/FHL-2.
|
The direct interaction of DRAL/FHL-2 with the is2 and N2B regions of titin was further confirmed by an in vitro binding assay (Fig. 4B). Recombinant GST-DRAL/FHL-2 was incubated with total lysates from COS-1 cells that had been transfected with eukaryotic expression constructs encoding GFP-tagged is2 or N2B, respectively. As a control, GST alone was incubated in parallel with the same lysates. Both is2 and N2B were found in the GST-DRAL/FHL-2 fraction, whereas they were absent from the GST fraction. This result confirms the observed colocalisation in the transient transfection experiments and suggests that DRAL/FHL-2 is targeted to these sites in the sarcomere by a direct interaction with the N2B and the is2 regions of titin, respectively.
The N2B region of titin contains an N-terminal and a C-terminal block of
two Ig-like domains interrupted by a large stretch of unique sequence
(Fig. 5A)
(Labeit and Kolmerer, 1995
).
In order to determine whether DRAL/FHL-2 binds to the blocks of the Ig-like
domains or to the unique sequence that connects them, we constructed several
deletion mutants of N2B and assayed these for interaction with GST-DRAL/FHL-2
in pull-down assays (Fig. 5B).
GFP-N2B
1, which lacks the two C-terminal Ig-like domains, was still
capable of interacting with DRAL/FHL-2. Additional deletion of the C-terminal
half of the unique sequence in GFP-N2B
2 did not affect its binding to
DRAL/FHL-2, either. However, deletion of another 270 amino acids from the
central part of the unique sequence in GFP-N2B
4 completely abolished
the interaction of DRAL/FHL-2 and N2B. Likewise, GFP-N2B
3, which
contains the C-terminal end of the unique sequence followed by the two
C-terminal Ig-like domains, did not retain any affinity for DRAL/FHL-2. These
results suggest that the interaction with DRAL/FHL-2 is mediated by a binding
site located within the central 270 amino acids of the N2B region. To
investigate this putative binding site more closely, we created an additional
construct, GFP-N2B
5, which comprises just this sequence. This minimal
binding domain shows targeting that is indistinguishable from the full-length
titin N2B segment (Fig. 5C).
Additional proof for an interaction between DRAL/FHL-2 and this region in
titin N2B was provided by assaying COS cells that were transiently transfected
with DRAL/FHL-2-FLAG and GFP-N2B
5. Following immunoprecipitation with
an anti-FLAG antibody, GFP-N2B
5 could be visualised on a immunoblot
with anti-GFP antibodies, confirming the stabile interaction of these protein
domains in vivo (Fig. 5D).
In summary, the colocalisation and pull-down experiments confirm the interaction between DRAL/FHL-2 and two distinct regions in the giant protein titin and strongly suggest that DRAL/FHL-2 is targeted to two sarcomeric sites in cardiomyocytes by virtue of those interactions. Furthermore, the DRAL/FHL-2-binding site on N2B is located in the central 270 amino acids of the unique insertion connecting the Ig-like domains.
Interaction of DRAL/FHL-2 with the enzymes creatine kinase, adenylate
kinase and phosphofructokinase
The metabolic enzyme MM-CK (EC 2.7.3.2) was isolated five times in our
yeast two-hybrid screen. MM-CK is a predominantly cytosolic enzyme, but a
minor fraction is located at two distinct sites in the sarcomere near the
M-band and flanking the Z-disc
(Schäfer and Perriard,
1988
; Wallimann et al.,
1992
; Wegmann et al.,
1992
). In order to investigate whether exogenous DRAL/FHL-2 and
MM-CK colocalise in the sarcomere, we cotransfected primary cultures of rat
cardiomyocytes with constructs encoding FLAG-tagged DRAL/FHL-2 and GFP-tagged
MM-CK. Both DRAL/FHL-2 and MM-CK were found in a doublet pattern flanking the
Z-disc and in a single striation at the M-band
(Fig. 6A). However, while there
was less DRAL/FHL-2 bound to the M-band than to the Z-disc region, the signals
for MM-CK flanking the Z-disc and the M-band appeared equally intense (compare
insets in Fig. 6Aa and
a'), indicating that MM-CK may target to the M-band by
interaction with other proteins apart from DRAL/FHL-2
(Hornemann et al., 2000
).
|
Two other metabolic enzymes, adenylate kinase (EC 2.7.4.3) and
phosphofructokinase (EC 2.7.1.11), are also found in the M-band and, depending
on the buffer conditions used for fixation, in the I-band as well
(Dolken et al., 1975
;
Kraft et al., 2000
). We
therefore asked whether those proteins may achieve their localisation in the
sarcomere via an interaction with DRAL/FHL-2, too. First, we compared the
sarcomeric localisation of FLAG-tagged DRAL/FHL-2 and either adenylate kinase
or phosphofructokinase tagged with GFP by cotransfection into rat
cardiomyocytes (Fig. 6A).
