|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
doi: 10.1242/10.1242/jcs.00189
Research Article |
1 Division of Yeast Genetics, National Institute for Medical Research, The
Ridgeway, Mill Hill, London NW7 1AA, UK
2 Department of Genetics, University of Cambridge, Downing Street, Cambridge CB2
3EH, UK
* Author for correspondence (e-mail: ljohnst{at}nimr.mrc.ac.uk)
Accepted 22 September 2002
| Summary |
|---|
|
|
|---|
Finally, we report a mutational analysis undertaken to investigate intrinsic Lte1 determinants for localisation. Our data suggest that an intrameric interaction between the N-and C-terminal regions of Lte1 is important for cortex association.
Key words: Cell cycle, Mitotic exit, Polarity, Cdc14, Budding yeast
| Introduction |
|---|
|
|
|---|
As the ultimate inducer of mitotic exit, Cdc14 itself is tightly regulated.
Its activity is inhibited through binding to Net1/Cfi1, which sequesters Cdc14
in the nucleolus for most of the cell cycle
(Shou et al., 1999
;
Visintin et al., 1999
). Early
in anaphase a pool of Cdc14 is released through the action of the so-called
FEAR network, comprising proteins such as the separase Esp1, Slk19, Spo12 and
the polo-like kinase Cdc5 (Stegmeier et
al., 2002
; Yoshida et al.,
2002
). This initial wave of liberated Cdc14 sets off a positive
feedback loop by activating the mitotic exit network (MEN), which is required
for the complete and sustained release of Cdc14 from the nucleolus
(Stegmeier et al., 2002
;
Pereira et al., 2002
).
A key upstream component of the MEN is Tem1, a GTPase belonging to the Ras
superfamily (Shirayama et al.,
1994b
). Activation of Tem1 triggers a signalling cascade, which
includes several protein kinases such as Cdc15, Dbf2 and Dbf20. Cdc5 is also a
member of the MEN but its precise role is complex as it impinges on the
pathway both upstream and downstream of Tem1
(Bardin and Amon, 2001
;
Mah et al., 2001
;
Lee et al., 2001a
;
Hu et al., 2001
).
Given the central position of Tem1 in the MEN its regulation is pivotal for
control of mitotic exit. Bub2 and Bfa1, which form a bipartite GAP, function
to downregulate Tem1 activity (Geymonat et
al., 2002
). By contrast, Lte1, which has homology to the Cdc25
family of guanine-nucleotide exchange factors, is presumed to activate Tem1
(Keng et al., 1994
;
Shirayama et al., 1994b
).
Defects in LTE1 cause cells to arrest at telophase at low
temperatures (Shirayama et al.,
1994a
). In fact, TEM1 was originally isolated as a
high-copy suppressor of the cold-sensitive phenotype of an lte1
mutant (Shirayama et al.,
1994b
). The high intrinsic exchange activity of Tem1 recently
reported may explain why Lte1 is dispensable for viability at higher
temperatures (Geymonat et al.,
2002
). Also, Bub2 and Bfa1 are non-essential components in an
unperturbed cell cycle. However, in situations where spindle position is
compromised, Bub2 and Bfa1, as part of the spindle orientation checkpoint,
become essential to restrain Tem1 activity and delay mitotic exit. In the
absence of Bub2 or Bfa1, mutants such as dhc1 and kar9,
which display spindle orientation defects, proceed with mitosis regardless of
spindle position (Bardin et al.,
2000
; Pereira et al.,
2000
).
Recent work suggests that the subcellular distribution of Tem1 and Lte1
holds the key to how the spatial information on spindle position is integrated
with the mitotic exit machinery. Whereas Tem1, like most of the MEN
components, localises preferentially to the SPB destined for the daughter
cell, Lte1 is confined to the bud periphery
(Bardin et al., 2000
;
Pereira et al., 2000
). In this
way, Tem1 activation by Lte1 is prevented until SPB movement into the daughter
cell has occurred, thereby coupling mitotic exit with completion of chromosome
segregation. Consistent with this model, overproduction of Lte1 driving it
into the mother cell leads to premature mitotic exit in dhc1 mutants,
resulting in the formation of multinucleate and anucleate cells
(Bardin et al., 2000
). However,
LTE1 overexpression is not lethal in wild-type cells, suggesting that
additional mechanisms must exist to control mitotic exit.
The unique asymmetric division of budding yeast is based on a complex
spatial regulation of secretion and cell polarity
(Chant, 1999
). Activation of
the major Cdk, Cdc28, by G1 cyclins Cln1-3 at START promotes bud site assembly
(Lew and Reed, 1995
). This is
achieved by targeted activation of Cdc42, a Rho-like GTPase, which through
association with numerous effectors including the PAK-like kinases and the
Gic1/2 proteins recruit components involved in actin polarisation to the newly
designated bud site (Johnson,
1999
). Both actin-dependent and -independent pathways are deployed
in polarised bud growth. At present, it is unclear how spatial control of Lte1
is coupled to the polarity establishment machinery.
To date very little is known about the regulation of Lte1. Although Lte1
protein levels do not fluctuate during the cell cycle, the protein exhibits
cell-cycle-dependent phosphorylation
(Bardin et al., 2000
;
Lee et al., 2001b
). The
precise role of this modification is not understood.
To gain insight into the regulation of Lte1 we set out to examine the pathways that contribute to its asymmetric distribution. Here we reveal a dual requirement for Cdc28/Cln activity in recruitment of Lte1 to the bud cortex. Firstly, Cdc28 is required to activate the Cdc42 GTPase, which is essential to establish Lte1 at the incipient bud site. However, Cdc42 activation in the absence of Cdc28 activity is not sufficient to target Lte1 to the cortex, suggesting an additional role for Cdc28. We provide evidence that Cdc28 directly phosphorylates Lte1. Also, we show that Cdc14 phosphatase activity triggers the dephosphorylation and concomitant release of Lte1 from the bud cortex. Taken together our results suggest that Cdc28-dependent phosphorylation of Lte1 dictates its asymmetric localisation. Finally, a structure-function analysis of Lte1 reveals that both the N- and C-terminal domains are required for its localisation to the bud cortex.
| Materials and Methods |
|---|
|
|
|---|
ns ade1 his2 leu2-3,
112 trp1-1a (Richardson et
al., 1989
|
Plasmids
The integrative pKGFP plasmid, which carries the KANR marker for
G418 resistance, was used to fuse the endogenous Lte1 protein to the GFP
epitope (F64L, S65T, Q80R mutant). A SalI-NotI fragment
spanning the last 600 bases of the LTE1 gene was inserted into pKGFP
cut with SalI and NotI. The plasmid was linearised with
AflII, and integrants were isolated by selecting for G418 resistance.
The parental pKGFP plasmid has been described previously
(Jensen et al., 2001
).
The LTE1HA3-pTRP1 and LTE1HA3-pKAN plasmids were used to tag the endogenous
Lte1 protein with 3HA epitopes at the C-terminus. These integrative plasmids
carry the sequence encoding 3 HA epitopes, which can be fused to a protein of
interest (Jensen et al.,
2001
). The plasmids were linearised with AflII and
integrants isolated by selecting for growth on dex-trp or resistance to G418,
respectively.
The CFP-TUB1 plasmid has been described previously
(Jensen et al., 2001
). Plasmid
pCDC14-EMBLYex4 was used to express 6Histagged Cdc14 under the control of
GAL1-inducible promoter. Plasmid pLD1 used to express a
non-degradable version of Sic1 (Sic1
N) from the GAL1-inducible
promoter has been described previously
(Labib et al., 1999
).
