spacer gif spacer gif spacer gif spacer gif Propose a workshop for 2011 spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

doi: 10.1242/10.1242/jcs.00189


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Related articles in JCS
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jensen, S.
Right arrow Articles by Johnston, L. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jensen, S.
Right arrow Articles by Johnston, L. H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Journal of Cell Science 115, 4977-4991 (2002)
Copyright © 2002 The Company of Biologists Limited
doi: 10.1242/jcs.00189


Research Article

Spatial regulation of the guanine nucleotide exchange factor Lte1 in Saccharomyces cerevisiae

Sanne Jensen1, Marco Geymonat1, Anthony L. Johnson1, Marisa Segal2 and Leland H. Johnston1,*

1 Division of Yeast Genetics, National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA, UK
2 Department of Genetics, University of Cambridge, Downing Street, Cambridge CB2 3EH, UK

* Author for correspondence (e-mail: ljohnst{at}nimr.mrc.ac.uk)

Accepted 22 September 2002


    Summary
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In budding yeast, activation of the small Ras-like GTPase Tem1 triggers exit from mitosis and cytokinesis. Tem1 is regulated by Bub2/Bfa1, a two-component GTPase-activating protein (GAP), and by Lte1, a putative guanine nucleotide exchange factor. Lte1 is confined to the bud cortex, and its spatial separation from Tem1 at the spindle pole body (SPB) is important to prevent untimely exit from mitosis. The pathways contributing to Lte1 asymmetry have not been elucidated. Here we show that establishment of Lte1 at the cortex occurs by an actin-independent mechanism, which requires activation of Cdc28/Cln kinase at START and Cdc42, a key regulator of cell polarity and cytoskeletal organisation. This defines a novel role for Cdc42 in late mitotic events. In turn, dissociation of Lte1 from the cortex in telophase depends on activation of the Cdc14 phosphatase. Ectopic expression of Cdc14 at metaphase results in premature dephosphorylation of Lte1 coincident with its release from the cortex. In vitro phosphatase assays confirm that Lte1 is a direct substrate for Cdc14. Our results suggest that the asymmetry in Lte1 localisation is imposed by Cdc28-dependent phosphorylation.

Finally, we report a mutational analysis undertaken to investigate intrinsic Lte1 determinants for localisation. Our data suggest that an intrameric interaction between the N-and C-terminal regions of Lte1 is important for cortex association.

Key words: Cell cycle, Mitotic exit, Polarity, Cdc14, Budding yeast


    Introduction
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Accurate chromosome partitioning is of fundamental importance to the continued genome integrity and survival of a species. It is therefore not surprising that exit from mitosis is one of the most heavily regulated transitions in the cell cycle. In all eukaryotic cells, exit from mitosis and cytokinesis requires mitotic cyclin-dependent kinase (Cdk) inactivation. In budding yeast, this is partly achieved through activation of the anaphase-promoting complex (APC) or cyclosome, a multiprotein complex required for ubiquitin-dependent proteolysis of unstable proteins (Morgan, 1999Go). The dual specificity phosphatase Cdc14 is responsible for dephosphorylation of the APC/C specificity factor Hct1/Cdh1 thereby stimulating APC-dependent degradation of mitotic cyclins (Schwab et al., 1997Go). In addition, Cdc14 dephosphorylates the Cdk inhibitor Sic1 and its transcription factor Swi5, which induces stabilisation of Sic1 and SIC1 transcription, respectively, whereby mitotic Cdk is further inactivated (Visintin et al., 1998Go).

As the ultimate inducer of mitotic exit, Cdc14 itself is tightly regulated. Its activity is inhibited through binding to Net1/Cfi1, which sequesters Cdc14 in the nucleolus for most of the cell cycle (Shou et al., 1999Go; Visintin et al., 1999Go). Early in anaphase a pool of Cdc14 is released through the action of the so-called FEAR network, comprising proteins such as the separase Esp1, Slk19, Spo12 and the polo-like kinase Cdc5 (Stegmeier et al., 2002Go; Yoshida et al., 2002Go). This initial wave of liberated Cdc14 sets off a positive feedback loop by activating the mitotic exit network (MEN), which is required for the complete and sustained release of Cdc14 from the nucleolus (Stegmeier et al., 2002Go; Pereira et al., 2002Go).

A key upstream component of the MEN is Tem1, a GTPase belonging to the Ras superfamily (Shirayama et al., 1994bGo). Activation of Tem1 triggers a signalling cascade, which includes several protein kinases such as Cdc15, Dbf2 and Dbf20. Cdc5 is also a member of the MEN but its precise role is complex as it impinges on the pathway both upstream and downstream of Tem1 (Bardin and Amon, 2001Go; Mah et al., 2001Go; Lee et al., 2001aGo; Hu et al., 2001Go).

Given the central position of Tem1 in the MEN its regulation is pivotal for control of mitotic exit. Bub2 and Bfa1, which form a bipartite GAP, function to downregulate Tem1 activity (Geymonat et al., 2002Go). By contrast, Lte1, which has homology to the Cdc25 family of guanine-nucleotide exchange factors, is presumed to activate Tem1 (Keng et al., 1994Go; Shirayama et al., 1994bGo). Defects in LTE1 cause cells to arrest at telophase at low temperatures (Shirayama et al., 1994aGo). In fact, TEM1 was originally isolated as a high-copy suppressor of the cold-sensitive phenotype of an lte1 {Delta} mutant (Shirayama et al., 1994bGo). The high intrinsic exchange activity of Tem1 recently reported may explain why Lte1 is dispensable for viability at higher temperatures (Geymonat et al., 2002Go). Also, Bub2 and Bfa1 are non-essential components in an unperturbed cell cycle. However, in situations where spindle position is compromised, Bub2 and Bfa1, as part of the spindle orientation checkpoint, become essential to restrain Tem1 activity and delay mitotic exit. In the absence of Bub2 or Bfa1, mutants such as dhc1 and kar9, which display spindle orientation defects, proceed with mitosis regardless of spindle position (Bardin et al., 2000Go; Pereira et al., 2000Go).

Recent work suggests that the subcellular distribution of Tem1 and Lte1 holds the key to how the spatial information on spindle position is integrated with the mitotic exit machinery. Whereas Tem1, like most of the MEN components, localises preferentially to the SPB destined for the daughter cell, Lte1 is confined to the bud periphery (Bardin et al., 2000Go; Pereira et al., 2000Go). In this way, Tem1 activation by Lte1 is prevented until SPB movement into the daughter cell has occurred, thereby coupling mitotic exit with completion of chromosome segregation. Consistent with this model, overproduction of Lte1 driving it into the mother cell leads to premature mitotic exit in dhc1 mutants, resulting in the formation of multinucleate and anucleate cells (Bardin et al., 2000Go). However, LTE1 overexpression is not lethal in wild-type cells, suggesting that additional mechanisms must exist to control mitotic exit.

The unique asymmetric division of budding yeast is based on a complex spatial regulation of secretion and cell polarity (Chant, 1999Go). Activation of the major Cdk, Cdc28, by G1 cyclins Cln1-3 at START promotes bud site assembly (Lew and Reed, 1995Go). This is achieved by targeted activation of Cdc42, a Rho-like GTPase, which through association with numerous effectors including the PAK-like kinases and the Gic1/2 proteins recruit components involved in actin polarisation to the newly designated bud site (Johnson, 1999Go). Both actin-dependent and -independent pathways are deployed in polarised bud growth. At present, it is unclear how spatial control of Lte1 is coupled to the polarity establishment machinery.

To date very little is known about the regulation of Lte1. Although Lte1 protein levels do not fluctuate during the cell cycle, the protein exhibits cell-cycle-dependent phosphorylation (Bardin et al., 2000Go; Lee et al., 2001bGo). The precise role of this modification is not understood.

To gain insight into the regulation of Lte1 we set out to examine the pathways that contribute to its asymmetric distribution. Here we reveal a dual requirement for Cdc28/Cln activity in recruitment of Lte1 to the bud cortex. Firstly, Cdc28 is required to activate the Cdc42 GTPase, which is essential to establish Lte1 at the incipient bud site. However, Cdc42 activation in the absence of Cdc28 activity is not sufficient to target Lte1 to the cortex, suggesting an additional role for Cdc28. We provide evidence that Cdc28 directly phosphorylates Lte1. Also, we show that Cdc14 phosphatase activity triggers the dephosphorylation and concomitant release of Lte1 from the bud cortex. Taken together our results suggest that Cdc28-dependent phosphorylation of Lte1 dictates its asymmetric localisation. Finally, a structure-function analysis of Lte1 reveals that both the N- and C-terminal domains are required for its localisation to the bud cortex.


    Materials and Methods
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Yeast strains and methods
Relevant yeast strains and their genotypes are shown in Table 1. Most strains are isogenic derivatives of BF264-15 15DU: a ura3{Delta}ns ade1 his2 leu2-3, 112 trp1-1a (Richardson et al., 1989Go). Strains in CG378 background: a ade5 can1 leu2 trp1 ura3. S288C-derived strains: a his3 leu2 lys2 ura3. Strains in W303 background: ade2-1 trp1-1 can1-100 leu2,-3,112 his3-11,15 ura3. Yeast media and genetic procedures were performed as described previously (Guthrie and Fink, 1991Go). Briefly, YEP was used as rich media with 2% of appropriate sugars added. Synthetic media was used with appropriate drop-outs. Cultures were grown at 25°C and shifted to 37°C in temperature-shift experiments unless otherwise stated. Gene disruptions were performed by a PCR-targeting technique (Wach et al., 1994Go).