Adenylate kinase and phosphofructokinase were found in a doublet flanking the
Z-disc and in a single striation at the M-band
(Fig. 6A). Superimpositions
showed that both proteins colocalised exactly with DRAL/FHL-2. Thus, MM-CK,
adenylate kinase and phosphofructokinase are all located at the same
sarcomeric sites flanking the Z-disc and the M-band together with
DRAL/FHL-2.
To investigate wether the colocalisation of the three metabolic enzymes is
due to their direct interaction with DRAL/FHL-2, we performed in vitro
pull-down assays. GST-DRAL/FHL-2 was incubated with lysates of COS-1 cells
expressing MM-CK, adenylate kinase or phosphofructokinase. As a control for
non-specific binding, GST alone was used. As shown in
Fig. 6B, all three enzymes
interacted with GST-DRAL/FHL-2 but not with GST alone. A recently identified
muscle protein, Smpx/Csl (Kemp et al.,
2001
; Palmer et al.,
2001
), which shows a localisation pattern similar to that of
DRAL/FHL-2 (Fig. 6A), was also
evaluated for its interaction with DRAL/FHL-2. Smpx/Csl interacted neither
with DRAL/FHL-2-GST nor with GST alone, confirming the specificity of the
pull-down assay. These results strongly suggest that in cardiomyocytes the
three metabolic enzymes MM-CK, adenylate kinase and phosphofructokinase are
bound to two distinct sarcomeric sites near the Z-disc and the M-band by their
interaction with DRAL/FHL-2. In contrast to the interactions between
DRAL/FHL-2 and titin, attempts to co-immunoprecipitate the metabolic enzymes
with DRAL/FHL-2 were not successful (data not shown). The failure to detect
the interaction of DRAL/FHL2 and the metabolic enzymes may indicate that their
association is transient in nature and may serve as a means for dynamic
compartmentalisation of these enzymes, rather than a strict immobilisation to
the sarcomere.
DRAL/FHL-2 interacts with FHL-1 but not with the LIM domain protein
MLP
Recently, it has been shown that DRAL/FHL-2 and FHL-3 associate to form
heterodimers (Li et al.,
2001b
). We wanted to investigate whether DRAL/FHL-2 also forms
dimers with the other four and a half LIM-only family members. We focused on
FHL-1, since it is the only other family member apart from DRAL/FHL-2 that is
also expressed in the heart (Fimia et al.,
2000
). First, we cotransfected rat cardiomyocytes with constructs
encoding GFP-tagged DRAL/FHL-2 and FLAG-tagged FHL-1 to compare the
localisation of the two proteins. DRAL/FHL-2 and FHL-1 colocalised exactly in
two striations flanking the Z-disc and in a single striation in the M-band
(data not shown). Next, we tested whether the colocalisation of DRAL/FHL-2 and
FHL-1 in the sarcomere is due to a direct interaction using a pull-down assay.
As shown in Fig. 7, FHL-1 bound
to GST-DRAL/FHL-2 but not to GST alone. The interaction was abolished by the
addition of 10 mM EDTA to the incubation buffer. EDTA complexes and removes
the two Zn2+ ions that are bound to histidine and cysteine residues
of a zinc finger, thereby unfolding it. Thus, the proper conformation of the
LIM domain is needed for the interaction of DRAL/FHL-2 with FHL-1.
|
To exclude non-specific interactions between LIM domains, we also tested an
unrelated LIM protein, MLP, for binding to DRAL/FHL-2. MLP is expressed in the
heart but shows a different subcellular localisation than DRAL/FHL-2
(Arber et al., 1997
), making a
direct interaction of the two proteins extremely unlikely. For this reason,
MLP serves as a good control to assess non-specific interactions between LIM
domains. As expected, MLP interacted neither with GST-DRAL/FHL-2 nor with GST
alone (Fig. 7). The fact that
DRAL/FHL-2 does not bind to MLP in our pull-down assays suggests that no
non-specific interaction between LIM domains occurs under our assay
conditions. Furthermore, the loss of interaction between DRAL/FHL-2 and FHL-1
in the presence of EDTA shows that the binding between the two proteins is
dependent on the proper folding of the LIM domains and is not mediated by the
non-specific sticking of LIM domains to each other.