LTE1-pRSG is an integrative plasmid carrying the LTE1 open reading
frame (ORF) under the control of the GAL1 promoter. It was generated
by inserting a BamHI PCR fragment into the pRSG plasmid
(Jensen et al., 2001
). A
SmaI site was inserted just before the stop codon allowing in-frame
insertion of three HA or GFP epitope tags. Truncation mutants of Lte1 were
cloned into this plasmid. All pRSG-derived plasmids were linearised with
StuI and integrants isolated by selecting for growth on dex-ura
media.
Plasmid LTE1-YIplac128 was made by inserting the LTE1 promoter
sequence and ORF into the integrative plasmid YIplac128. A 500 basepair
XhoI-SalI PCR fragment of the promoter sequence was inserted
into YIplac128 cut open with SalI. A SalI-KpnI
fragment spanning the LTE1 ORF was subsequently introduced into
SalI and KpnI. A SmaI site was included in the
oligomer to allow the in-frame insertion of a three HA or GFP tag at the
C-terminus. The plasmid was digested with ClaI prior to
transformation and integrants isolated by selecting for growth on dex-leu
media. Plasmids LTE1(
N157)-, LTE1(
N300)-, LTE1(
N360)-,
LTE1(
C1270)- and LTE1(
C1334)-YIplac128 were designed to allow
expression of Lte1 truncation mutants at endogenous level.
Plasmid LTE1Cdk-YIplac128 was generated by several rounds of mutagenic PCR. The mutagenic oligos used were: 5' TGCCTCCAGCACCGGCTAAAAAAGTTGAATTTATTCTGAACTCCTTA 3' (T317A mutation shown in bold; underlined base indicates a silent mutation eliminating the EcoRI site), 5' CAGAGGCGCAGAAGTCATGCTTTTTTGGGATTGGGAATGATTTTTCCTCCTTGGTGCCATATTTGTA 3' (T614A and S630A mutations shown in bold), 5' TCATCCAGCGCTCCACCCAGAGAT 3' (S667A mutation shown in bold), 5' GACTTGTTTTGCTCAGGGTCTACTATGGATAACTCTTTGGTTGGTGCTATGGCAATG 3' (T793A mutation shown in bold; underlined base indicates a silent mutation eliminating the BstYI site). The PCR fragments were cloned into plasmid LTE1-YIplac128 as described above.
To create GST-Lte1 (300-845), a PCR-generated HindIII fragment covering residues 300-845 was cloned into pGEX-KG vector digested with HindIII allowing in-frame fusion with GST. To create MBP-Lte1(1-500). a PCR-generated BamHI fragment spanning residues 1-500 was introduced after the maltose-binding domain in pMA1-2C vector opened with BamHI.
Plasmid GST-Lte1Cdk(300-845) was made by cloning a PCR-generated HindIII fragment based on Lte1Cdk-YIplac128 template into pGEX-2C cut with HindIII.
Plasmid GST-Cdc28-13 was used to express Cdc28-13 kinase from the GAL1-inducible promoter.
All plasmids were subjected to sequencing to verify their integrity. Integrants and deletion mutants were verified by PCR analysis.
Cell biology protocols
Fluorescence microscopy was performed using a Photometrics CH350L liquid
cooled CCD camera on an Olympus IX70 inverted microscope, with a 100x
objective. Cell images were captured and manipulated using SoftWoRx software
(Applied Precision Inc., Issaquah, WA) and Adobe Photoshop version 6.0 (Adobe
Systems Incorp., Mountain View, CA). For live microscopy, cells were grown in
the presence of extra supplement of adenine (0.2 mg/ml). In general, images
were taken of a single focal plane and acquired using 0.5-4 second exposures.
At least 200 cells were counted for each sample.
Yeast actin was visualised with rhodamine-conjugated phalloidin as
previously described (Frenz et al.,
2000
).
Cell cycle synchronization
G0-G1 release experiments were carried out as described previously
(Ayscough et al., 1997
).
G1 arrest of the cln1,2,3
GAL1-CLN3 (SY123) cells was
achieved by repressing CLN3 for 2 hours by growth in
dextrose-containing media. After washing, cells were released by inducing
Cln3p expression in medium containing 2% galactose. Where indicated
latrunculin B (LatB) (Calbiochem, final concentration 250 µg/ml dissolved
in DMSO) or an equivalent amount of DMSO, as a control, was added.
G1 arrest of cln1,2,3
MET-CLN2 LTE1GFP GAL-CDC42G12V
(SY124) cells grown in raffinose containing media was achieved by repressing
expression of Cln2 for 3 hours in selective medium supplemented with 2 mM
methionine. Where indicated either 2% galactose or 2% dextrose was added to
induce or prevent expression of Cdc42 mutant protein for 3 hours prior to
microscopic examination. As a control, arrested cells were washed and released
by inducing Cln2 expression in medium lacking methionine.
For
-factor arrest and release experiments, cells in mid-log phase
were arrested with 3.5 µg/ml
-factor for 3 hours. Cells were
filtered, washed and released into fresh media.
Nocodazole arrest was induced by incubation of mid-log phase cultures with 15 µg/ml nocodazole for 2 hours.
Cell cultures were analysed for DNA content using a FACScan Becton
Dickinson flow cytometer as described previously
(Kramer et al., 1998
).
Lysate preparation and immunoblotting
Cells were broken with glass beads using a Hybaid Ribolyser in NP-40 buffer
(50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.1% NP-40, 10 mM sodium pyrophosphate,
0.1 mM orthovanadate, 1 mM PMSF, 2 mg/ml aprotinin, leupeptin and pepstatin
A). In general, protein was separated on 7.5% gels by SDS-PAGE. For detection
of HA-tagged proteins, the mouse monoclonal antibody 12CA5 (kindly provided by
Steve Ley) was used at a 1:1000 dilution. For detection of His-tagged protein,
the monoclonal anti-RGSHIS antibody (Clontech) was used at 1:1000 dilution.
The polyclonal anti-Sic1 antibody described previously
(Donovan et al., 1994
) was
used at a 1:2000 dilution and the monoclonal anti-TAT1 antibody used to detect
tubulin was used at 1:1000 dilution.
Immunoprecipitation, kinase and phosphatase assays
Clb2-associated kinase activity was measured as previously described
(Kramer et al., 1998
).
Briefly, 250 µg extract was incubated with 0.2 µg rabbit anti-Clb2
antibody (Santa Cruz) for 1 hour at 4°C. 50 µl of pre-washed Protein A
Sepharose beads (50% slurry) was added and incubation continued for 1 hour.
Immunoprecipitates were washed three times with extraction buffer and twice
with kinase buffer (25 mM Mops pH 7.4, 15 mM MgCl2). Immobilized
Cdc28-Clb2 complexes were incubated for 30 minutes at room temperature in a 20
µl reaction mixture containing 100 µM ATP, 5 µg histone H1 and 2
µCi [
-32P] ATP (3000 mCi/mmol) in kinase buffer (50 mM
HEPES-NaOH pH 7.4, 10 mM MgCl2 and 1 mM DTT). Reaction products
were analysed by 12% SDS-PAGE followed by autoradiography.
For immunoprecipitation phosphatase assays, HA-tagged Lte1 was immunoprecipitated from 1 mg cell lysate using 1 µl monoclonal 12CA5 antibody and protein G sepharose (Pharmacia). Following three washes with NP40 lysis buffer and two washes with phosphatase buffer (50 mM imidazole-HCl pH 6.6, 1 mM EDTA, 1 mM DTT), immunoprecipitates were resuspended in 50 µl phosphatase buffer to which 1 µg MBP-Cdc14, 1 µg MBP-Cdc14C283A or 1 µg MBP were added. After incubation for 45 minutes at 30°C, immune complexes were washed twice in lysis buffer and analysed by immunoblotting.