View this table:
[in this window]
[in a new window]
 
Table 1. Yeast strains used in this study

 

Plasmids
The integrative pKGFP plasmid, which carries the KANR marker for G418 resistance, was used to fuse the endogenous Lte1 protein to the GFP epitope (F64L, S65T, Q80R mutant). A SalI-NotI fragment spanning the last 600 bases of the LTE1 gene was inserted into pKGFP cut with SalI and NotI. The plasmid was linearised with AflII, and integrants were isolated by selecting for G418 resistance. The parental pKGFP plasmid has been described previously (Jensen et al., 2001Go).

The LTE1HA3-pTRP1 and LTE1HA3-pKAN plasmids were used to tag the endogenous Lte1 protein with 3HA epitopes at the C-terminus. These integrative plasmids carry the sequence encoding 3 HA epitopes, which can be fused to a protein of interest (Jensen et al., 2001Go). The plasmids were linearised with AflII and integrants isolated by selecting for growth on dex-trp or resistance to G418, respectively.

The CFP-TUB1 plasmid has been described previously (Jensen et al., 2001Go). Plasmid pCDC14-EMBLYex4 was used to express 6Histagged Cdc14 under the control of GAL1-inducible promoter. Plasmid pLD1 used to express a non-degradable version of Sic1 (Sic1{Delta}N) from the GAL1-inducible promoter has been described previously (Labib et al., 1999Go).

LTE1-pRSG is an integrative plasmid carrying the LTE1 open reading frame (ORF) under the control of the GAL1 promoter. It was generated by inserting a BamHI PCR fragment into the pRSG plasmid (Jensen et al., 2001Go). A SmaI site was inserted just before the stop codon allowing in-frame insertion of three HA or GFP epitope tags. Truncation mutants of Lte1 were cloned into this plasmid. All pRSG-derived plasmids were linearised with StuI and integrants isolated by selecting for growth on dex-ura media.

Plasmid LTE1-YIplac128 was made by inserting the LTE1 promoter sequence and ORF into the integrative plasmid YIplac128. A 500 basepair XhoI-SalI PCR fragment of the promoter sequence was inserted into YIplac128 cut open with SalI. A SalI-KpnI fragment spanning the LTE1 ORF was subsequently introduced into SalI and KpnI. A SmaI site was included in the oligomer to allow the in-frame insertion of a three HA or GFP tag at the C-terminus. The plasmid was digested with ClaI prior to transformation and integrants isolated by selecting for growth on dex-leu media. Plasmids LTE1({Delta}N157)-, LTE1({Delta}N300)-, LTE1({Delta}N360)-, LTE1({Delta}C1270)- and LTE1({Delta}C1334)-YIplac128 were designed to allow expression of Lte1 truncation mutants at endogenous level.

Plasmid LTE1Cdk-YIplac128 was generated by several rounds of mutagenic PCR. The mutagenic oligos used were: 5' TGCCTCCAGCACCGGCTAAAAAAGTTGAATTTATTCTGAACTCCTTA 3' (T317A mutation shown in bold; underlined base indicates a silent mutation eliminating the EcoRI site), 5' CAGAGGCGCAGAAGTCATGCTTTTTTGGGATTGGGAATGATTTTTCCTCCTTGGTGCCATATTTGTA 3' (T614A and S630A mutations shown in bold), 5' TCATCCAGCGCTCCACCCAGAGAT 3' (S667A mutation shown in bold), 5' GACTTGTTTTGCTCAGGGTCTACTATGGATAACTCTTTGGTTGGTGCTATGGCAATG 3' (T793A mutation shown in bold; underlined base indicates a silent mutation eliminating the BstYI site). The PCR fragments were cloned into plasmid LTE1-YIplac128 as described above.

To create GST-Lte1 (300-845), a PCR-generated HindIII fragment covering residues 300-845 was cloned into pGEX-KG vector digested with HindIII allowing in-frame fusion with GST. To create MBP-Lte1(1-500). a PCR-generated BamHI fragment spanning residues 1-500 was introduced after the maltose-binding domain in pMA1-2C vector opened with BamHI.

Plasmid GST-Lte1Cdk(300-845) was made by cloning a PCR-generated HindIII fragment based on Lte1Cdk-YIplac128 template into pGEX-2C cut with HindIII.

Plasmid GST-Cdc28-13 was used to express Cdc28-13 kinase from the GAL1-inducible promoter.

All plasmids were subjected to sequencing to verify their integrity. Integrants and deletion mutants were verified by PCR analysis.

Cell biology protocols
Fluorescence microscopy was performed using a Photometrics CH350L liquid cooled CCD camera on an Olympus IX70 inverted microscope, with a 100x objective. Cell images were captured and manipulated using SoftWoRx software (Applied Precision Inc., Issaquah, WA) and Adobe Photoshop version 6.0 (Adobe Systems Incorp., Mountain View, CA). For live microscopy, cells were grown in the presence of extra supplement of adenine (0.2 mg/ml). In general, images were taken of a single focal plane and acquired using 0.5-4 second exposures. At least 200 cells were counted for each sample.

Yeast actin was visualised with rhodamine-conjugated phalloidin as previously described (Frenz et al., 2000Go).

Cell cycle synchronization
G0-G1 release experiments were carried out as described previously (Ayscough et al., 1997Go).

G1 arrest of the cln1,2,3{Delta} GAL1-CLN3 (SY123) cells was achieved by repressing CLN3 for 2 hours by growth in dextrose-containing media. After washing, cells were released by inducing Cln3p expression in medium containing 2% galactose. Where indicated latrunculin B (LatB) (Calbiochem, final concentration 250 µg/ml dissolved in DMSO) or an equivalent amount of DMSO, as a control, was added.

G1 arrest of cln1,2,3{Delta} MET-CLN2 LTE1GFP GAL-CDC42G12V (SY124) cells grown in raffinose containing media was achieved by repressing expression of Cln2 for 3 hours in selective medium supplemented with 2 mM methionine. Where indicated either 2% galactose or 2% dextrose was added to induce or prevent expression of Cdc42 mutant protein for 3 hours prior to microscopic examination. As a control, arrested cells were washed and released by inducing Cln2 expression in medium lacking methionine.

For {alpha}-factor arrest and release experiments, cells in mid-log phase were arrested with 3.5 µg/ml {alpha}-factor for 3 hours. Cells were filtered, washed and released into fresh media.

Nocodazole arrest was induced by incubation of mid-log phase cultures with 15 µg/ml nocodazole for 2 hours.

Cell cultures were analysed for DNA content using a FACScan Becton Dickinson flow cytometer as described previously (Kramer et al., 1998Go).

Lysate preparation and immunoblotting
Cells were broken with glass beads using a Hybaid Ribolyser in NP-40 buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.1% NP-40, 10 mM sodium pyrophosphate, 0.1 mM orthovanadate, 1 mM PMSF, 2 mg/ml aprotinin, leupeptin and pepstatin A). In general, protein was separated on 7.5% gels by SDS-PAGE. For detection of HA-tagged proteins, the mouse monoclonal antibody 12CA5 (kindly provided by Steve Ley) was used at a 1:1000 dilution. For detection of His-tagged protein, the monoclonal anti-RGSHIS antibody (Clontech) was used at 1:1000 dilution. The polyclonal anti-Sic1 antibody described previously (Donovan et al., 1994Go) was used at a 1:2000 dilution and the monoclonal anti-TAT1 antibody used to detect tubulin was used at 1:1000 dilution.

Immunoprecipitation, kinase and phosphatase assays
Clb2-associated kinase activity was measured as previously described (Kramer et al., 1998Go). Briefly, 250 µg extract was incubated with 0.2 µg rabbit anti-Clb2 antibody (Santa Cruz) for 1 hour at 4°C. 50 µl of pre-washed Protein A Sepharose beads (50% slurry) was added and incubation continued for 1 hour. Immunoprecipitates were washed three times with extraction buffer and twice with kinase buffer (25 mM Mops pH 7.4, 15 mM MgCl2). Immobilized Cdc28-Clb2 complexes were incubated for 30 minutes at room temperature in a 20 µl reaction mixture containing 100 µM ATP, 5 µg histone H1 and 2 µCi [{gamma}-32P] ATP (3000 mCi/mmol) in kinase buffer (50 mM HEPES-NaOH pH 7.4, 10 mM MgCl2 and 1 mM DTT). Reaction products were analysed by 12% SDS-PAGE followed by autoradiography.

For immunoprecipitation phosphatase assays, HA-tagged Lte1 was immunoprecipitated from 1 mg cell lysate using 1 µl monoclonal 12CA5 antibody and protein G sepharose (Pharmacia). Following three washes with NP40 lysis buffer and two washes with phosphatase buffer (50 mM imidazole-HCl pH 6.6, 1 mM EDTA, 1 mM DTT), immunoprecipitates were resuspended in 50 µl phosphatase buffer to which 1 µg MBP-Cdc14, 1 µg MBP-Cdc14C283A or 1 µg MBP were added. After incubation for 45 minutes at 30°C, immune complexes were washed twice in lysis buffer and analysed by immunoblotting.