| Discussion |
|---|
|
|
|---|
-actinin
(Young et al., 1998
-actinin. LIM domains have been suggested to act as
protein-protein interaction domains and to mediate structural links
(Schmeichel and Beckerle,
1994
|
DRAL/FHL-2 localises to the N2B region of titin, which is present only in
cardiac-specific isoforms of titin (Gautel
et al., 1996
), with DRAL/FHL-2 being at the same time
predominantly expressed in cardiac muscle. The importance of the N2B region
for cardiomyocyte structure was demonstrated by the observation that
overexpression of N2B fragments in cardiomyocytes can lead to a disruption of
thin filaments and it has been suggested that the N2B region might be
important for the binding of several sarcomeric components
(Linke et al., 1999
). In our
transfection assays no deleterious effects of expression of N2B could be
observed; however, we analysed the cardiomyocytes already 1-2 days after
transfection, when the disruption of thin filament structures is probably not
yet visible and the cross-striated pattern of ectopically expressed N2B in
I-band and M-band can still be detected. A possible explanation of why
ectopically expressed N2B fragments target to the I-band in transiently
transfected NRC could be that DRAL/FHL-2 exerts its function as a homodimer,
which has been strongly suggested by in vitro observations
(Wixler et al., 2000
). In
contrast to the PEVK region, which is situated further towards the C-terminus
of titin, no direct binding of N2B to actin could be found
(Gutierrez-Cruz et al., 2001
;
Kulke et al., 2001
;
Yamasaki et al., 2001
).
DRAL/FHL-2 interaction with metabolic enzymes in the heart
Targeting of metabolic enzymes to the I-band has been shown previously
(Arnold and Pette, 1970
;
Dolken et al., 1975
;
Wegmann et al., 1992
;
Kraft et al., 2000
) and is
thought to be necessary for energy provision during contraction
(Wallimann and Eppenberger,
1985
). The I-band association seems to be dependent on the buffer
conditions used for the sample preparation, since it is primarily observed if
bivalent cation chelators such as EDTA are omitted
(Wegmann et al., 1992
). Since
our experiments indicated that the presence of EDTA abolished the in vitro
interaction between DRAL/FHL-2 and FHL-1, it seems very likely that the
association of metabolic enzymes is also dependent on a conserved conformation
of LIM domains in DRAL/FHL-2. DRAL/FHL-2 expression is upregulated in the
heart only rather late during embryonic development. This is similar to
results obtained for MM-CK expression levels in developing muscle and might
explain the delay in sarcomeric compartmentalisation of this enzyme that is
observed during development (Carlsson et
al., 1982
; Carlsson et al.,
1990
; Ventura-Clapier et al.,
1998
). Animals that are homozygous null for DRAL/FHL-2 seem normal
and display no obvious abnormalities in myofibrils
(Chu et al., 2000b
). However,
they seem to be more sensitive to stress situations such as ß-adrenergic
stimulation (Kong et al.,
2001
), which might suggest an impaired ability to cope with
abnormal requirements on the cardiac energy metabolism.
DRAL/FHL-2 interactions with non-sarcomeric proteins
Previous investigations in non-cardiac cells have identified hCDC47,
presenilin-2, the androgen receptor and several
- and ß-integrins
as potential interaction partners of DRAL/FHL-2
(Chan et al., 2000
;
Tanahashi and Tabira, 2000
;
Müller et al., 2000
;
Wixler et al., 2000
); however,
the biological significance of these interactions in the heart is still
unclear. It has been suggested that the androgen receptor might be involved in
the development of hypertrophy in the heart
(Marsh et al., 1998
) and a
decrease in DRAL/FHL-2 expression seems to occur in patients with dilated
cardiomyopathy (Müller et al.,
2000
), again underlining the importance of LIM-domain-containing
proteins for the maintenance of cardiac function
(Arber et al., 1997
;
Pashmforoush et al., 2001
).
Despite the reported binding of DRAL/FHL-2 to integrins we were unable to see
the typical costameric localisation pattern as expected for an
integrin-associated protein in cardiomyocytes. Several other
LIM-domain-containing proteins target to focal adhesions, such as paxillin
(Brown et al., 1996
) and zyxin
(Sadler et al., 1992
), or bind
to integrin in vitro, such as N-RAP (Luo
et al., 1999
). DRAL/FHL-2 is indeed localised at focal adhesions
in non-muscle cells (Scholl et al.,
2000
) and also in not yet differentiated muscle cells
(Li et al., 2001b
). However,
as soon as myofibrils are formed, the preferential association of DRAL/FHL-2
seems to occur in the region of the I-band
[(Li et al., 2001b
) and this
study] and no costameric association can be observed any longer. This might
suggest that in cardiomyocytes the binding affinity of DRAL/FHL-2 for titin is
so strong that it competes completely for the interaction with other potential
binding partners. The localisation pattern of DRAL/FHL-2 or other
LIM-domain-containing proteins could therefore be dependent on the molecular
expression profile in different cell types.
In summary, subcellular localisation experiments and in vitro binding assays suggest that the localisation of DRAL/FHL-2 at two defined sites in the cardiac sarcomere is mediated by its interaction with the N2B and is2 regions of titin. In turn, DRAL/FHL-2 binds to the metabolic enzymes MM-CK, adenylate kinase and phosphofructokinase, thus serving as an adaptor to couple them to the N2B and is2 regions in titin. The results presented here point towards a crucial role for DRAL/FHL-2 in the compartmentalisation of metabolic enzymes in the heart. The participation of DRAL/FHL-2 in signalling and response to extracellular stimuli such as growth factors and mechanical stress remains to be established.
| Acknowledgments |
|---|
| Footnotes |
|---|
These authors contributed equally to this work | References |
|---|
|
|
|---|
Amaar, Y. G., Thompson, G. R., Linkhart, T. A., Chen, S.-T.,
Baylink, D. J. and Mohan, S. (2002). Insulin-like growth
factor-binding protein 5 (IGFBP-5) interacts with a four and a half LIM
protein 2 (FHL2). J. Biol. Chem.