To produce recombinant MBP-Cdc14 and MBP-Cdc14C283A, pMAL-CDC14 and pMAL-CDC14C283A (provided by Prolifix) were transformed into the protease-deficient Escherichia coli BL21 and cells grown to an OD600 of 0.6 before expression of MBP-fusion protein was induced with IPTG (0.1 mM) for 16 hours at 20°C. The recombinant Cdc14 was purified from bacterial lysates on an amylose column (NEB) followed by a desalting column (Pharmacia) as specified by the manufacturer.
To produce Cdc28/Cln2 for kinase assays, cdc53-1 mutant yeast cells containing a dual GAL1-inducible GST-CDC28 CLN2-FLAG plasmid were arrested at restrictive temperature for 2 hours and Cdc28/Cln2 expression induced with galactose for 3 hours. For each pull-down reaction, 500 µg of yeast extracts was incubated at 4°C for 1 hour with 25 µl glutathione-sepharose beads. Beads were washed four times with binding buffer (50 mM Tris-HCl pH 7.5, 250 mM NaCl, 0.5% NP40, 1 mM DTT) and two times with kinase buffer before kinase assays were performed.
Wild-type or Cdk mutant fragments of Lte1 (aa 300-845) fused to GST were produced in E. coli and purified on glutathione sepharose beads according to the manufacturers instructions. Proteins were eluted with 15 mM glutathione and dialysed prior to use.
For Lte1 in vitro binding assay, MBP-Lte1(1-500) was purified from bacterial lysates on amylose resin. 25 µl of eluted and dialysed MBP-Lte1(1-500) protein was used in GST pull-down experiments with either 50 µl GST-Lte1(984-1434) or GST alone purified on glutathione sepharose beads in a final volume of 300 µl binding buffer (50 mM Tris-HCl pH 7.5, 200 mM NaCl). After 1.5 hours incubation at 4°C, beads were washed four times with buffer (50 mM Tris-HCl pH 7.5, 300 mM NaCl, 0.5% NP40, 2 mM DTT), and protein was eluted in buffer (50 mM Tris-HCl pH 7.5, 200 mM NaCl, 0.1% NP40, 1 mM DTT, 15 mM glutathione). Samples were analysed by SDS-PAGE (8% gels) followed by immunoblotting with monoclonal anti-MPB antibody (Clontech).
| Results |
|---|
|
|
|---|
mutant (data not shown), indicating that it encoded a
functional Lte1.
To assess Lte1 distribution across the cell cycle, we used
cln1
cln2
cln3
GAL1-CLN3 cells expressing Lte1GFP
to inactivate Cdc28/Cln activity by Cln3 depletion. Cells were released from
the G1 arrest into the cell cycle by Cln3 reexpression in the presence of
galactose. Upon G1 arrest, Lte1GFP signal was predominantly cytoplasmic but
after Cdc28/Cln activation Lte1 formed a patch at the developing bud site and
concomitant with bud emergence the protein became associated with the bud
cortex as previously observed (Bardin et
al., 2000
; Pereira et al.,
2000
). The cortical distribution of Lte1 persisted as buds
enlarged until nuclear division at which point Lte1 was dispersed in the
cytoplasm (Fig. 1A).
|
To determine whether the localisation of Lte1 to the incipient bud site
required an intact actin cytoskeleton, cells were released from a G1 block in
the presence or absence of the actin-depolymerising drug latrunculin B (LatB).
As shown in Fig. 1B, this
treatment did not prevent Lte1 localisation to the cortex. Staining with
rhodamine-phalloidin confirmed that the actin cytoskeleton was indeed
depolarised by LatB treatment (data not shown). Also, when asynchronous cells
were treated with LatB the majority (98%) of small to medium budded cells
maintained Lte1 at the cortex (data not shown). Furthermore, we observed that
Lte1GFP was targeted to the mating projection upon addition of mating
pheromone. As Cdc28/Cln activity is inhibited by the G1 Cdk inhibitor Far1 in
-factor-arrested cells, Lte1 localisation does not require Cdc28
activity in the mating pathway (see Discussion). However, Lte1 is maintained
at the tip of the shmoo by an actin-independent mechanism
(Fig. 1C). We conclude that
neither establishment nor maintenance of Lte1 at the cortex is dependent on
the structural integrity of the actin cytoskeleton.
Finally, we investigated the involvement of microtubules in targeting Lte1 to the cortex. For this purpose, cells were arrested at a late cell-cycle stage induced by a cdc15-1 mutation and treated with nocodazole to destroy microtubules. This treatment did not disrupt the cortical localisation of Lte1 observed in the cdc15-1 mutant (Fig. 1Da-b). When cells were released from the telophase block at 25°C in the presence of nocodazole, Lte1 was relocalised to the bud site in the next cell cycle in the majority of cells (97%) (Fig. 1Dc). Therefore, Lte1 is not targeted to the cortex by either the microtubule or actin network, suggesting the involvement of other determinants at the cortex.
Importance of an intact secretion pathway and septin function in Lte1
localisation
An intact secretion pathway has been implicated in localising bud site
determinants to the cell cortex (Jin and
Amberg, 2000
). To test whether polarised secretion is required to
maintain Lte1 at the bud cortex we assayed its localisation in
sec18-1 mutants. The ability of Lte1 to assemble at the incipient bud
site in unbudded cells and at the daughter cell cortex in budded cells was
largely unaffected by the sec18-1 mutation
(Fig. 2A,B). Therefore, a
functional secretion pathway appears not to be critical for initial
association of Lte1 to the cortex.
|
Recently, septins have been shown to play a role in maintaining cortical
factors in the bud (Barral et al.,
2000
; Takizawa et al.,
2000
). To examine whether septin function was required for Lte1
localisation, wild-type and cdc12-6 cells expressing Lte1GFP were
shifted to 37°C for 20 minutes, which is sufficient to destroy septin
structures. Even at the permissive temperature, Lte1 localisation is
diminished in cdc12-6 cells; however, upon shift to 37°C, Lte1
redistributed equally between mother and bud compartments in more than 60% of
budded cells (Fig. 2C). By
contrast, Lte1 remained concentrated in the bud and excluded from the mother
cell in wild-type cells incubated at 37°C. Introduction of a plasmid-borne
CDC12 gene restored the asymmetric localisation of Lte1 in the
cdc12-6 mutant (Fig.
2D). Lte1 is a phosphoprotein in vivo
(Lee et al., 2001b
) (see
below). Analysis of Lte1 protein in septin mutants showed that neither protein
level nor phosphorylation status was greatly affected
(Fig. 2E). We conclude that
septin integrity is important to restrict Lte1 to the daughter cell
compartment.
Recruitment of Lte1 to incipient bud site depends on Cdc42
activity
To dissect events at the G1 transition important for establishing Lte1 at
the cortex, we investigated Lte1 localisation in a panel of mutants defective
in bud polarisation. Consistent with our data from the Cln-depleted strain
(Fig. 1A), we found that Lte1
failed to localise to the cortex in cdc28-13 mutants arrested in G1
at the restrictive temperature (Fig.