To produce recombinant MBP-Cdc14 and MBP-Cdc14C283A, pMAL-CDC14 and pMAL-CDC14C283A (provided by Prolifix) were transformed into the protease-deficient Escherichia coli BL21 and cells grown to an OD600 of 0.6 before expression of MBP-fusion protein was induced with IPTG (0.1 mM) for 16 hours at 20°C. The recombinant Cdc14 was purified from bacterial lysates on an amylose column (NEB) followed by a desalting column (Pharmacia) as specified by the manufacturer.

To produce Cdc28/Cln2 for kinase assays, cdc53-1 mutant yeast cells containing a dual GAL1-inducible GST-CDC28 CLN2-FLAG plasmid were arrested at restrictive temperature for 2 hours and Cdc28/Cln2 expression induced with galactose for 3 hours. For each pull-down reaction, 500 µg of yeast extracts was incubated at 4°C for 1 hour with 25 µl glutathione-sepharose beads. Beads were washed four times with binding buffer (50 mM Tris-HCl pH 7.5, 250 mM NaCl, 0.5% NP40, 1 mM DTT) and two times with kinase buffer before kinase assays were performed.

Wild-type or Cdk mutant fragments of Lte1 (aa 300-845) fused to GST were produced in E. coli and purified on glutathione sepharose beads according to the manufacturers instructions. Proteins were eluted with 15 mM glutathione and dialysed prior to use.

For Lte1 in vitro binding assay, MBP-Lte1(1-500) was purified from bacterial lysates on amylose resin. 25 µl of eluted and dialysed MBP-Lte1(1-500) protein was used in GST pull-down experiments with either 50 µl GST-Lte1(984-1434) or GST alone purified on glutathione sepharose beads in a final volume of 300 µl binding buffer (50 mM Tris-HCl pH 7.5, 200 mM NaCl). After 1.5 hours incubation at 4°C, beads were washed four times with buffer (50 mM Tris-HCl pH 7.5, 300 mM NaCl, 0.5% NP40, 2 mM DTT), and protein was eluted in buffer (50 mM Tris-HCl pH 7.5, 200 mM NaCl, 0.1% NP40, 1 mM DTT, 15 mM glutathione). Samples were analysed by SDS-PAGE (8% gels) followed by immunoblotting with monoclonal anti-MPB antibody (Clontech).


    Results
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell-cycle-dependent localisation of Lte1 in live cells
Previous studies on Lte1 have employed indirect immunofluorescence or overexpression to monitor its localisation (Bardin et al., 2000Go; Pereira et al., 2000Go). To address the spatial regulation of Lte1 under more natural conditions, we fused the GFP gene downstream of the endogenous LTE1 gene. The Lte1GFP fusion protein was able to complement the cold-sensitivity of the lte1{Delta} mutant (data not shown), indicating that it encoded a functional Lte1.

To assess Lte1 distribution across the cell cycle, we used cln1{Delta}cln2{Delta}cln3{Delta} GAL1-CLN3 cells expressing Lte1GFP to inactivate Cdc28/Cln activity by Cln3 depletion. Cells were released from the G1 arrest into the cell cycle by Cln3 reexpression in the presence of galactose. Upon G1 arrest, Lte1GFP signal was predominantly cytoplasmic but after Cdc28/Cln activation Lte1 formed a patch at the developing bud site and concomitant with bud emergence the protein became associated with the bud cortex as previously observed (Bardin et al., 2000Go; Pereira et al., 2000Go). The cortical distribution of Lte1 persisted as buds enlarged until nuclear division at which point Lte1 was dispersed in the cytoplasm (Fig. 1A).



View larger version (41K):
[in this window]
[in a new window]
 
Fig. 1. Mitotic Lte1 localisation is actin independent but requires activation of Cdc28/Cln kinase. (A) cln1{Delta}cln2{Delta}cln3{Delta} GAL1-CLN3 strain (SJ123) was arrested in G1 and released into YEPGalactose to induce expression of Cln3 at 30°C. Aliquots were removed at indicated times for analysis by real time microscopy, determination of budding index and cell cycle progression by DAPI stain. ({square}) Budding index; ({diamondsuit}) cortical Lte1; ({circ}) cells with pre-anaphase nuclear morphology; ({triangleup}) cells with anaphase nuclear morphology; (•) cells with completely separated DNA masses (telophase). (B) Cells described in (A) were arrested in G1 (a) and released into the cell cycle in the presence of LatB (b) or DMSO as control (c). Localisation of Lte1GFP monitored after 2 hours. The percentage of cells with cortical Lte1 is indicated below. (C) Wild-type cells (SY125) were arrested in G1 with {alpha}-factor (a). Shmoos were treated with LatB for 15 minutes and cells examined by microscopy (b-c). Numbers indicate the percentage of cells that localised Lte1GFP to the tip of the mating projection. (D) Localisation of Lte1GFP in cdc15-1 mutant cells expressing CFP-tubulin (SY126) at the restrictive temperature (a), following 1 hour nocodazole treatment at 37°C (b) and 1 hour after release at permissive temperature (c). Numbers indicate the percentage of cells with cortical Lte1. Bar, 10 µm.

 

To determine whether the localisation of Lte1 to the incipient bud site required an intact actin cytoskeleton, cells were released from a G1 block in the presence or absence of the actin-depolymerising drug latrunculin B (LatB). As shown in Fig. 1B, this treatment did not prevent Lte1 localisation to the cortex. Staining with rhodamine-phalloidin confirmed that the actin cytoskeleton was indeed depolarised by LatB treatment (data not shown). Also, when asynchronous cells were treated with LatB the majority (98%) of small to medium budded cells maintained Lte1 at the cortex (data not shown). Furthermore, we observed that Lte1GFP was targeted to the mating projection upon addition of mating pheromone. As Cdc28/Cln activity is inhibited by the G1 Cdk inhibitor Far1 in {alpha}-factor-arrested cells, Lte1 localisation does not require Cdc28 activity in the mating pathway (see Discussion). However, Lte1 is maintained at the tip of the shmoo by an actin-independent mechanism (Fig. 1C). We conclude that neither establishment nor maintenance of Lte1 at the cortex is dependent on the structural integrity of the actin cytoskeleton.

Finally, we investigated the involvement of microtubules in targeting Lte1 to the cortex. For this purpose, cells were arrested at a late cell-cycle stage induced by a cdc15-1 mutation and treated with nocodazole to destroy microtubules. This treatment did not disrupt the cortical localisation of Lte1 observed in the cdc15-1 mutant (Fig. 1Da-b). When cells were released from the telophase block at 25°C in the presence of nocodazole, Lte1 was relocalised to the bud site in the next cell cycle in the majority of cells (97%) (Fig. 1Dc). Therefore, Lte1 is not targeted to the cortex by either the microtubule or actin network, suggesting the involvement of other determinants at the cortex.

Importance of an intact secretion pathway and septin function in Lte1 localisation
An intact secretion pathway has been implicated in localising bud site determinants to the cell cortex (Jin and Amberg, 2000Go). To test whether polarised secretion is required to maintain Lte1 at the bud cortex we assayed its localisation in sec18-1 mutants. The ability of Lte1 to assemble at the incipient bud site in unbudded cells and at the daughter cell cortex in budded cells was largely unaffected by the sec18-1 mutation (Fig. 2A,B). Therefore, a functional secretion pathway appears not to be critical for initial association of Lte1 to the cortex.



View larger version (41K):
[in this window]
[in a new window]
 
Fig. 2. Lte1 cortex association is largely independent of an intact secretion pathway but responds to defects in septin structure. (A,B) Wild-type and sec18-1 (SY132) cells were shifted to 37°C for 90 minutes and Lte1 localisation was observed and quantified. Bar, 10 µm. (C) Lte1GFP localisation in wild-type and cdc12-6 (SY134) mutant cells at permissive temperature and following 20 minutes shift to 37°C. (D) Introduction of CDC12, but not plasmid alone, restores Lte1 to the cortex (a-b). (E) Phosphorylation status/stability of Lte1 is not affected by septin mutation. Wild-type and cdc12-6 (SY133) strains expressing HA3 tagged Lte1 were arrested with nocodazole at 20°C. Cultures were shifted 20 minutes to 37°C and cells collected for protein analysis.

 

Recently, septins have been shown to play a role in maintaining cortical factors in the bud (Barral et al., 2000Go; Takizawa et al., 2000Go). To examine whether septin function was required for Lte1 localisation, wild-type and cdc12-6 cells expressing Lte1GFP were shifted to 37°C for 20 minutes, which is sufficient to destroy septin structures. Even at the permissive temperature, Lte1 localisation is diminished in cdc12-6 cells; however, upon shift to 37°C, Lte1 redistributed equally between mother and bud compartments in more than 60% of budded cells (Fig. 2C). By contrast, Lte1 remained concentrated in the bud and excluded from the mother cell in wild-type cells incubated at 37°C. Introduction of a plasmid-borne CDC12 gene restored the asymmetric localisation of Lte1 in the cdc12-6 mutant (Fig. 2D). Lte1 is a phosphoprotein in vivo (Lee et al., 2001bGo) (see below). Analysis of Lte1 protein in septin mutants showed that neither protein level nor phosphorylation status was greatly affected (Fig. 2E). We conclude that septin integrity is important to restrict Lte1 to the daughter cell compartment.