277,12053
-12060.
Arber, S., Halder, G. and Caroni, P. (1994). Muscle LIM protein, a novel essential regulator of myogenesis, promotes myogenic differentiation. Cell 79,221 -231.[CrossRef][Medline]
Arber, S., Hunter, J. J., Ross, J. J., Hongo, M., Sansig, G., Borg, J., Perriard, J.-C., Chien, K. R. and Caroni, P. (1997). MLP-deficient mice exhibit a disruption of cardiac cytoarchitectural organization, dilated cardiomyopathy, and heart failure. Cell 88,393 -403.[CrossRef][Medline]
Arnold, H. and Pette, D. (1970). Binding of aldolase and triosephosphate dehydrogenase to F-actin and modification of catalytic properties of aldolase. Eur. J. Biochem. 15,360 -366.[Medline]
Auerbach, D., Bantle, S., Keller, S., Hinderling, V., Leu, M.,
Ehler, E. and Perriard, J. C. (1999). Different domains of
the M-band protein myomesin are involved in myosin binding and M-band
targeting. Mol. Biol. Cell
10,1297
-1308.
Bach, I. (2000). The LIM domain: regulation by association. Mech. Dev. 91, 5-17.[CrossRef][Medline]
Brown, M. C., Perrotta, J. A. and Turner, C. E.
(1996). Identification of LIM3 as the principal determinant of
paxillin focal adhesion localization and characterization of a novel motif on
paxillin directing vinculin and focal adhesion kinase binding. J.
Cell Biol. 135,1109
-1123.
Carlsson, E., Kjorell, U., Thornell, L. E., Lambertsson, A. and Strehler, E. (1982). Differentiation of the myofibrils and the intermediate filament system during postnatal development of the rat heart. Eur. J. Cell Biol. 27, 62-73.[Medline]
Carlsson, E., Grove, B. K., Wallimann, T., Eppenberger, H. M. and Thornell, L. E. (1990). Myofibrillar M-band proteins in rat skeletal muscles during development. Histochemistry 95,27 -35.[CrossRef][Medline]
Centner, T., Yano, J., Kimura, E., McElhinny, A. S., Pelin, K., Witt, C. C., Bang, M. L., Trombitas, K., Granzier, H., Gregorio, C. C. et al. (2001). Identification of muscle specific ring finger proteins as potential regulators of the titin kinase domain. J. Mol Biol. 306,717 -726.[CrossRef][Medline]
Chan, K. K., Tsui, S. K., Lee, S. M., Luk, S. C., Liew, C. C., Fung, K. P., Waye, M. M. and Lee, C. Y. (1998). Molecular cloning and characterization of FHL2, a novel LIM domain protein preferentially expressed in human heart. Gene 210,345 -350.[CrossRef][Medline]
Chan, K. K., Tsui, S. K., Ngai, S. M., Lee, S. M., Kotaka, M., Waye, M. M., Lee, C. Y. and Fung, K. P. (2000). Protein-protein interaction of FHL2, a LIM domain protein preferentially expressed in human heart, with hCDC47. J. Cell Biochem. 76,499 -508.[CrossRef][Medline]
Chien, K. R. (1999). Stress pathways and heart failure. Cell 98,555 -558.[CrossRef][Medline]
Chien, K. R. (2000). Genomic circuits and the integrative biology of cardiac diseases. Nature 407,227 -232.[CrossRef][Medline]
Chu, P. H., Ruiz-Lozano, P., Zhou, Q., Cai, C. and Chen, J. (2000a). Expression patterns of FHL/SLIM family members suggest important functional roles in skeletal muscle and cardiovascular system. Mech. Dev. 95,259 -265.[CrossRef][Medline]
Chu, P. H., Bardwell, W. M., Gu, Y., Ross, J., Jr and Chen,
J. (2000b). FHL2 (SLIM3) is not essential for cardiac
development and function. Mol. Cell Biol.
20,7460
-7462.
Dawid, I. B., Breen, J. J. and Toyama, R. (1998). LIM domains: multiple roles as adapters and functional modifiers in protein interactions. Trends Genet 14,156 -162.[CrossRef][Medline]
Dolken, G., Leisner, E. and Pette, D. (1975). Immunofluorescent localization of glycogenolytic and glycolytic enzyme proteins and of malate dehydrogenase isozymes in cross-striated skeletal muscle and heart of the rabbit. Histochemistry 43,113 -121.[CrossRef][Medline]
Ehler, E., Rothen, B. M., Hämmerle, S. P., Komiyama, M. and Perriard, J.-C. (1999). Myofibrillogenesis in the developing chicken heart: assembly of Z-disk, M-line and the thick filaments. J. Cell Sci. 112,1529 -1539.[Abstract]
Ehler, E., Horowits, R., Zuppinger, C., Price, R. L., Perriard,
E., Leu, M., Caroni, P., Sussman, M., Eppenberger, H. M. and Perriard, J.