3A). Cdc28/Cln activity triggers activation of the Cdc42 GTPase by
targeting its exchange factor Cdc24 to the plasma membrane. This activation is
required to organise polarity factors and the actin cytoskeleton towards the
incipient bud site (Johnson,
1999
). We found that Lte1 was cytoplasmic in cdc42-1
mutants held at the restrictive temperature
(Fig. 3B), suggesting that
Cdc42 is required to localise Lte1 to the cortex. As DNA replication and the
nuclear division cycle continue in cdc42 mutants despite the block in
bud formation it follows that activation of Cdc28 at START is not sufficient
by itself to target Lte1 to the cortex. By contrast, Cdc24 fused to GFP
localised efficiently in cdc42-1 mutants, as expected
(Fig. 3B). Once Lte1 is
established at the cortex, Cdc42 function is no longer required for its
maintenance, as inactivation of cdc42 after bud emergence had little
effect on Lte1 cortical localisation (data not shown).
|
Activated Cdc42 recruits a number of effectors to the plasma membrane
required for polarised growth. We examined whether the Cdc42 targets Gic1 and
Gic2 were involved in Lte1 localisation. The gic1
gic2
double mutant is conditionally lethal and accumulates as large, unbudded and
multinucleate cells at the restrictive temperature
(Chen et al., 1997
). Lte1GFP
failed to localise to the presumptive bud site in
gic1
gic2
cells held at 37°C
(Fig. 3C). Quantification of
these results revealed that 96% (n=250) of the
gic1
gic2
cells were unable to localise Lte1 at bud
emergence, whereas Cdc24 was found at the bud site in 25% (n=200) of
the cells. Thus, these results imply that the Gic proteins may be involved in
recruiting or stabilising Lte1 at the incipient bud site. It is important to
note, however, that in the few gic1
gic2
cells that were
able to form a bud, Lte1 localised efficiently to bud tips, demonstrating that
the Gic proteins are not the only components capable of localising Lte1 to
sites of polarised growth.
Recently, the Gic proteins were shown to direct Bud6 and the formin Bni1 to
the incipient bud site, underscoring their importance in linking activated
Cdc42 to the cortical actin cytoskeleton
(Jaquenoud and Peter, 2000
).
However, we find that neither Bni1 nor Bud6 is required to establish Lte1 at
the cortex. As shown in Fig.
3D, upon release from a G0 block, Lte1 localised to the
presumptive bud site in bni1
and bud6
mutants
with a similar efficiency to that seen in wild-type cells. Bni1 is necessary
for the asymmetric distribution of the transcription factor Ash1 involved in
mating type switching (Bobola et al.,
1996
). The observation that BNI1 deletion does not cause
mislocalisation of Lte1, as is the case for Ash1, supports the notion that
Lte1 is not transported to the bud tip by a similar actomyosin-driven
mechanism.
Dephosphorylation by Cdc14 phosphatase triggers Lte1 release from bud
cortex
Once Lte1 has been established at the cell cortex at START it is maintained
until late in mitosis (Fig.
1A). We find that Lte1 distribution is unaffected by MEN mutations
(Fig. 1C, cdc15-1,
data for dbf2-2, tem1-3 and cdc5-1 not shown). This argues
that an event downstream of MEN function is required to release Lte1 from the
cortex. This prompted us to explore the effect of Cdc14 activation and mitotic
kinase inactivation on Lte1 distribution. For this purpose, cells containing a
CDC14 gene under the control of a GAL1 promoter were
pre-arrested in metaphase by nocodazole treatment. Overexpression of
CDC14 resulted in the untimely release of Lte1 from the daughter cell
cortex. In more than 80% of arrested cells, Lte1 signal was completely
eliminated from the cortex within 2 hours of induction
(Fig. 4A). By contrast,
overproduction of a Cdc14 phosphatase mutant did not disrupt Lte1 distribution
(data not shown). Overexpression of CDC14 causes hyperaccumulation of
Sic1, which contributes to mitotic Cdk inactivation
(Visintin et al., 1998
). To
examine whether the effect on Lte1 localisation is a consequence of mitotic
kinase inactivation we repeated the experiment with cells overexpressing
SIC1 from the GAL1 promoter. In this case, only
20% of
arrested cells had lost Lte1 signal at the cortex after 2 hours induction
(Fig. 4B). Thus, Cdc14 triggers
dissociation of Lte1 from the cortex by a mechanism that is largely
independent of mitotic kinase inactivation but requires its phosphatase
activity. This suggests that phosphorylation either directly or indirectly is
important for Lte1 localisation.
|
To address this further, we examined the effect of GAL1-CDC14 on the phosphorylation status of Lte1 using a similar experimental approach. We found that ectopic overexpression of CDC14 in metaphase-arrested cells caused a complete elimination of Lte1 phosphorylation with a comparable timing to the loss of cortical Lte1 observed in the previous experiment (Fig. 5A, compare with Fig. 4A). Again, it is evident that Cdc14 does not trigger Lte1 dephosphorylation indirectly simply by decreasing Cdc28 activity. Overexpression of SIC1 had no detectable effect on the phosphorylation status of Lte1. Lte1 remained hyperphosphorylated although mitotic kinase was inactivated within 1 hour of induction (Fig. 5B). Overexpression of GLC7, which encodes a protein phosphatase, does not promote Lte1 dephosphorylation (data not shown). This strongly suggests that the effect on Lte1 phosphorylation is not a consequence of overexpression of a phosphatase per se but is specific to Cdc14.
|
We next tested the ability of Cdc14 to dephosphorylate Lte1 in vitro. Treatment of Lte1 immunoprecipitates prepared from mitotically arrested cells with purified MBP-Cdc14 resulted in a complete collapse of the low mobility forms of Lte1 into a single band (Fig. 5C, lane 2). There was no effect when a catalytically inactive version of Cdc14 (MBP-Cdc14C283A) or MBP alone was added (Fig. 5C, lanes 3-4). Given the timing of Cdc14 activation and its requirement for exit of mitosis, our results suggest that Lte1 is a physiological substrate of Cdc14.
Taken collectively our data support the notion that Cdc14 by dephosphorylating Lte1 in late anaphase triggers its rapid dissociation from the daughter cell cortex.
Lte 1 is phosphorylated by Cdc28 cyclin-dependent kinase
We, and others, have previously shown that Lte1 exhibits
cell-cycle-dependent phosphorylation
(Bardin et al., 2000
;
Lee et al., 2001b
). The
modification occurs coincident with bud emergence but is accentuated as cells
enter mitosis. The multiple phosphorylation is lost coincident with Clb2
destruction at mitotic exit (Fig.
6A). Hence, the phosphorylation mimics the localisation profile.
Given that Lte1 cortical localisation is regulated by Cdc14
(Fig. 4) and depends on
Cdc28/Cln activity (Fig. 1A,
Fig. 3A), we set out to
investigate if Lte1 is phosphorylated by Cdc28.
|
Cdc28 regulates cell cycle progression by associating with different
stage-specific cyclins. Whereas the G1/S transition relies solely on Cdc28/Cln
activity, progression through S-phase and mitosis is coupled to Cdc28
activation by B-type cyclins Clb1-6
(Nasmyth, 1993
). To
discriminate between Cdc28/Cln and Cdc28/Clb activities, we examined the
phosphorylation of Lte1 in synchronised cells expressing a non-degradable form
of Sic1 (Sic1
N), a potent inhibitor of S-phase and mitotic Cdk
activities. As cells were released from an
-factor-induced G1 block,
slower-migrating forms of Lte1 appeared coincident with bud emergence even
when Sic1 accumulation had inhibited Clb/Cdc28 activity judged by lack of DNA
replication (Fig. 6B arrows,
data not shown). Inhibition of Clb/Cdc28 activity also did not affect the
establishment of Lte1 at the bud cortex. As a consequence of Sic1
overproduction, cells exhibited highly elongated buds with Lte1GFP persisting
at their tips (Fig. 6B).
Although the early cell cycle phosphorylation of Lte1 is unperturbed upon
Clb/Cdc28 inactivation, the hyperphosphorylated species normally observed
later in the cell cycle are not formed (compare, for example, lanes indicated
by asterisks in Fig. 6B). This
suggests that Cdc28/Clb, directly or indirectly, may be responsible for some
Lte1 phosphorylation events in vivo.