Recruitment of Lte1 to incipient bud site depends on Cdc42 activity
To dissect events at the G1 transition important for establishing Lte1 at the cortex, we investigated Lte1 localisation in a panel of mutants defective in bud polarisation. Consistent with our data from the Cln-depleted strain (Fig. 1A), we found that Lte1 failed to localise to the cortex in cdc28-13 mutants arrested in G1 at the restrictive temperature (Fig. 3A). Cdc28/Cln activity triggers activation of the Cdc42 GTPase by targeting its exchange factor Cdc24 to the plasma membrane. This activation is required to organise polarity factors and the actin cytoskeleton towards the incipient bud site (Johnson, 1999Go). We found that Lte1 was cytoplasmic in cdc42-1 mutants held at the restrictive temperature (Fig. 3B), suggesting that Cdc42 is required to localise Lte1 to the cortex. As DNA replication and the nuclear division cycle continue in cdc42 mutants despite the block in bud formation it follows that activation of Cdc28 at START is not sufficient by itself to target Lte1 to the cortex. By contrast, Cdc24 fused to GFP localised efficiently in cdc42-1 mutants, as expected (Fig. 3B). Once Lte1 is established at the cortex, Cdc42 function is no longer required for its maintenance, as inactivation of cdc42 after bud emergence had little effect on Lte1 cortical localisation (data not shown).



View larger version (39K):
[in this window]
[in a new window]
 
Fig. 3. Distribution of Lte1 in polarity mutants. (A) Localisation of Lte1GFP in a cdc28-13 strain (SY127) at the permissive temperature and after incubation at 37°C. (B) Haploid cdc42-1 cells expressing either endogenous Lte1GFP (SY128, upper panel) or Cdc24GFP (SY129, bottom panel) were examined at the permissive temperature and 2 hours after shift to 37°C. (C) Haploid gic1{Delta}gic2{Delta} cells expressing endogenous Lte1GFP (SY151) were shifted to 37°C for 3 hours and Lte1 localisation monitored by microscopy. (D) Wild-type (SY125), bni1{Delta} (SY130) and bud6{Delta} (SY131) cells were released from their block in G0 at 30°C and analysed for Lte1 localisation after 2 hours. (A-D) Numbers indicate the percentage of cells with shown localisation pattern.

 

Activated Cdc42 recruits a number of effectors to the plasma membrane required for polarised growth. We examined whether the Cdc42 targets Gic1 and Gic2 were involved in Lte1 localisation. The gic1{Delta}gic2{Delta} double mutant is conditionally lethal and accumulates as large, unbudded and multinucleate cells at the restrictive temperature (Chen et al., 1997Go). Lte1GFP failed to localise to the presumptive bud site in gic1{Delta}gic2{Delta} cells held at 37°C (Fig. 3C). Quantification of these results revealed that 96% (n=250) of the gic1{Delta}gic2{Delta} cells were unable to localise Lte1 at bud emergence, whereas Cdc24 was found at the bud site in 25% (n=200) of the cells. Thus, these results imply that the Gic proteins may be involved in recruiting or stabilising Lte1 at the incipient bud site. It is important to note, however, that in the few gic1{Delta}gic2{Delta} cells that were able to form a bud, Lte1 localised efficiently to bud tips, demonstrating that the Gic proteins are not the only components capable of localising Lte1 to sites of polarised growth.

Recently, the Gic proteins were shown to direct Bud6 and the formin Bni1 to the incipient bud site, underscoring their importance in linking activated Cdc42 to the cortical actin cytoskeleton (Jaquenoud and Peter, 2000Go). However, we find that neither Bni1 nor Bud6 is required to establish Lte1 at the cortex. As shown in Fig. 3D, upon release from a G0 block, Lte1 localised to the presumptive bud site in bni1{Delta} and bud6{Delta} mutants with a similar efficiency to that seen in wild-type cells. Bni1 is necessary for the asymmetric distribution of the transcription factor Ash1 involved in mating type switching (Bobola et al., 1996Go). The observation that BNI1 deletion does not cause mislocalisation of Lte1, as is the case for Ash1, supports the notion that Lte1 is not transported to the bud tip by a similar actomyosin-driven mechanism.

Dephosphorylation by Cdc14 phosphatase triggers Lte1 release from bud cortex
Once Lte1 has been established at the cell cortex at START it is maintained until late in mitosis (Fig. 1A). We find that Lte1 distribution is unaffected by MEN mutations (Fig. 1C, cdc15-1, data for dbf2-2, tem1-3 and cdc5-1 not shown). This argues that an event downstream of MEN function is required to release Lte1 from the cortex. This prompted us to explore the effect of Cdc14 activation and mitotic kinase inactivation on Lte1 distribution. For this purpose, cells containing a CDC14 gene under the control of a GAL1 promoter were pre-arrested in metaphase by nocodazole treatment. Overexpression of CDC14 resulted in the untimely release of Lte1 from the daughter cell cortex. In more than 80% of arrested cells, Lte1 signal was completely eliminated from the cortex within 2 hours of induction (Fig. 4A). By contrast, overproduction of a Cdc14 phosphatase mutant did not disrupt Lte1 distribution (data not shown). Overexpression of CDC14 causes hyperaccumulation of Sic1, which contributes to mitotic Cdk inactivation (Visintin et al., 1998Go). To examine whether the effect on Lte1 localisation is a consequence of mitotic kinase inactivation we repeated the experiment with cells overexpressing SIC1 from the GAL1 promoter. In this case, only ~20% of arrested cells had lost Lte1 signal at the cortex after 2 hours induction (Fig. 4B). Thus, Cdc14 triggers dissociation of Lte1 from the cortex by a mechanism that is largely independent of mitotic kinase inactivation but requires its phosphatase activity. This suggests that phosphorylation either directly or indirectly is important for Lte1 localisation.



View larger version (29K):
[in this window]
[in a new window]
 
Fig. 4. Cdc14 activity induces dissociation of Lte1 from the cortex. (A) A strain carrying GAL1-inducible CDC14 (SY140) was grown in YPRaffinose and arrested with nocodazole. At the arrest either 2% galactose (+) or 2% dextrose (-) was added. At the indicated times Lte1GFP fluorescence was monitored. Representative cells are shown below the table. Bar, 10 µm. (B) A strain harbouring a GAL1-inducible SIC1 plasmid (SY139) was treated as described in A. Cells were quantified in a similar fashion. A multibudded phenotype was observed upon extensive SIC1 overexpression but pictures are representative of cells at the 2 hour time point.

 

To address this further, we examined the effect of GAL1-CDC14 on the phosphorylation status of Lte1 using a similar experimental approach. We found that ectopic overexpression of CDC14 in metaphase-arrested cells caused a complete elimination of Lte1 phosphorylation with a comparable timing to the loss of cortical Lte1 observed in the previous experiment (Fig. 5A, compare with Fig. 4A). Again, it is evident that Cdc14 does not trigger Lte1 dephosphorylation indirectly simply by decreasing Cdc28 activity. Overexpression of SIC1 had no detectable effect on the phosphorylation status of Lte1. Lte1 remained hyperphosphorylated although mitotic kinase was inactivated within 1 hour of induction (Fig. 5B). Overexpression of GLC7, which encodes a protein phosphatase, does not promote Lte1 dephosphorylation (data not shown). This strongly suggests that the effect on Lte1 phosphorylation is not a consequence of overexpression of a phosphatase per se but is specific to Cdc14.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 5. The Cdc14 phosphatase dephosphorylates Lte1 in vivo and in vitro. (A) A strain expressing endogenous HA3-tagged Lte1 and carrying a GAL1-inducible CDC14 plasmid (SY138) was treated as described in Fig. 4A. At the indicated times, samples were withdrawn for protein analysis, Clb2-associated kinase assays using Histone H1 as substrate and FACS analysis. The arrow indicates position of unphosphorylated Lte1. (B) Similar analysis to that described in A was performed on a strain expressing Lte1HA3 and carrying a GAL1-inducible SIC1 plasmid (SY137). Multiple Lte1 forms are indicated with a bracket. An unspecific band seen with the anti-Sic1 antibody is indicated with an asterisk (C). Extracts from nocodazole-arrested cells expressing endogenous Lte1 HA3 tagged protein were subjected to immunoprecipitation using anti-HA antibody. The immunoprecipitates were left untreated (lane 1), incubated with 1 µg purified MBP-Cdc14 (lane 2), 1 µg MBP-Cdc14C283A (lane 3) or 1 µg MBP (lane 4).

 

We next tested the ability of Cdc14 to dephosphorylate Lte1 in vitro. Treatment of Lte1 immunoprecipitates prepared from mitotically arrested cells with purified MBP-Cdc14 resulted in a complete collapse of the low mobility forms of Lte1 into a single band (Fig. 5C, lane 2). There was no effect when a catalytically inactive version of Cdc14 (MBP-Cdc14C283A) or MBP alone was added (Fig. 5C, lanes 3-4). Given the timing of Cdc14 activation and its requirement for exit of mitosis, our results suggest that Lte1 is a physiological substrate of Cdc14.

Taken collectively our data support the notion that Cdc14 by dephosphorylating Lte1 in late anaphase triggers its rapid dissociation from the daughter cell cortex.

Lte 1 is phosphorylated by Cdc28 cyclin-dependent kinase
We, and others, have previously shown that Lte1 exhibits cell-cycle-dependent phosphorylation (Bardin et al., 2000Go; Lee et al., 2001bGo). The modification occurs coincident with bud emergence but is accentuated as cells enter mitosis. The multiple phosphorylation is lost coincident with Clb2 destruction at mitotic exit (Fig. 6A). Hence, the phosphorylation mimics the localisation profile. Given that Lte1 cortical localisation is regulated by Cdc14 (Fig. 4) and depends on Cdc28/Cln activity (Fig. 1A, Fig. 3A), we set out to investigate if Lte1 is phosphorylated by Cdc28.