C. (2001). Alterations at the intercalated disk associated
with the absence of muscle LIM protein. J. Cell Biol.
153,763
-772.
Estojak, J., Brent, R. and Golemis, E. A. (1995). Correlation of two-hybrid affinity data with in vitro measurements. Mol. Cell Biol. 15,5820 -5829.[Abstract]
Faulkner, G., Lanfranchi, G. and Valle, G. (2001). Telethonin and other new proteins of the Z-disc of skeletal muscle. IUBMB Life 51,275 -282.[Medline]
Fentzke, R. C., Korcarz, C. E., Lang, R. M., Lin, H. and Leiden, J. M. (1998). Dilated cardiomyopathy in transgenic mice expressing a dominant-negative CREB transcription factor in the heart. J. Clin. Invest. 101,2415 -2426.[Medline]
Fimia, G. M., de Cesare, D. and Sassone-Corsi, P. (1999). CBP-independent activation of CREM and CREB by the LIM-only protein ACT. Nature 398,165 -169.[CrossRef][Medline]
Fimia, G. M., de Cesare, D. and Sassone-Corsi, P.
(2000). A family of LIM-only transcriptional coactivators:
tissue-specific expression and selective activation of CREB and CREM.
Mol. Cell. Biol. 20,8613
-8622.
Flick, M. and Konieczny, S. (2000). The muscle regulatory and structural protein MLP is a cytoskeletal binding partner of ßI-spectrin. J. Cell Sci. 113,1553 -1564.[Abstract]
Fougerousse, F., Anderson, L. V. B., Delezoide, A.-L., Suel, L., Durand, M. and Beckmann, J. S. (2000). Calpain3 expression during human cardiogenesis. Neuromuscul. Disord. 10,251 -256.[CrossRef][Medline]
Freiburg, A. and Gautel, M. (1996). A molecular map of the interactions between titin and myosin-binding protein C. Implications for sarcomeric assembly in familial hypertrophic cardiomyopathy. Eur. J. Biochem. 235,317 -323.[Medline]
Fürst, D. O. and Gautel, M. (1995). The anatomy of a molecular giant: how the sarcomere cytoskeleton is assembled from immunoglobulin superfamily molecules. J. Mol. Cell Cardiol. 27,951 -959.[CrossRef][Medline]
Fürst, D. O., Osborn, M., Nave, R. and Weber, K.
(1988). The organization of titin filaments in the half-sarcomere
revealed by monoclonal antibodies in immunoelectron microscopy: a map of ten
nonrepetitive epitopes starting at the Z line extends close to the M line.
J. Cell Biol. 106,1563
-1572.
Fürst, D. O., Vinkemeier, U. and Weber, K.
(1992). Mammalian skeletal muscle C-protein: purification from
bovine muscle, binding to titin and the characterization of a full-length
human cDNA. J. Cell Sci.
102,769
-778.
Gautel, M., Lehtonen, E. and Pietruschka, F. (1996). Assembly of the cardiac I-band region of titin/connectin: expression of the cardiac-specific regions and their structural relation to the elastic segments. J. Muscle. Res. Cell Motil. 17,449 -461.[CrossRef][Medline]
Genini, M., Schwalbe, P., Scholl, F. A., Remppis, A., Mattei, M. G. and Schäfer, B. W. (1997). Subtractive cloning and characterization of DRAL, a novel LIM-domain protein down-regulated in rhabdomyosarcoma. DNA Cell Biol. 16,433 -442.[Medline]
Gluzman, Y. (1981). SV40-transformed simian cells support the replication of early SV40 mutants. Cell 23,175 -182.[CrossRef][Medline]
Goldspink, P. H. and Russell, B. (1996). Physiological role of phosphorylation of the cyclic AMP response element binding protein in rat cardiac nuclei. Cell Tissue Res. 285,379 -385.[CrossRef][Medline]
Gregorio, C. C., Trombitas, K., Centner, T., Kolmerer, B.,
Stier, G., Kunke, K., Suzuki, K., Obermayr, F., Herrmann, B., Granzier, H. et
al. (1998). The NH2 terminus of titin spans the Z-disc: its
interaction with a novel 19-kD ligand (T-cap) is required for sarcomeric
integrity. J. Cell Biol.
143,1013
-1027.
Gutierrez-Cruz, G., van Heerden, A. H. and Wang, K.
(2001). Modular motif, structural folds and affinity profiles of
the PEVK segment of human fetal skeletal muscle titin. J. Biol.