To assess whether Cdc28 can directly phosphorylate Lte1, we performed in vitro kinase assays using purified Cdc28-13 enzyme, which has a thermolabile kinase activity. We were able to detect phosphorylation of a bacterially produced Lte1 fragment spanning residues 300-845 at low temperatures (Fig. 6C, left panel). When the kinase reactions were performed at 37°C to inactivate the Cdc28-13 kinase, the phosphorylation was abolished, demonstrating that Cdc28 and no other putative contaminating kinase is responsible for the Lte1 phosphorylation (Fig. 6C, left panel).
To investigate whether Lte1 is a target of Cdc28 kinase complexed with Cln cyclins, in vitro kinase assays were carried out using Cdc28/Cln2 purified from yeast. We did observe phosphorylation of the Lte1 fragment (Fig. 6C, middle panel), implying that Lte1 is a substrate for Cdc28/Cln kinase in vitro.
The ability of Cdc28 to phosphorylate Lte1 is not restricted to Cln complexes. We found that Cdc28 kinase purified from mitotically arrested yeast cells was also able to phosphorylate Lte1 in vitro (Fig. 6C, right panel). Lte1 contains nine consensus Cdk phosphorylation motifs (S/T-P-X-K/R, S/T-P-K/R, and K/R-S/T-P), of which five are contained in the fragment. We constructed point mutations in the LTE1 gene to replace the serine or threonine residue in these five putative Cdk sites by an alanine residue (hereafter referred to as Lte1Cdk). The mutant fragment has a significantly reduced incorporation of radiolabel compared to the wild-type fragment although phosphorylation by Cdc28/Clb is not completely abolished (Fig. 6C). The latter may be due to the presence of several SP and TP motifs in the fragment, which are also potential Cdk phosphorylation sites.
To analyse the effect of the Lte1 Cdk mutant allele in vivo, strains were
constructed with an integrated version of the mutant LTE1 gene
expressed from its endogenous promoter. Analysis of protein status in
synchronised cells revealed that the low mobility species were significantly
decreased, consistent with reduced phosphorylation, across the entire cell
cycle (Fig. 6D). This strongly
suggests that Cdc28 phosphorylates Lte1 in vivo. The mutant allele is
functional, as it is able to complement the cold-sensitivity of the
lte1
mutant and the synthetic lethality of a
spol2
lte1
double mutant (data not shown). Surprisingly,
analysis of the localisation of Lte1Cdk fused to GFP in synchronised cells
showed no apparent defect in asymmetric localisation or in the kinetics of
cortical association (data not shown). Therefore, the residual phosphorylation
of the Lte1Cdk mutant must be sufficient to establish cortex interaction.
The inability of Lte1 to localise to the cortex in mutants lacking Cdc28
activity (Fig. 1B,
Fig. 3A) is not simply a
consequence of these mutants failing to activate Cdc42. Expression of a
hyperactivated form of Cdc42 can bypass the requirement for Cdc28/Cln activity
in establishment of polarity (Gulli et
al., 2000
). We find that polarisation of G1-cyclin-depleted cells
induced by expression of the GTP-bound form of Cdc42, Cdc42-G12V, was not
sufficient to recruit Lte1 to the plasma membrane (64% of cells exhibit
polarised actin cytoskeleton after 3 hours induction; data not shown).
Although few cells displayed a faint stain at the polarisation sites, the bulk
of Lte1 was retained in the cytoplasm (Fig.
6E). Thus, Cdc28/Cln has a separate role in membrane recruitment
of Lte1 in addition to activation of Cdc42 presumably involving Lte1
phosphorylation.
Lte1 localisation to bud cortex requires cooperation between N- and
C-terminal domains
To further explore the requirements for cortical attachment, we
investigated the intrinsic Lte1 determinants for localisation. For this
purpose, we conducted a mutational analysis on Lte1 that also allowed us to
address which regions are crucial for Lte1 activity. Lte1 is a large protein
composed of a total of 1435 amino-acid residues. The C-terminal region of Lte1
exhibits considerable homology to the nucleotide exchange domain present in
Cdc25 (26% identity over last 200 amino acid residues). However, information
is scarce regarding the exact role of the remaining domains. Examination of
Lte1 primary amino-acid sequence using the SMART program revealed the presence
of a hydrophobic N-terminal motif, GEFN, spanning residues 24-157, which is
found in a subset of GEFs for Ras-like GTPases
(Fig. 7A).
|
To address the importance of this GEFN motif for Lte1 function, we
constructed a set of N-terminal truncation mutants and tested their ability to
complement the cold-sensitive phenotype of an lte1
mutant.
This phenotype is reversible by BUB2 deletion and thus likely to
reflect the GEF activity of Lte1 (Lee et
al., 2001b
). Deletion of up to 300 amino acids from the
N-terminus, thereby removing the GEFN domain, had little effect on the
complementation ability of the mutant proteins when overexpressed from the
GAL1 promoter or provided in a lower dose from the endogenous
promoter (Fig. 7A). Further
deletion to residue 360 resulted in weak suppression of the
lte1
phenotype, although the mutant protein was expressed at
wild-type levels (data not shown). Thus, the N-terminal region of Lte1
containing the GEFN motif is dispensable for Lte1 function in vivo.
Surprisingly, deletion of the conserved C-terminal region harbouring the
presumed GEF activity still allowed mutant proteins to partially complement
the lte1
cold-sensitivity (see Discussion).
We next examined the subcellular localisation of the Lte1 mutant proteins.
Interestingly, we found that the N-terminal Lte1 fragment (1-984) was able to
localise to the cortex upon GAL1 overproduction, albeit with reduced
efficiency. By contrast, the C-terminal fragments (801-1435), (922-1435) and
(984-1435) were delocalised throughout the cell at all stages of the cell
cycle (Fig. 7B). Further
analysis identified a minimal region, spanning residue 300-984, in Lte1
sufficient to mediate weak cortical attachment, suggesting that it harbours a
cortical docking site. However, microscopic examination of mutants such as
Lte1
N157 and Lte1
C1334 expressed at endogenous level revealed
that both proteins localised predominantly to the cytoplasm. Therefore, both
the N-terminal and C-terminal regions are required to mediate efficient/stable
attachment of Lte1 to the cortex (Fig.
7B). In support of their cooperation, we have detected an
interaction between the N-terminal region (1-984) and the C-terminal domain
(
N1133) of Lte1 by two-hybrid analysis (data not shown). This
interaction was further confirmed in vitro with purified Lte1 fragments using
pulldown assays (Fig. 7C),
suggesting that the interaction is of physiological relevance.
| Discussion |
|---|
|
|
|---|
Here we have explored how the asymmetric recruitment of Lte1 to the
daughter cell cortex is coupled to intrinsic cell cycle events. We show that
activation of Cdc28/Cln kinase at START triggers the localisation of Lte1 to
the incipient bud site (Fig.