View larger version (57K):
[in this window]
[in a new window]
 
Fig. 6. Lte1 is phosphorylated by Cdc28 across the cell cycle. (A) Wild-type cells (SY142) were released from an {alpha}-factor-induced G1 block into fresh YPDextrose medium at 25°C. Cells were collected at indicated intervals and processed for immunoblotting. The asterisk indicates the position of an unspecific band. (B) Cells containing a non-degradable version of Sic1 under the control of the GAL promoter (SY135) were synchronised in G1 with {alpha}-factor. Cells were released into either YPSucrose or YPGalactose medium at 30°C. At 15 minute intervals, samples were withdrawn for western blotting to monitor Lte1 phosphorylation and FACS analysis. Cells expressing Lte1 GFP (SY136) were treated in a similar fashion and the effect of Sic1{Delta}N overproduction on Lte1 localisation scored by microscopy (lower panel). Numbers indicate the percentage of cells with cortical Lte1. (C) Left panel, GST-Cdc28-13 purified from asynchronous yeast cells was used for kinase assays at 25°C and 37°C with either GST-Lte1(300-845) or Histone H1 as substrates. The Cdc28-13 kinase was pre-incubated at 37°C for 30 minutes prior to use in reactions performed at 37°C. Middle panel, GST-Cdc28/Cln2 complexes purified on glutathione sepharose beads from cdc53-1 yeast cells (SY141) arrested at the restrictive temperature were used for kinase assays with either GST-Lte1(300-845) or Histone H1 as substrates. Extract from uninduced cdc53-1 cells was used as a negative control. Right panel, purified GST-Lte1(300-845) and GST-Lte1Cdk(300-845) proteins were used in kinase assays with Cdc28 purified from nocodazole-treated yeast cells. The band of radioactive protein migrated to the same position as the Lte1 protein detected by Coomassie staining (input). (D) Cells expressing Lte1CdkHA3 (SY143) were synchronised in G1 by {alpha}-factor and released into YPDextrose medium at 25°C. Cells were then treated as in A. (E) Localisation of Lte1GFP in G1 cyclin-depleted cells (SY124) (—Cln2), after 3 hours overexpression of Cdc42-G12V from the GAL promoter (—Cln2+galactose). The number indicates cells with clear cytoplasmic staining. Cells released from the arrest localised Lte1 efficiently at the cortex (+Cln2). Here the number indicates cells with cortical distribution.

 

Cdc28 regulates cell cycle progression by associating with different stage-specific cyclins. Whereas the G1/S transition relies solely on Cdc28/Cln activity, progression through S-phase and mitosis is coupled to Cdc28 activation by B-type cyclins Clb1-6 (Nasmyth, 1993Go). To discriminate between Cdc28/Cln and Cdc28/Clb activities, we examined the phosphorylation of Lte1 in synchronised cells expressing a non-degradable form of Sic1 (Sic1{Delta}N), a potent inhibitor of S-phase and mitotic Cdk activities. As cells were released from an {alpha}-factor-induced G1 block, slower-migrating forms of Lte1 appeared coincident with bud emergence even when Sic1 accumulation had inhibited Clb/Cdc28 activity judged by lack of DNA replication (Fig. 6B arrows, data not shown). Inhibition of Clb/Cdc28 activity also did not affect the establishment of Lte1 at the bud cortex. As a consequence of Sic1 overproduction, cells exhibited highly elongated buds with Lte1GFP persisting at their tips (Fig. 6B). Although the early cell cycle phosphorylation of Lte1 is unperturbed upon Clb/Cdc28 inactivation, the hyperphosphorylated species normally observed later in the cell cycle are not formed (compare, for example, lanes indicated by asterisks in Fig. 6B). This suggests that Cdc28/Clb, directly or indirectly, may be responsible for some Lte1 phosphorylation events in vivo.

To assess whether Cdc28 can directly phosphorylate Lte1, we performed in vitro kinase assays using purified Cdc28-13 enzyme, which has a thermolabile kinase activity. We were able to detect phosphorylation of a bacterially produced Lte1 fragment spanning residues 300-845 at low temperatures (Fig. 6C, left panel). When the kinase reactions were performed at 37°C to inactivate the Cdc28-13 kinase, the phosphorylation was abolished, demonstrating that Cdc28 and no other putative contaminating kinase is responsible for the Lte1 phosphorylation (Fig. 6C, left panel).

To investigate whether Lte1 is a target of Cdc28 kinase complexed with Cln cyclins, in vitro kinase assays were carried out using Cdc28/Cln2 purified from yeast. We did observe phosphorylation of the Lte1 fragment (Fig. 6C, middle panel), implying that Lte1 is a substrate for Cdc28/Cln kinase in vitro.

The ability of Cdc28 to phosphorylate Lte1 is not restricted to Cln complexes. We found that Cdc28 kinase purified from mitotically arrested yeast cells was also able to phosphorylate Lte1 in vitro (Fig. 6C, right panel). Lte1 contains nine consensus Cdk phosphorylation motifs (S/T-P-X-K/R, S/T-P-K/R, and K/R-S/T-P), of which five are contained in the fragment. We constructed point mutations in the LTE1 gene to replace the serine or threonine residue in these five putative Cdk sites by an alanine residue (hereafter referred to as Lte1Cdk). The mutant fragment has a significantly reduced incorporation of radiolabel compared to the wild-type fragment although phosphorylation by Cdc28/Clb is not completely abolished (Fig. 6C). The latter may be due to the presence of several SP and TP motifs in the fragment, which are also potential Cdk phosphorylation sites.

To analyse the effect of the Lte1 Cdk mutant allele in vivo, strains were constructed with an integrated version of the mutant LTE1 gene expressed from its endogenous promoter. Analysis of protein status in synchronised cells revealed that the low mobility species were significantly decreased, consistent with reduced phosphorylation, across the entire cell cycle (Fig. 6D). This strongly suggests that Cdc28 phosphorylates Lte1 in vivo. The mutant allele is functional, as it is able to complement the cold-sensitivity of the lte1{Delta} mutant and the synthetic lethality of a spol2{Delta}lte1{Delta} double mutant (data not shown). Surprisingly, analysis of the localisation of Lte1Cdk fused to GFP in synchronised cells showed no apparent defect in asymmetric localisation or in the kinetics of cortical association (data not shown). Therefore, the residual phosphorylation of the Lte1Cdk mutant must be sufficient to establish cortex interaction.

The inability of Lte1 to localise to the cortex in mutants lacking Cdc28 activity (Fig. 1B, Fig. 3A) is not simply a consequence of these mutants failing to activate Cdc42. Expression of a hyperactivated form of Cdc42 can bypass the requirement for Cdc28/Cln activity in establishment of polarity (Gulli et al., 2000Go). We find that polarisation of G1-cyclin-depleted cells induced by expression of the GTP-bound form of Cdc42, Cdc42-G12V, was not sufficient to recruit Lte1 to the plasma membrane (64% of cells exhibit polarised actin cytoskeleton after 3 hours induction; data not shown). Although few cells displayed a faint stain at the polarisation sites, the bulk of Lte1 was retained in the cytoplasm (Fig. 6E). Thus, Cdc28/Cln has a separate role in membrane recruitment of Lte1 in addition to activation of Cdc42 presumably involving Lte1 phosphorylation.

Lte1 localisation to bud cortex requires cooperation between N- and C-terminal domains
To further explore the requirements for cortical attachment, we investigated the intrinsic Lte1 determinants for localisation. For this purpose, we conducted a mutational analysis on Lte1 that also allowed us to address which regions are crucial for Lte1 activity. Lte1 is a large protein composed of a total of 1435 amino-acid residues. The C-terminal region of Lte1 exhibits considerable homology to the nucleotide exchange domain present in Cdc25 (26% identity over last 200 amino acid residues). However, information is scarce regarding the exact role of the remaining domains. Examination of Lte1 primary amino-acid sequence using the SMART program revealed the presence of a hydrophobic N-terminal motif, GEFN, spanning residues 24-157, which is found in a subset of GEFs for Ras-like GTPases (Fig. 7A).



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 7. Functional domain analysis of Lte1. (A) A schematic representation of the domain structure of Lte1 is shown. The N-terminal region contains a GEFN motif, whereas the Cdc25-related GEF domain resides in the extreme C-terminus. Mutants were either expressed from an integrated allele driven by the GAL1 promoter (GAL1) or from an integrated allele driven by the LTE1 promoter (endogenous). Complementation was scored as the ability to rescue the growth defect of lte1{Delta} mutant (SY144) by serial dilution spot analysis after 7 days incubation at 14°C. Lte1 mutants were tested for complementation with or without GFP/HA3 tag with roughly similar outcome. +, cortical localisation; -, cytoplasmic/none localisation; +/-, partial cortical localisation; ND, not determined. (B) Representative cells of Lte1 mutants expressed either from GAL1 promoter or at endogenous level; Lte1{Delta}C984GFP (SY149); Lte1{Delta}N801GFP (SY150); wild-type Lte1GFP (SY148); Lte1{Delta}N157GFP (SY146); Lte1{Delta}C1334GFP (SY147); wild-type Lte1GFP (SY145). (C) Equal amounts of GST-Lte1{Delta}N984 protein or GST were bound to glutathione sepharose beads and incubated with MBP-Lte1 (1-500). Bound protein was eluted with glutathione and analysed by SDS-PAGE (10% gels) and immunostaining with anti-MBP antibody.