Chem. 276,7442
-7449.
Gyuris, J., Golemis, E., Chertkov, H. and Brent, R. (1993). Cdi1, a human G1 and S phase protein phosphatase that associates with Cdk2. Cell 75,791 -803.[CrossRef][Medline]
Hobert, O. and Westphal, H. (2000). Functions of LIM-homeobox genes. Trends Genet. 16, 75-83.[CrossRef][Medline]
Hornemann, T., Stolz, M. and Wallimann, T.
(2000). Isoenzyme-specific interaction of muscle-type creatine
kinase with the sarcomeric M-line is mediated by NH(2)-terminal lysine
charge-clamps. J. Cell Biol.
149,1225
-1234.
Houmeida, A., Holt, J., Tskhovrebova, L. and Trinick, J.
(1995). Studies of the interaction between titin and myosin.
J. Cell Biol. 131,1471
-1481.
Kemp, T. J., Sadusky, T. J., Simon, M., Brown, R., Eastwood, M., Sassoon, D. A. and Coulton, G. R. (2001). Identification of a novel stretch-responsive skeletal muscle gene (Smpx). Genomics 72,260 -271.[CrossRef][Medline]
Kinbara, K., Sorimachi, H., Ishiura, S. and Suzuki, K. (1997). Muscle-specific calpain, p94, interacts with the extreme C-terminal region of connectin, a unique region flanked by two immunoglobulin C2 motifs. Arch. Biochem. Biophys. 342,99 -107.[CrossRef][Medline]
Kong, Y., Shelton, J. M., Rothermel, B., Li, X., Richardson, J.
A., Bassel-Duby, R. and Williams, R. S. (2001).
Cardiac-specific LIM protein FHL2 modifies the hypertrophic response to
beta-adrenergic stimulation. Circulation
103,2731
-2738.
Kraft, T., Hornemann, T., Stolz, M., Nier, V. and Wallimann, T. (2000). Coupling of creatine kinase to glycolytic enzymes at the sarcomeric I- band of skeletal muscle: a biochemical study in situ. J. Muscle Res. Cell Motil. 21,691 -703.[CrossRef][Medline]
Kulke, M., Fujita-Becker, S., Rostkova, E., Neagoe, C., Labeit,
D., Manstein, D. J., Gautel, M. and Linke, W. A. (2001).
Interaction between PEVK-titin and actin filaments: origin of a viscous force
component in cardiac myofibrils. Circ. Res.
89,874
-881.
Labeit, S. and Kolmerer, B. (1995). Titins:
Giant proteins in charge of muscle ultrastructure and elasticity.
Science 270,293
-296.
Li, H. Y., Ng, E. K., Lee, S. M., Kotaka, M., Tsui, S. K., Lee, C. Y., Fung, K. P. and Waye, M. M. (2001a). Protein-protein interaction of FHL3 with FHL2 and visualization of their interaction by green fluorescent proteins (GFP) two-fusion fluorescence resonance energy transfer (FRET). J. Cell Biochem. 80,293 -303.[CrossRef][Medline]
Li, H. Y., Kotaka, M., Kostin, S., Lee, S. M., Kok, L. D., Chan, K. K., Tsui, S. K., Schaper, J., Zimmermann, R., Lee, C. Y., Fung, K. P. and Waye, M. M. (2001b). Translocation of a human focal adhesion LIM-only protein, FHL2, during myofibrillogenesis and identification of LIM2 as the principal determinants of FHL2 focal adhesion localization. Cell Motil Cytoskeleton 48, 11-23.[CrossRef][Medline]
Linke, W. A., Rudy, D. E., Centner, T., Gautel, M., Witt, C.,
Labeit, S. and Gregorio, C. C. (1999). I-band titin in
cardiac muscle is a three-element molecular spring and is critical for
maintaining thin filament structure. J. Cell Biol.
146,631
-644.
Lumsden, A. (1995). Neural development. A `LIM code' for motor neurons? Curr. Biol. 5, 491-495.[CrossRef][Medline]
Luo, G., Zhang, J., Nguyen, T.-P., Herrera, A., Paterson, B. and Horowits, R. (1997). Complete cDNA sequence and tissue localization of N-RAP, a novel nebulin-related protein of striated muscle. Cell Motil. Cytoskeleton 38, 75-90.[CrossRef][Medline]
Luo, G., Herrera, A. H. and Horowits, R. (1999). Molecular interactions of N-RAP, a nebulin-related protein of striated muscle myotendon junctions and intercalated disks. Biochemistry 38,6135 -6143.[CrossRef][Medline]
Marsh, J. D., Lehmann, M. H., Ritchie, R. H., Gwathmey, J. K.,
Green, G. E. and Schiebinger, R. J. (1998). Androgen
receptors mediate hypertrophy in cardiac myocytes.
Circulation 98,256
-261.