1A,B). Our data suggest that Cdc28/Cln kinase has at least two
functions in promoting Lte1 cortical establishment. One function is to
activate Cdc42, as cdc42ts cells are unable to recruit Lte1 to the
cell cortex (Fig. 3B). Cdc42
has previously been implicated in control of mitotic events
(Richman et al., 1999
;
Tjandra et al., 1998
) but this
reveals a so-far unknown link between Cdc42 function at bud emergence and
mitotic exit. That the localisation depends on functional Cdc42 is supported
by the fact that mutation of downstream effector proteins Gic1 and Gic2 result
in a failure to localise Lte1 to the site of polarisation at the restrictive
temperature (Fig. 3C). Whether
Lte1 forms a direct association with Gic1/2 is unclear. However, Gic1/2 are
clearly not the only way of targeting Lte1. Firstly, in
gic
1gic2
mutants Lte1 is efficiently localised to the
bud site at the permissive temperature. Secondly, Gic2 is degraded shortly
after bud emergence and is absent at later stages of the cell cycle
(Jaquenoud et al., 1998
),
implying that Gic2 is not required to maintain Lte1 at the cortex. Thus,
Gic1/2-independent mechanisms must exist to localise Lte1 at the bud tip. One
possibility is that other Cdc42 effectors such as the PAK-like kinases
including Cla4, Ste20 and Skm1, can regulate Lte1 localisation. Genetic
interactions between these two classes of Cdc42 effectors have been observed
(Chen et al., 1997
;
Drees et al., 2001
),
suggesting they share overlapping functions. Alternatively, Cdc42-interacting
proteins Msb3 and Msb4, which are partly redundant with the Gic1/2 pathway
(Bi et al., 2000
), may be
involved. The recruitment of Lte1 at the cortex does not require proteins
immediately downstream of Gic1/2 such as Bni1 or Bud6
(Fig. 3D). In fact, it appears
to be independent of a polarised actin cytoskeleton or an intact secretory
pathway, as it occurs in the presence of the actin polymerisation antagonist
LatB and in sec18-1 mutants at the restrictive temperature
(Fig. 1A, Fig. 2A). Yet, we cannot
exclude the possibility that actin to some extent contributes to the
maintenance of Lte1 at the cortex.
Activation of Cdc42 in late G1 also triggers the assembly of a septin ring
at the bud site independently from actin polarisation
(Ayscough et al., 1997
). We
observed that disruption of the septin ring completely abolished the
asymmetric localisation of Lte1 (Fig.
2D). The reason for this is unclear at present. The altered actin
stability in septin mutants (Barral et al.,
2000
) is unlikely to account for the loss of Lte1 from the
daughter cell (see above). A septin-mediated diffusion barrier has been
reported to maintain asymmetric distribution of proteins such as Myo2, Sec3
and Spa2 (Barral et al., 2000
).
We propose that septins regulate Lte1 in a similar way. Therefore, mutations
that affect septin integrity would also indirectly cause Lte1
mislocalisation.
Despite similarities in localisation requirements, Lte1 does not have as
dramatic effects on the actin cytoskeleton as Gic1/2, Bud6 and Bni1 proteins.
The actin network appears largely unaffected in lte1
mutants,
and they retain the ability to respond proficiently to mating pheromone (data
not shown). Also, overexpression of LTE1 cannot rescue the shmoo
defect of the gic1
gic2
double mutant as observed for
Bud6 and Bni1 (Jaquenoud and Peter,
2000
) (data not shown).
Intriguingly, Lte1 also localised to the tips of polarised cell surface
projections formed when cells were stimulated with mating pheromone. This
reinforces the conclusion that Lte1 becomes concentrated to sites of polarised
cell growth. However, the presence of Far1 inhibits Cdc28/Cln activity in
mating cells, so unlike the budding cycle Cdc28 activity is not required for
Lte1 localisation in the mating pathway. How Lte1 distribution is regulated in
response to mating signals remains to be determined. The specific polarised
sequestration of Lte1 suggests that it may have a so-far unidentified role in
mating. Intriguingly, we have identified Kel1, a kelch-domain containing
protein, in a two-hybrid analysis with Lte1 (our unpublished observations).
This association was also reported in a recent large-scale protein complex
analysis (Gavin et al., 2002
).
Kel1 is a cortical protein involved in polarisation, and it is important for
cell fusion during mating (Philips and
Herskowitz, 1998
). We were unable to detect any inter-dependency
in their cortical localisation. Surprisingly, however, we observed that
deletion of KEL1 rescued the cold-sensitivity of the
lte1
mutant. The connection between Lte1 and Kel1 is currently
under investigation.
Dephosphorylation of Lte1 by Cdc14 triggers its release from the
cortex
Lte1 is phosphorylated in a cell-cycle-dependent manner with a profile that
mirrors the kinetics of its cortical association
(Fig. 1A, Fig. 6A). Phosphorylation is
clearly a key regulatory step in Lte1 localisation. We find that ectopic
expression of the Cdc14 phosphatase in metaphase-arrested cells is sufficient
to trigger the premature release of Lte1 from the cortex into the cytoplasm
(Fig. 4A). Coincident with
cortical release, Lte1 becomes dephosphorylated, suggesting that the effect is
direct (Fig. 5A). In support of
this, we find that purified Cdc14 can dephosphorylate Lte1 in vitro,
identifying Lte1 as a novel target of Cdc14
(Fig. 5C). By contrast,
premature inactivation of mitotic Cdc28 kinase in metaphase-arrested cells,
either by overproduction of the Cdk inhibitor Sic1
(Fig. 4B) or through use of
cdc28ts alleles (data not shown), was not sufficient to alter the
phosphorylation status of Lte1. Nevertheless, preventing activation of
Cdc28/Clb kinase during the cell cycle prevented the formation of certain
hyperphosphorylated species of Lte1 (Fig.
6B). The role of this particular phosphorylation is not clear. So,
only once established, Cdc28 activity is no longer required to maintain Lte1
phosphorylation. Similarly, inactivation of mitotic Cdc28 activity had only a
moderate effect on Lte1 localisation in cells arrested by nocodazole
(Fig. 4B). In some 20% of cells
Lte1 signal was lost from the cortex so we cannot rule out the possibility
that sustained Cdc28 activity, either directly or indirectly, plays a somewhat
minor role in maintaining Lte1 at the cortex.
Cdc14 may regulate other aspects of Lte1 function in addition to its
cortical localisation. We have previously shown that the mitotic
phosphorylation of Lte1 is reduced in cdc5-1 mutants at the
restrictive temperature (Lee et al.,
2001b
). In the course of this study, we found that Lte1
localisation is largely unperturbed in cdc5-1 mutants (data not
shown), suggesting that Cdc5-dependent phosphorylation is not required for
Lte1 localisation. Recently, Cdc5 was shown to phosphorylate Bfa1, which
presumably inhibits the Bub2/Bfa1 GAP activity
(Hu et al., 2001
).
Dephosphorylation of Bfa1 by Cdc14 at the end of mitosis reverses this effect,
presumably leading to the inactivation of the MEN
(Pereira et al., 2002
).
Whether Cdc5 and/or Cdc14 modulate the exchange activity of Lte1 is
unclear.
Lte1 is phosphorylated by Cdc28 kinase
A second role of Cdc28/Cln in Lte1 function in addition to Cdc42 activation
can be deduced from the observation that activation of Cdc42 in the absence of
Cdc28 activity is not sufficient to drive Lte1 to the polarisation sites
(Fig. 6E). In addition to its
requirement for Lte1 localisation (Fig.
1B, Fig. 3A), Cdc28
is required to phosphorylate Lte1. In cdc28ts mutants at the
restrictive temperature, in cells depleted for G1 cyclins (our unpublished
observations) and in
-factor-arrested cells
(Fig. 6A), Lte1 is present in
an unphosphorylated state. Several lines of evidence suggest that Lte1 is a
physiological substrate for Cdc28. First, we were able to efficiently
phosphorylate a fragment of Lte1 in vitro with purified Cdc28 kinase complexed
with either Cln or Clb cyclins (Fig.
6C). Second, mutating 5 Cdk consensus sites in Lte1 significantly
reduced this phosphorylation in vitro (Fig.
6C). Third, inactivation of Cdc28/Clb kinase in synchronised cells
resulted in an altered Lte1 phosphorylation pattern
(Fig. 6B). Finally, and most
importantly, mutation of five Cdk sites in Lte1 significantly reduced the
cell-cycle-dependent phosphorylation in vivo
(Fig. 6D). The mutations did
not affect the ability of the protein to localise asymmetrically to the bud
cortex. However, the residual phosphorylation of the Lte1Cdk mutant fluctuates
in a cell-cycle-dependent manner consistent with its localisation profile. The
Cdk sites phosphorylated by Cdc28 in vitro all reside in the minimal Lte1
fragment that can be targeted to the cortex
(Fig. 7A). As Cdc28-dependent
phosphorylation is still observed in the Lte1Cdk fragment in vitro
(Fig. 6C) it is possible that
the remaining phosphorylation of the Lte1Cdk mutant in vivo is attributable to
Cdc28. However, we cannot rule out the possibility that other kinases may
contribute to Lte1 phosphorylation.