 

To address the importance of this GEFN motif for Lte1 function, we constructed a set of N-terminal truncation mutants and tested their ability to complement the cold-sensitive phenotype of an lte1{Delta} mutant. This phenotype is reversible by BUB2 deletion and thus likely to reflect the GEF activity of Lte1 (Lee et al., 2001bGo). Deletion of up to 300 amino acids from the N-terminus, thereby removing the GEFN domain, had little effect on the complementation ability of the mutant proteins when overexpressed from the GAL1 promoter or provided in a lower dose from the endogenous promoter (Fig. 7A). Further deletion to residue 360 resulted in weak suppression of the lte1{Delta} phenotype, although the mutant protein was expressed at wild-type levels (data not shown). Thus, the N-terminal region of Lte1 containing the GEFN motif is dispensable for Lte1 function in vivo. Surprisingly, deletion of the conserved C-terminal region harbouring the presumed GEF activity still allowed mutant proteins to partially complement the lte1{Delta} cold-sensitivity (see Discussion).

We next examined the subcellular localisation of the Lte1 mutant proteins. Interestingly, we found that the N-terminal Lte1 fragment (1-984) was able to localise to the cortex upon GAL1 overproduction, albeit with reduced efficiency. By contrast, the C-terminal fragments (801-1435), (922-1435) and (984-1435) were delocalised throughout the cell at all stages of the cell cycle (Fig. 7B). Further analysis identified a minimal region, spanning residue 300-984, in Lte1 sufficient to mediate weak cortical attachment, suggesting that it harbours a cortical docking site. However, microscopic examination of mutants such as Lte1{Delta}N157 and Lte1{Delta}C1334 expressed at endogenous level revealed that both proteins localised predominantly to the cytoplasm. Therefore, both the N-terminal and C-terminal regions are required to mediate efficient/stable attachment of Lte1 to the cortex (Fig. 7B). In support of their cooperation, we have detected an interaction between the N-terminal region (1-984) and the C-terminal domain ({Delta}N1133) of Lte1 by two-hybrid analysis (data not shown). This interaction was further confirmed in vitro with purified Lte1 fragments using pulldown assays (Fig. 7C), suggesting that the interaction is of physiological relevance.


    Discussion
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Lte1 localisation depends on Cdc42 activity
Spatial regulation of proteins is fundamental to many biological processes. Recent work has highlighted the importance of spatial regulation of Lte1 in mitotic exit control (Bardin et al., 2000Go).

Here we have explored how the asymmetric recruitment of Lte1 to the daughter cell cortex is coupled to intrinsic cell cycle events. We show that activation of Cdc28/Cln kinase at START triggers the localisation of Lte1 to the incipient bud site (Fig. 1A,B). Our data suggest that Cdc28/Cln kinase has at least two functions in promoting Lte1 cortical establishment. One function is to activate Cdc42, as cdc42ts cells are unable to recruit Lte1 to the cell cortex (Fig. 3B). Cdc42 has previously been implicated in control of mitotic events (Richman et al., 1999Go; Tjandra et al., 1998Go) but this reveals a so-far unknown link between Cdc42 function at bud emergence and mitotic exit. That the localisation depends on functional Cdc42 is supported by the fact that mutation of downstream effector proteins Gic1 and Gic2 result in a failure to localise Lte1 to the site of polarisation at the restrictive temperature (Fig. 3C). Whether Lte1 forms a direct association with Gic1/2 is unclear. However, Gic1/2 are clearly not the only way of targeting Lte1. Firstly, in gic{Delta}1gic2{Delta} mutants Lte1 is efficiently localised to the bud site at the permissive temperature. Secondly, Gic2 is degraded shortly after bud emergence and is absent at later stages of the cell cycle (Jaquenoud et al., 1998Go), implying that Gic2 is not required to maintain Lte1 at the cortex. Thus, Gic1/2-independent mechanisms must exist to localise Lte1 at the bud tip. One possibility is that other Cdc42 effectors such as the PAK-like kinases including Cla4, Ste20 and Skm1, can regulate Lte1 localisation. Genetic interactions between these two classes of Cdc42 effectors have been observed (Chen et al., 1997Go; Drees et al., 2001Go), suggesting they share overlapping functions. Alternatively, Cdc42-interacting proteins Msb3 and Msb4, which are partly redundant with the Gic1/2 pathway (Bi et al., 2000Go), may be involved. The recruitment of Lte1 at the cortex does not require proteins immediately downstream of Gic1/2 such as Bni1 or Bud6 (Fig. 3D). In fact, it appears to be independent of a polarised actin cytoskeleton or an intact secretory pathway, as it occurs in the presence of the actin polymerisation antagonist LatB and in sec18-1 mutants at the restrictive temperature (Fig. 1A, Fig. 2A). Yet, we cannot exclude the possibility that actin to some extent contributes to the maintenance of Lte1 at the cortex.

Activation of Cdc42 in late G1 also triggers the assembly of a septin ring at the bud site independently from actin polarisation (Ayscough et al., 1997Go). We observed that disruption of the septin ring completely abolished the asymmetric localisation of Lte1 (Fig. 2D). The reason for this is unclear at present. The altered actin stability in septin mutants (Barral et al., 2000Go) is unlikely to account for the loss of Lte1 from the daughter cell (see above). A septin-mediated diffusion barrier has been reported to maintain asymmetric distribution of proteins such as Myo2, Sec3 and Spa2 (Barral et al., 2000Go). We propose that septins regulate Lte1 in a similar way. Therefore, mutations that affect septin integrity would also indirectly cause Lte1 mislocalisation.

Despite similarities in localisation requirements, Lte1 does not have as dramatic effects on the actin cytoskeleton as Gic1/2, Bud6 and Bni1 proteins. The actin network appears largely unaffected in lte1{Delta} mutants, and they retain the ability to respond proficiently to mating pheromone (data not shown). Also, overexpression of LTE1 cannot rescue the shmoo defect of the gic1{Delta} gic2{Delta} double mutant as observed for Bud6 and Bni1 (Jaquenoud and Peter, 2000Go) (data not shown).

Intriguingly, Lte1 also localised to the tips of polarised cell surface projections formed when cells were stimulated with mating pheromone. This reinforces the conclusion that Lte1 becomes concentrated to sites of polarised cell growth. However, the presence of Far1 inhibits Cdc28/Cln activity in mating cells, so unlike the budding cycle Cdc28 activity is not required for Lte1 localisation in the mating pathway. How Lte1 distribution is regulated in response to mating signals remains to be determined. The specific polarised sequestration of Lte1 suggests that it may have a so-far unidentified role in mating. Intriguingly, we have identified Kel1, a kelch-domain containing protein, in a two-hybrid analysis with Lte1 (our unpublished observations). This association was also reported in a recent large-scale protein complex analysis (Gavin et al., 2002Go). Kel1 is a cortical protein involved in polarisation, and it is important for cell fusion during mating (Philips and Herskowitz, 1998Go). We were unable to detect any inter-dependency in their cortical localisation. Surprisingly, however, we observed that deletion of KEL1 rescued the cold-sensitivity of the lte1{Delta} mutant. The connection between Lte1 and Kel1 is currently under investigation.

Dephosphorylation of Lte1 by Cdc14 triggers its release from the cortex
Lte1 is phosphorylated in a cell-cycle-dependent manner with a profile that mirrors the kinetics of its cortical association (Fig. 1A, Fig. 6A). Phosphorylation is clearly a key regulatory step in Lte1 localisation. We find that ectopic expression of the Cdc14 phosphatase in metaphase-arrested cells is sufficient to trigger the premature release of Lte1 from the cortex into the cytoplasm (Fig. 4A). Coincident with cortical release, Lte1 becomes dephosphorylated, suggesting that the effect is direct (Fig. 5A). In support of this, we find that purified Cdc14 can dephosphorylate Lte1 in vitro, identifying Lte1 as a novel target of Cdc14 (Fig. 5C). By contrast, premature inactivation of mitotic Cdc28 kinase in metaphase-arrested cells, either by overproduction of the Cdk inhibitor Sic1 (Fig. 4B) or through use of cdc28ts alleles (data not shown), was not sufficient to alter the phosphorylation status of Lte1. Nevertheless, preventing activation of Cdc28/Clb kinase during the cell cycle prevented the formation of certain hyperphosphorylated species of Lte1 (Fig. 6B). The role of this particular phosphorylation is not clear. So, only once established, Cdc28 activity is no longer required to maintain Lte1 phosphorylation. Similarly, inactivation of mitotic Cdc28 activity had only a moderate effect on Lte1 localisation in cells arrested by nocodazole (Fig. 4B). In some 20% of cells Lte1 signal was lost from the cortex so we cannot rule out the possibility that sustained Cdc28 activity, either directly or indirectly, plays a somewhat minor role in maintaining Lte1 at the cortex.