Messerli, J. M., van der Voort, H. T. M., Rungger-Brändle, E. and Perriard, J.-C. (1993). Three-dimensional visualization of multi-channel volume data: the: the amSFP algorithm. Cytometry 14,725 -735.[CrossRef][Medline]
Morgan, M. J. and Madgwick, A. J. (1996). Slim defines a novel family of LIM-proteins expressed in skeletal muscle. Biochem. Biophys. Res. Commun. 225,632 -638.[CrossRef][Medline]
Morgan, M. J. and Madgwick, A. J. (1999a). The fourth member of the FHL family of LIM proteins is expressed exclusively in the testis. Biochem. Biophys. Res. Commun. 255,251 -255.[CrossRef][Medline]
Morgan, M. J. and Madgwick, A. J. (1999b). The LIM proteins FHL1 and FHL3 are expressed differently in skeletal muscle. Biochem. Biophys. Res. Commun. 255,245 -250.[CrossRef][Medline]
Mues, A., van der Ven, P. F., Young, P., Fürst, D. O. and Gautel, M. (1998). Two immunoglobulin-like domains of the Z-disc portion of titin interact in a conformation-dependent way with telethonin. FEBS Lett. 428,111 -114.[CrossRef][Medline]
Müller, J. M., Isele, U., Metzger, E., Rempel, A., Moser, M., Pscherer, A., Breyer, T., Holubarsch, C., Buettner, R. and Schule, R. (2000). FHL2, a novel tissue-specific coactivator of the androgen receptor. EMBO J. 19,359 -369.[CrossRef][Medline]
Nave, R., Fürst, D. O. and Weber, K.
(1989). Visualization of the polarity of isolated titin
molecules: a single globular head on a long thin rod as the M band anchoring
domain? J. Cell Biol.
109,2177
-2187.
Ng, E. K. O., Chan, K. K., Wong, C. H., Tsui, S. K. W., Ngai, S. M., Lee, S. M. Y., Kotaka, M., Lee, C. Y., Waye, M. M. Y. and Fung, K. P. (2002). Interaction of the heart-specific LIM domain protein FHL2 with DNA-binding nuclear protein hNP220. J. Cell Biochem. 84,556 -566.[CrossRef][Medline]
Obermann, W. M., Plessmann, U., Weber, K. and Fürst, D. O. (1995). Purification and biochemical characterization of myomesin, a myosin-binding and titin-binding protein, from bovine skeletal muscle. Eur. J. Biochem. 233,110 -115.[Medline]
Obermann, W. M., Gautel, M., Steiner, F., van der Ven, P. F.,
Weber, K. and Fürst, D. O. (1996). The structure of the
sarcomeric M band: localization of defined domains of myomesin, M-protein, and
the 250-kD carboxy-terminal region of titin by immunoelectron microscopy.
J. Cell Biol. 134,1441
-1453.
Ordahl, C. P., Evans, G. L., Cooper, T. A., Kunz, G. and
Perriard, J. C. (1984). Complete cDNA-derived amino acid
sequence of chick muscle creatine kinase. J. Biol.
Chem. 259,15224
-15227.
Palmer, S., Groves, N., Schindeler, A., Yeoh, T., Biben, C.,
Wang, C. C., Sparrow, D. B., Barnett, L., Jenkins, N. A., Copeland, N. G. et
al. (2001). The small muscle-specific protein Csl modifies
cell shape and promotes myocyte fusion in an insulin-like growth factor
1-dependent manner. J. Cell Biol.
153,985
-998.
Pashmforoush, M., Pomies, P., Peterson, K. L., Kubalak, S., Ross, J., Jr, Hefti, A., Aebi, U., Beckerle, M. C. and Chien, K. R. (2001). Adult mice deficient in actinin-associated LIM-domain protein reveal a developmental pathway for right ventricular cardiomyopathy. Nat. Med. 7,591 -597.[CrossRef][Medline]
Pomies, P., Macalma, T. and Beckerle, M. C.
(1999). Purification and characterization of an
alpha-actinin-binding PDZ-LIM protein that is up-regulated during muscle
differentiation. J. Biol. Chem.
274,29242
-29250.
Sadler, I., Crawford, A. W., Michelsen, J. W. and Beckerle, M.
C. (1992). Zyxin and cCRP: two interactive LIM domain
proteins associated with the cytoskeleton. J. Cell
Biol. 119,1573
-1587.
Schäfer, B. W. and Perriard, J.-C. (1988).
Intracellular targeting of isoproteins in muscle cytoarchitecture.
J. Cell Biol. 106,1161
-1179.
Schmeichel, K. L. and Beckerle, M. C. (1994). The LIM domain is a modular protein-binding interface. Cell 79,211 -219.[CrossRef][Medline]
Scholl, F. A., McLoughlin, P., Ehler, E., de Giovanni, C. and
Schäfer, B. W. (2000). DRAL is a p53-responsive gene
whose four and a half LIM domain protein product induces apoptosis.