It is possible that Cdc28/Cln phosphorylates additional proteins involved in establishing polarised localisation of Lte1. However, taken together, our data favour a scenario where Cdc28 via phosphorylation primes Lte1 for recruitment to the cortex in a Cdc42-dependent step. Once established Lte1 is maintained at the bud tip until Cdc14 is activated and released from the nucleolus in mitosis. This scenario is consistent with the similar kinetics of Lte1 phosphorylation and localisation and with the timing of Cdc28 and Cdc14 activation.
Cortical attachment requires both the N- and C-terminal domains in
Lte1
In this study we have reported an investigation of the domain structure of
Lte1 aimed at defining regions critical for its localisation. In addition, we
performed a functional analysis of the domains.
Studies of the exchange factor activity of Cdc25 have shown that the well
conserved C-terminal catalytic domain suffices for catalytic activity
(Lai et al., 1993
). In the
case of Lte1 we find that the C-terminal domain is not critical at least for
some functions as Lte1
C1270 and Lte1
C1334 mutants are able to
support growth of the lte1
mutant at 14°C albeit less
efficiently than wild-type (Fig.
7A). This finding is unexpected, as the cold-sensitivity of
lte1
is believed to reflect the absence of its GEF activity.
It is possible that our mutants retain sufficient GEF activity or
alternatively that the cold-sensitivity can be partly suppressed by a separate
function of Lte1, unrelated to its GEF activity. The C-terminal region on its
own is not able to complement the lte1
phenotype even at high
dosage. In addition, we have been unable to detect exchange activity
associated with bacterially produced Lte1 (984-1435) fragment, comprising the
GEF domain using the Tem1 filter binding assay recently described
(Geymonat et al., 2002
) (data
not shown). Therefore, unlike Cdc25, other regions in Lte1 in addition to the
GEF domain may be required for activity or modification such as
phosphorylation may be necessary.
We were intrigued by the presence of a GEFN motif, a domain found in a
subset of guanine nucleotide exchange factors for Ras-like small GTPases. In
the case of Sos, the GEF for human Ras, the motif appears to have a purely
structural role (Boriack-Sjodin et al.,
1998
). Usually the domain is located just upstream of the
catalytic GEF (or Cdc25-like) domain. In Lte1, however, it is separated by a
significant distance from the C-terminal GEF
(Fig. 7A). Although progressive
N-terminal deletion of Lte1 revealed that the first 300 residues are
dispensable for the ability to complement the lte1
cold-sensitivity, we find that the N-terminus does interact with the
C-terminal GEF domain in two-hybrid screens and in vitro
(Fig. 7C). This association is
likely to be of structural importance as mutants lacking either the N-terminus
or C-terminus fail to localise efficiently to the cortex but remain
cytoplasmic throughout the cell cycle (Fig.
7B).
Therefore, in addition to phosphorylation Lte1 requires the presence of both the N-terminal and C-terminal domains to efficiently localise to the cortex. The connection between these requirements is not clear. One attractive model is that phosphorylation regulates the intrameric association of the two domains, thereby facilitating Lte1 attachment to the cortex. Detailed structure-function studies should allow this hypothesis to be tested in the future.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Ayscough, K. R., Stryker, J., Pokala, N., Sanders, M., Crews, P.
and Drubin, D. G. (1997). High rates of actin filament
turnover in budding yeast and roles for actin in establishment and maintenance
of cell polarity revealed using the actin inhibitor latrunculin-A.
J. Cell Biol. 137,399
-416.
Bardin, A. J. and Amon, A. (2001). Men and sin: what's the difference? Nat. Rev. Mol. Cell Biol. 2, 815-826.[CrossRef][Medline]
Bardin, A. J., Visintin, R. and Amon, A. (2000). A mechanism for coupling exit from mitosis to partitioning of the nucleus. Cell 102, 21-31.[CrossRef][Medline]
Barral, Y., Mermall, V., Mooseker, M. S. and Snyder, M. (2000). Compartmentalization of the cell cortex by septins is required for maintenance of cell polarity in yeast. Mol. Cell 5,841 -851.[CrossRef][Medline]
Bi, E., Chiavetta, J. B., Chen, H., Chen, G. C., Chan, C. S. and
Pringle, J. R. (2000). Identification of novel,
evolutionarily conserved Cdc42p-interacting proteins and of redundant pathways
linking Cdc24p and Cdc42p to actin polarization in yeast. Mol.
Biol. Cell 11,773
-793.
Bobola, N., Jansen, R. P., Shin, T. H. and Nasmyth, K. (1996). Asymmetric accumulation of Ash1p in postanaphase nuclei depends on a myosin and restricts yeast mating-type switching to mother cells. Cell 84,699 -709.[CrossRef][Medline]
Boriack-Sjodin, P. A., Margarit, S. M., Bar-Sagi, D. and Kuriyan, J. (1998). The structural basis of the activation of Ras by Sos. Nature 394,337 -343.[CrossRef][Medline]
Chant, J. (1999). Cell polarity in yeast. Annu. Rev. Cell Dev. Biol. 15,365 -391.[CrossRef][Medline]
Chen, G. C., Kim, Y. J. and Chan, C. S. (1997).
The Cdc42 GTPase-associated proteins Gic1 and Gic2 are required for polarized
cell growth in Saccharomyces cerevisiae. Genes Dev.
11,2958
-2971.
Donovan, J. D., Toyn, J. H., Johnson, A. L. and Johnston, L.
H. (1994). P40SDB25, a putative CDK inhibitor, has a role in
the M/G1 transition in Saccharomyces cerevisiae. Genes
Dev. 8,1640
-1653.
Drees, B. L., Sundin, B., Brazeau, E., Caviston, J. P., Chen, G.
C., Guo, W., Kozminski, K. G., Lau, M. W., Moskow, J. J., Tong, A. et al.
(2001). A protein interaction map for cell polarity development.
J. Cell Biol. 154,549
-571.
Frenz, L. M., Lee, S. E., Fesquet, D. and Johnston, L. H. (2000). The budding yeast Dbf2 protein kinase localises to the centrosome and moves to the bud neck in late mitosis. J. Cell Sci. 113,3399 -3408.[Abstract]
Gavin, A. C., Bosche, M., Krause, R., Grandi, P., Marzioch, M., Bauer, A., Schultz, J., Rick, J. M., Michon, A. M., Cruciat, C. M. et al. (2002). Functional organization of the yeast proteome by systematic analysis of protein complexes. Nature 415,141 -147.[CrossRef][Medline]
Geymonat, M., Spanos, A., Smith, S. J. M., Wheatley, E.,
Rittinger, K., Johnston, L. H. and Sedgwick, S. G. (2002).
Control of mitotic exit in budding yeast: in vitro regulation of Tem1 GTPase
by Bub2 and Bfa1. J. Biol. Chem.
277,28439
-28445.
Gulli, M. P., Jaquenoud, M., Shimada, Y., Niederhauser, G., Wiget, P. and Peter, M. (2000). Phosphorylation of the Cdc42 exchange factor Cdc24 by the PAK-like kinase Cla4 may regulate polarized growth in yeast. Mol. Cell 6,1155 -1167.[CrossRef][Medline]
Guthrie, C. and Fink, G. R. (1991). Methods in Enzymology. Guide to Yeast Genetics and Molecular Biology. San Diego, California: Academic Press, Inc.