Cdc14 may regulate other aspects of Lte1 function in addition to its cortical localisation. We have previously shown that the mitotic phosphorylation of Lte1 is reduced in cdc5-1 mutants at the restrictive temperature (Lee et al., 2001bGo). In the course of this study, we found that Lte1 localisation is largely unperturbed in cdc5-1 mutants (data not shown), suggesting that Cdc5-dependent phosphorylation is not required for Lte1 localisation. Recently, Cdc5 was shown to phosphorylate Bfa1, which presumably inhibits the Bub2/Bfa1 GAP activity (Hu et al., 2001Go). Dephosphorylation of Bfa1 by Cdc14 at the end of mitosis reverses this effect, presumably leading to the inactivation of the MEN (Pereira et al., 2002Go). Whether Cdc5 and/or Cdc14 modulate the exchange activity of Lte1 is unclear.

Lte1 is phosphorylated by Cdc28 kinase
A second role of Cdc28/Cln in Lte1 function in addition to Cdc42 activation can be deduced from the observation that activation of Cdc42 in the absence of Cdc28 activity is not sufficient to drive Lte1 to the polarisation sites (Fig. 6E). In addition to its requirement for Lte1 localisation (Fig. 1B, Fig. 3A), Cdc28 is required to phosphorylate Lte1. In cdc28ts mutants at the restrictive temperature, in cells depleted for G1 cyclins (our unpublished observations) and in {alpha}-factor-arrested cells (Fig. 6A), Lte1 is present in an unphosphorylated state. Several lines of evidence suggest that Lte1 is a physiological substrate for Cdc28. First, we were able to efficiently phosphorylate a fragment of Lte1 in vitro with purified Cdc28 kinase complexed with either Cln or Clb cyclins (Fig. 6C). Second, mutating 5 Cdk consensus sites in Lte1 significantly reduced this phosphorylation in vitro (Fig. 6C). Third, inactivation of Cdc28/Clb kinase in synchronised cells resulted in an altered Lte1 phosphorylation pattern (Fig. 6B). Finally, and most importantly, mutation of five Cdk sites in Lte1 significantly reduced the cell-cycle-dependent phosphorylation in vivo (Fig. 6D). The mutations did not affect the ability of the protein to localise asymmetrically to the bud cortex. However, the residual phosphorylation of the Lte1Cdk mutant fluctuates in a cell-cycle-dependent manner consistent with its localisation profile. The Cdk sites phosphorylated by Cdc28 in vitro all reside in the minimal Lte1 fragment that can be targeted to the cortex (Fig. 7A). As Cdc28-dependent phosphorylation is still observed in the Lte1Cdk fragment in vitro (Fig. 6C) it is possible that the remaining phosphorylation of the Lte1Cdk mutant in vivo is attributable to Cdc28. However, we cannot rule out the possibility that other kinases may contribute to Lte1 phosphorylation.

It is possible that Cdc28/Cln phosphorylates additional proteins involved in establishing polarised localisation of Lte1. However, taken together, our data favour a scenario where Cdc28 via phosphorylation primes Lte1 for recruitment to the cortex in a Cdc42-dependent step. Once established Lte1 is maintained at the bud tip until Cdc14 is activated and released from the nucleolus in mitosis. This scenario is consistent with the similar kinetics of Lte1 phosphorylation and localisation and with the timing of Cdc28 and Cdc14 activation.

Cortical attachment requires both the N- and C-terminal domains in Lte1
In this study we have reported an investigation of the domain structure of Lte1 aimed at defining regions critical for its localisation. In addition, we performed a functional analysis of the domains.

Studies of the exchange factor activity of Cdc25 have shown that the well conserved C-terminal catalytic domain suffices for catalytic activity (Lai et al., 1993Go). In the case of Lte1 we find that the C-terminal domain is not critical at least for some functions as Lte1{Delta}C1270 and Lte1{Delta}C1334 mutants are able to support growth of the lte1{Delta} mutant at 14°C albeit less efficiently than wild-type (Fig. 7A). This finding is unexpected, as the cold-sensitivity of lte1{Delta} is believed to reflect the absence of its GEF activity. It is possible that our mutants retain sufficient GEF activity or alternatively that the cold-sensitivity can be partly suppressed by a separate function of Lte1, unrelated to its GEF activity. The C-terminal region on its own is not able to complement the lte1{Delta} phenotype even at high dosage. In addition, we have been unable to detect exchange activity associated with bacterially produced Lte1 (984-1435) fragment, comprising the GEF domain using the Tem1 filter binding assay recently described (Geymonat et al., 2002Go) (data not shown). Therefore, unlike Cdc25, other regions in Lte1 in addition to the GEF domain may be required for activity or modification such as phosphorylation may be necessary.

We were intrigued by the presence of a GEFN motif, a domain found in a subset of guanine nucleotide exchange factors for Ras-like small GTPases. In the case of Sos, the GEF for human Ras, the motif appears to have a purely structural role (Boriack-Sjodin et al., 1998Go). Usually the domain is located just upstream of the catalytic GEF (or Cdc25-like) domain. In Lte1, however, it is separated by a significant distance from the C-terminal GEF (Fig. 7A). Although progressive N-terminal deletion of Lte1 revealed that the first 300 residues are dispensable for the ability to complement the lte1{Delta} cold-sensitivity, we find that the N-terminus does interact with the C-terminal GEF domain in two-hybrid screens and in vitro (Fig. 7C). This association is likely to be of structural importance as mutants lacking either the N-terminus or C-terminus fail to localise efficiently to the cortex but remain cytoplasmic throughout the cell cycle (Fig. 7B).

Therefore, in addition to phosphorylation Lte1 requires the presence of both the N-terminal and C-terminal domains to efficiently localise to the cortex. The connection between these requirements is not clear. One attractive model is that phosphorylation regulates the intrameric association of the two domains, thereby facilitating Lte1 attachment to the cortex. Detailed structure-function studies should allow this hypothesis to be tested in the future.


    Acknowledgments
 
We are grateful to Rong Li, John Diffley, Mathias Peter, Danny Lew and Steve Ley for providing reagents. We would like to thank Geoffroy de Bettignies, Steve Sedgwick and members of the Millar lab for critical reading of the manuscript and for invaluable discussions. We would also like to thank the Delta Vision facility for help with microscopy. S.J. was in part supported by a fellowship from the Danish Medical Research Council.


    References
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

Ayscough, K. R., Stryker, J., Pokala, N., Sanders, M., Crews, P. and Drubin, D. G. (1997). High rates of actin filament turnover in budding yeast and roles for actin in establishment and maintenance of cell polarity revealed using the actin inhibitor latrunculin-A. J. Cell Biol. 137,399 -416.[Abstract/Free Full Text]

Bardin, A. J. and Amon, A. (2001). Men and sin: what's the difference? Nat. Rev. Mol. Cell Biol. 2, 815-826.[CrossRef][Medline]

Bardin, A. J., Visintin, R. and Amon, A. (2000). A mechanism for coupling exit from mitosis to partitioning of the nucleus. Cell 102, 21-31.[CrossRef][Medline]

Barral, Y., Mermall, V., Mooseker, M. S. and Snyder, M. (2000). Compartmentalization of the cell cortex by septins is required for maintenance of cell polarity in yeast. Mol. Cell 5,841 -851.[CrossRef][Medline]

Bi, E., Chiavetta, J. B., Chen, H., Chen, G. C., Chan, C. S. and Pringle, J. R. (2000). Identification of novel, evolutionarily conserved Cdc42p-interacting proteins and of redundant pathways linking Cdc24p and Cdc42p to actin polarization in yeast. Mol. Biol. Cell 11,773 -793.[Abstract/Free Full Text]

Bobola, N., Jansen, R. P., Shin, T. H. and Nasmyth, K. (1996). Asymmetric accumulation of Ash1p in postanaphase nuclei depends on a myosin and restricts yeast mating-type switching to mother cells. Cell 84,699 -709.[CrossRef][Medline]

Boriack-Sjodin, P. A., Margarit, S. M., Bar-Sagi, D. and Kuriyan, J. (1998). The structural basis of the activation of Ras by Sos. Nature 394,337 -343.[CrossRef][Medline]

Chant, J. (1999). Cell polarity in yeast. Annu. Rev. Cell Dev. Biol. 15,365 -391.[CrossRef][Medline]

Chen, G. C., Kim, Y. J. and Chan, C. S. (1997). The Cdc42 GTPase-associated proteins Gic1 and Gic2 are required for polarized cell growth in Saccharomyces cerevisiae. Genes Dev. 11,2958 -2971.[Abstract/Free Full Text]

Donovan, J. D., Toyn, J. H., Johnson, A. L. and Johnston, L. H. (1994). P40SDB25, a putative CDK inhibitor, has a role in the M/G1 transition in Saccharomyces cerevisiae. Genes Dev. 8,1640 -1653.[Abstract/Free Full Text]

Drees, B. L., Sundin, B., Brazeau, E., Caviston, J. P., Chen, G. C., Guo, W., Kozminski, K. G., Lau, M. W., Moskow, J. J., Tong, A. et al. (2001). A protein interaction map for cell polarity development. J. Cell Biol. 154,549 -571.[Abstract/Free Full Text]

Frenz, L. M., Lee, S. E., Fesquet, D. and Johnston, L. H. (2000). The budding yeast Dbf2 protein kinase localises to the centrosome and moves to the bud neck in late mitosis. J. Cell Sci. 113,3399 -3408.[Abstract]

Gavin, A. C., Bosche, M., Krause, R., Grandi, P., Marzioch, M., Bauer, A., Schultz, J., Rick, J. M., Michon, A. M., Cruciat, C. M. et al. (2002). Functional organization of the yeast proteome by systematic analysis of protein complexes. Nature 415,141 -147.[CrossRef][Medline]

Geymonat, M., Spanos, A., Smith, S. J. M., Wheatley, E., Rittinger, K., Johnston, L. H. and Sedgwick, S. G. (2002). Control of mitotic exit in budding yeast: in vitro regulation of Tem1 GTPase by Bub2 and Bfa1. J. Biol. Chem. 277,28439 -28445.[Abstract/Free Full Text]

Gulli, M. P., Jaquenoud, M., Shimada, Y., Niederhauser, G., Wiget, P. and Peter, M. (2000). Phosphorylation of the Cdc42 exchange factor Cdc24 by the PAK-like kinase Cla4 may regulate polarized growth in yeast. Mol. Cell 6,1155 -1167.[CrossRef][Medline]

Guthrie, C. and Fink, G. R. (1991). Methods in Enzymology. Guide to Yeast Genetics and Molecular Biology. San Diego, California: Academic Press, Inc.