J. Cell Biol. 151,495
-506.
Squire, J. M. (1997). Architecture and function in the muscle sarcomere. Curr. Opin. Struct. Biol. 7, 247-257.[CrossRef][Medline]
Stenmark, H., Vitale, G., Ullrich, O. and Zerial, M. (1995). Rabaptin-5 is a direct effector of the small GTPase Rab5 in endocytic membrane fusion. Cell 83,423 -432.[CrossRef][Medline]
Tanahashi, H. and Tabira, T. (2000).
Alzheimer's disease-associated presenilin 2 interacts with DRAL, an LIM-
domain protein. Hum. Mol. Genet.
9,2281
-2289.
Trinick, J. and Tskhovrebova, L. (1999). Titin: a molecular control freak. Trends Cell Biol 9, 377-380.[CrossRef][Medline]
Ventura-Clapier, R., Kuznetsov, A., Veksler, V., Boehm, E. and Anflous, K. (1998). Functional coupling of creatine kinases in muscles: species and tissue specificity. Mol. Cell Biochem. 184,231 -247.[CrossRef][Medline]
Vojtek, A. B., Hollenberg, S. M. and Cooper, J. A. (1993). Mammalian Ras interacts directly with the serine/threonine kinase Raf. Cell 74,205 -214.[CrossRef][Medline]
Wallimann, T. and Eppenberger, H. M. (1985). Localization and function of M-line-bound creatine kinase. M-band model and creatine phosphate shuttle. Cell Muscle Motil. 6, 239-285.[Medline]
Wallimann, T., Wyss, M., Bradiczka, D., Nicolay, K. and Eppenberger, H. M. (1992). Intracellular compartmentation, structure and function of creatine kinase isoenzymes in tissues with high and fluctuating energy demands: the `phosphocreatine circuit' for cellular energy homeostasis. Biochem. J. 281, 21-40.
Wegmann, G., Zanolla, E., Eppenberger, H. M. and Wallimann, T. (1992). In situ compartmentation of creatine kinase in intact sarcomeric muscle: the acto-myosin overlap zone as a molecular sieve. J. Muscle Res. Cell Motil. 13,420 -435.[CrossRef][Medline]
Wixler, V., Geerts, D., Laplantine, E., Westhoff, D., Smyth, N.,
Aumailley, M., Sonnenberg, A. and Paulsson, M. (2000). The
LIM-only protein DRAL/FHL2 binds to the cytoplasmic domain of several alpha
and beta integrin chains and is recruited to adhesion complexes. J.
Biol. Chem. 275,33669
-33678.
Yamasaki, R., Berri, M., Wu, Y., Trombitas, K., McNabb, M., Kellermayer, M. S., Witt, C., Labeit, D., Labeit, S., Greaser, M. and Granzier, H. (2001). Titin-actin interaction in mouse myocardium: passive tension modulation and its regulation by calcium/s100a1. Biophys. J. 81,2297 -2313.[Medline]
Young, P., Ferguson, C., Banuelos, S. and Gautel, M. (1998). Molecular structure of the sarcomeric Z-disk: two types of titin interactions lead to an asymmetrical sorting of a-actinin. EMBO J. 17,1614 -1624.[CrossRef][Medline]
Young, P., Ehler, E. and Gautel, M. (2001).
Obscurin, a giant sarcomeric Rho guanine nucleotide exchange factor protein
involved in sarcomere assembly. J. Cell Biol.
154,123
-136.
Zhou, Q., Ruiz-Lozano, P., Martone, M. E. and Chen, J.
(1999). Cypher, a striated muscle-restricted PDZ and LIM
domain-containing protein, binds to alpha-actinin-2 and protein kinase C.
J. Biol. Chem. 274,19807
-19813.
Zhou, Q., Chu, P. H., Huang, C., Cheng, C. F., Martone, M. E.,
Knoll, G., Shelton, G. D., Evans, S. and Chen, J. (2001).
Ablation of Cypher, a PDZ-LIM domain Z-line protein, causes a severe form of
congenital myopathy. J. Cell Biol.
155,605
-612.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
Related articles in JCS:
This article has been cited by other articles:
![]() |
K. M. Brauch, N. D. Dhruv, E. A. Hanse, and M. T. Andrews Digital transcriptome analysis indicates adaptive mechanisms in the heart of a hibernating mammal Physiol Genomics, October 17, 2005; 23(2): 227 - 234. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Teran-Garcia, T. Rankinen, R. A. Koza, D. C. Rao, and C. Bouchard Endurance training-induced changes in insulin sensitivity and gene expression Am J Physiol Endocrinol Metab, June 1, 2005; 288(6): E1168 - E1178. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. E. Knoll, J. L. Pietrusz, and M. Liang Tissue-specific transcriptome responses in rats with early streptozotocin-induced diabetes Physiol Genomics, April 14, 2005; 21(2): 222 - 229. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||