Hu, F., Wang, Y., Liu, D., Li, Y., Qin, J. and Elledge, S. J. (2001). Regulation of the Bub2/Bfa1 GAP complex by Cdc5 and cell cycle checkpoints. Cell 107,655 -665.[CrossRef][Medline]

Jaquenoud, M. and Peter, M. (2000). Gic2p may link activated Cdc42p to components involved in actin polarization, including Bni1p and Bud6p (Aip3p). Mol. Cell. Biol. 20,6244 -6258.[Abstract/Free Full Text]

Jaquenoud, M., Gulli, M. P., Peter, K. and Peter, M. (1998). The Cdc42p effector Gic2p is targeted for ubiquitin-dependent degradation by the SCFGrr1 complex. EMBO J. 17,5360 -5373.[CrossRef][Medline]

Jensen, S., Segal, M., Clarke, D. J. and Reed, S. I. (2001). A novel role of the budding yeast separin Esp1 in anaphase spindle elongation: evidence that proper spindle association of Esp1 is regulated by Pds1. J. Cell Biol. 152, 27-40.[Abstract/Free Full Text]

Jin, H. and Amberg, D. C. (2000). The secretory pathway mediates localization of the cell polarity regulator Aip3p/Bud6p. Mol. Biol. Cell 11,647 -661.[Abstract/Free Full Text]

Johnson, D. I. (1999). Cdc42: An essential Rho-type GTPase controlling eukaryotic cell polarity. Microbiol. Mol. Biol. Rev. 63,54 -105.[Abstract/Free Full Text]

Keng, T., Clark, M. W., Storms, R. K., Fortin, N., Zhong, W., Ouellette, B. F., Barton, A. B., Kaback, D. B. and Bussey, H. (1994). LTE1 of Saccharomyces cerevisiae is a 1435 codon open reading frame that has sequence similarities to guanine nucleotide releasing factors. Yeast 10,953 -958.[CrossRef][Medline]

Kramer, K. M., Fesquet, D., Johnson, A. L. and Johnston, L. H. (1998). Budding yeast RSI1/APC2, a novel gene necessary for initiation of anaphase, encodes an APC subunit. EMBO J. 17,498 -506.[CrossRef][Medline]

Labib, K., Diffley, J. F. and Kearsey, S. E. (1999). G1-phase and B-type cyclins exclude the DNA-replication factor Mcm4 from the nucleus. Nat. Cell Biol. 1, 415-422.[CrossRef][Medline]

Lai, C. C., Boguski, M., Broek, D. and Powers, S. (1993). Influence of guanine nucleotides on complex formation between Ras and CDC25 proteins. Mol. Cell. Biol. 13,1345 -1352.[Abstract/Free Full Text]

Lee, S. E., Frenz, L. M., Wells, N. J., Johnson, A. L. and Johnston, L. H. (2001a). Order of function of the budding-yeast mitotic exit-network proteins Tem1, Cdc15, Mob1, Dbf2, and Cdc5. Curr. Biol. 11,784 -788.[CrossRef][Medline]

Lee, S. E., Jensen, S., Frenz, L. M., Johnson, A. L., Fesquet, D. and Johnston, L. H. (2001b). The Bub2-dependent mitotic pathway in yeast acts every cell cycle and regulates cytokinesis. J. Cell Sci. 114,2345 -2354.[Abstract/Free Full Text]

Lew, D. J. and Reed, S. I. (1995). Cell cycle control of morphogenesis in budding yeast. Curr. Opin. Genet. Dev. 5,17 -23.[CrossRef][Medline]

Mah, A. S., Jang, J. and Deshaies, R. J. (2001). Protein kinase Cdc15 activates the Dbf2-Mob1 kinase complex. Proc. Natl. Acad. Sci. USA 98,7325 -7330.[Abstract/Free Full Text]

Morgan, D. O. (1999). Regulation of the APC and the exit from mitosis. Nat. Cell Biol. 1, E47-E53.[CrossRef][Medline]

Nasmyth, K. (1993). Control of the yeast cell cycle by the Cdc28 protein kinase. Curr. Opin. Cell Biol. 5,166 -179.[CrossRef][Medline]

Pereira, G., Hofken, T., Grindlay, J., Manson, C. and Schiebel, E. (2000). The Bub2p spindle checkpoint links nuclear migration with mitotic exit. Mol. Cell 6, 1-10.[CrossRef][Medline]

Pereira, G., Manson, C., Grindlay, J. and Schiebel, E. (2002). Regulation of the Bfa1p-Bub2p complex at spindle pole bodies by the cell cycle phosphatase Cdc14p. J. Cell Biol. 157,367 -379.[Abstract/Free Full Text]

Philips, J. and Herskowitz, I. (1998). Identification of Kel1p, a kelch domain-containing protein involved in cell fusion and morphology in Saccharomyces cerevisiae. J. Cell Biol. 143,375 -389.[Abstract/Free Full Text]

Richardson, H. E., Wittenberg, C., Cross, F. and Reed, S. I. (1989). An essential G1 function for cyclin-like proteins in yeast. Cell 59,1127 -1133.[CrossRef][Medline]

Richman, T. J., Sawyer, M. M. and Johnson, D. I. (1999). The Cdc42p GTPase is involved in a G2/M morphogenetic checkpoint regulating the apical-isotropic switch and nuclear division in yeast. J. Biol. Chem. 274,16861 -16870.[Abstract/Free Full Text]

Schwab, M., Lutum, A. S. and Seufert, W. (1997). Yeast Hct1 is a regulator of Clb2 cyclin proteolysis. Cell 90,683 -693.[CrossRef][Medline]

Shirayama, M., Matsui, Y., Tanaka, K. and Toh-e, A. (1994a). Isolation of a CDC25 family gene, MSI2/LTE1, as a multicopy suppressor of ira1. Yeast 10,451 -461.[CrossRef][Medline]

Shirayama, M., Matsui, Y. and Toh, E. A. (1994b). The yeast TEM1 gene, which encodes a GTP-binding protein, is involved in termination of M phase. Mol. Cell. Biol. 14,7476 -7482.[Abstract/Free Full Text]

Shou, W., Seol, J. H., Shevchenko, A., Baskerville, C., Moazed, D., Chen, Z. W., Jang, J., Charbonneau, H. and Deshaies, R. J. (1999). Exit from mitosis is triggered by Tem1-dependent release of the protein phosphatase Cdc14 from nucleolar RENT complex. Cell 97,233 -244.[CrossRef][Medline]

Stegmeier, F., Visintin, R. and Amon, A. (2002). Separase, polo kinase, the kinetochore protein Slk19, and Spo12 function in a network that controls Cdc14 localization during early anaphase. Cell 108,207 -220.[CrossRef][Medline]

Takizawa, P. A., DeRisi, J. L., Wilhelm, J. E. and Vale, R. D. (2000). Plasma membrane compartmentalization in yeast by messenger RNA transport and a septin diffusion barrier. Science 290,341 -344.[Abstract/Free Full Text]

Tjandra, H., Compton, J. and Kellogg, D. (1998). Control of mitotic events by the Cdc42 GTPase, the Clb2 cyclin and a member of the PAK kinase family. Curr. Biol. 8,991 -1000.[CrossRef][Medline]

Visintin, R., Craig, K., Hwang, E. S., Prinz, S., Tyers, M. and Amon, A. (1998). The phosphatase Cdc14 triggers mitotic exit by reversal of Cdk-dependent phosphorylation. Mol. Cell 2,709 -718.[CrossRef][Medline]

Visintin, R., Hwang, E. S. and Amon, A. (1999). Cfi1 prevents premature exit from mitosis by anchoring Cdc14 phosphatase in the nucleolus. Nature 398,818 -823.[CrossRef][Medline]

Wach, A., Brachat, A., Pohlmann, R. and Philippsen, P. (1994). New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10,1793 -1808.[CrossRef][Medline]

Yoshida, S., Asakawa, K. and Toh, E. A. (2002). Mitotic Exit Network controls the localization of Cdc14 to the spindle pole body in Saccharomyces cerevisiae. Curr. Biol. 12,944 -950.[CrossRef][Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?

Related articles in JCS:

Mitotic exit networking

JCS 2002 115: 2404. [Full Text]  




This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Related articles in JCS
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Jensen, S.
Right arrow Articles by Johnston, L. H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Jensen, S.
Right arrow Articles by Johnston, L. H.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?