Hu, F., Wang, Y., Liu, D., Li, Y., Qin, J. and Elledge, S. J. (2001). Regulation of the Bub2/Bfa1 GAP complex by Cdc5 and cell cycle checkpoints. Cell 107,655 -665.[CrossRef][Medline]
Jaquenoud, M. and Peter, M. (2000). Gic2p may
link activated Cdc42p to components involved in actin polarization, including
Bni1p and Bud6p (Aip3p). Mol. Cell. Biol.
20,6244
-6258.
Jaquenoud, M., Gulli, M. P., Peter, K. and Peter, M. (1998). The Cdc42p effector Gic2p is targeted for ubiquitin-dependent degradation by the SCFGrr1 complex. EMBO J. 17,5360 -5373.[CrossRef][Medline]
Jensen, S., Segal, M., Clarke, D. J. and Reed, S. I.
(2001). A novel role of the budding yeast separin Esp1 in
anaphase spindle elongation: evidence that proper spindle association of Esp1
is regulated by Pds1. J. Cell Biol.
152, 27-40.
Jin, H. and Amberg, D. C. (2000). The secretory
pathway mediates localization of the cell polarity regulator Aip3p/Bud6p.
Mol. Biol. Cell 11,647
-661.
Johnson, D. I. (1999). Cdc42: An essential
Rho-type GTPase controlling eukaryotic cell polarity. Microbiol.
Mol. Biol. Rev. 63,54
-105.
Keng, T., Clark, M. W., Storms, R. K., Fortin, N., Zhong, W., Ouellette, B. F., Barton, A. B., Kaback, D. B. and Bussey, H. (1994). LTE1 of Saccharomyces cerevisiae is a 1435 codon open reading frame that has sequence similarities to guanine nucleotide releasing factors. Yeast 10,953 -958.[CrossRef][Medline]
Kramer, K. M., Fesquet, D., Johnson, A. L. and Johnston, L. H. (1998). Budding yeast RSI1/APC2, a novel gene necessary for initiation of anaphase, encodes an APC subunit. EMBO J. 17,498 -506.[CrossRef][Medline]
Labib, K., Diffley, J. F. and Kearsey, S. E. (1999). G1-phase and B-type cyclins exclude the DNA-replication factor Mcm4 from the nucleus. Nat. Cell Biol. 1, 415-422.[CrossRef][Medline]
Lai, C. C., Boguski, M., Broek, D. and Powers, S.
(1993). Influence of guanine nucleotides on complex formation
between Ras and CDC25 proteins. Mol. Cell. Biol.
13,1345
-1352.
Lee, S. E., Frenz, L. M., Wells, N. J., Johnson, A. L. and Johnston, L. H. (2001a). Order of function of the budding-yeast mitotic exit-network proteins Tem1, Cdc15, Mob1, Dbf2, and Cdc5. Curr. Biol. 11,784 -788.[CrossRef][Medline]
Lee, S. E., Jensen, S., Frenz, L. M., Johnson, A. L., Fesquet,
D. and Johnston, L. H. (2001b). The Bub2-dependent mitotic
pathway in yeast acts every cell cycle and regulates cytokinesis.
J. Cell Sci. 114,2345
-2354.
Lew, D. J. and Reed, S. I. (1995). Cell cycle control of morphogenesis in budding yeast. Curr. Opin. Genet. Dev. 5,17 -23.[CrossRef][Medline]
Mah, A. S., Jang, J. and Deshaies, R. J.
(2001). Protein kinase Cdc15 activates the Dbf2-Mob1 kinase
complex. Proc. Natl. Acad. Sci. USA
98,7325
-7330.
Morgan, D. O. (1999). Regulation of the APC and the exit from mitosis. Nat. Cell Biol. 1, E47-E53.[CrossRef][Medline]
Nasmyth, K. (1993). Control of the yeast cell cycle by the Cdc28 protein kinase. Curr. Opin. Cell Biol. 5,166 -179.[CrossRef][Medline]
Pereira, G., Hofken, T., Grindlay, J., Manson, C. and Schiebel, E. (2000). The Bub2p spindle checkpoint links nuclear migration with mitotic exit. Mol. Cell 6, 1-10.[CrossRef][Medline]
Pereira, G., Manson, C., Grindlay, J. and Schiebel, E.
(2002). Regulation of the Bfa1p-Bub2p complex at spindle pole
bodies by the cell cycle phosphatase Cdc14p. J. Cell
Biol. 157,367
-379.
Philips, J. and Herskowitz, I. (1998).
Identification of Kel1p, a kelch domain-containing protein involved in cell
fusion and morphology in Saccharomyces cerevisiae. J. Cell
Biol. 143,375
-389.
Richardson, H. E., Wittenberg, C., Cross, F. and Reed, S. I. (1989). An essential G1 function for cyclin-like proteins in yeast. Cell 59,1127 -1133.[CrossRef][Medline]
Richman, T. J., Sawyer, M. M. and Johnson, D. I.
(1999). The Cdc42p GTPase is involved in a G2/M morphogenetic
checkpoint regulating the apical-isotropic switch and nuclear division in
yeast. J. Biol. Chem.
274,16861
-16870.
Schwab, M., Lutum, A. S. and Seufert, W. (1997). Yeast Hct1 is a regulator of Clb2 cyclin proteolysis. Cell 90,683 -693.[CrossRef][Medline]
Shirayama, M., Matsui, Y., Tanaka, K. and Toh-e, A. (1994a). Isolation of a CDC25 family gene, MSI2/LTE1, as a multicopy suppressor of ira1. Yeast 10,451 -461.[CrossRef][Medline]
Shirayama, M., Matsui, Y. and Toh, E. A.
(1994b). The yeast TEM1 gene, which encodes a GTP-binding
protein, is involved in termination of M phase. Mol. Cell.
Biol. 14,7476
-7482.
Shou, W., Seol, J. H., Shevchenko, A., Baskerville, C., Moazed, D., Chen, Z. W., Jang, J., Charbonneau, H. and Deshaies, R. J. (1999). Exit from mitosis is triggered by Tem1-dependent release of the protein phosphatase Cdc14 from nucleolar RENT complex. Cell 97,233 -244.[CrossRef][Medline]
Stegmeier, F., Visintin, R. and Amon, A. (2002). Separase, polo kinase, the kinetochore protein Slk19, and Spo12 function in a network that controls Cdc14 localization during early anaphase. Cell 108,207 -220.[CrossRef][Medline]
Takizawa, P. A., DeRisi, J. L., Wilhelm, J. E. and Vale, R.
D. (2000). Plasma membrane compartmentalization in yeast by
messenger RNA transport and a septin diffusion barrier.
Science 290,341
-344.
Tjandra, H., Compton, J. and Kellogg, D. (1998). Control of mitotic events by the Cdc42 GTPase, the Clb2 cyclin and a member of the PAK kinase family. Curr. Biol. 8,991 -1000.[CrossRef][Medline]
Visintin, R., Craig, K., Hwang, E. S., Prinz, S., Tyers, M. and Amon, A. (1998). The phosphatase Cdc14 triggers mitotic exit by reversal of Cdk-dependent phosphorylation. Mol. Cell 2,709 -718.[CrossRef][Medline]
Visintin, R., Hwang, E. S. and Amon, A. (1999). Cfi1 prevents premature exit from mitosis by anchoring Cdc14 phosphatase in the nucleolus. Nature 398,818 -823.[CrossRef][Medline]
Wach, A., Brachat, A., Pohlmann, R. and Philippsen, P. (1994). New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10,1793 -1808.[CrossRef][Medline]
Yoshida, S., Asakawa, K. and Toh, E. A. (2002). Mitotic Exit Network controls the localization of Cdc14 to the spindle pole body in Saccharomyces cerevisiae. Curr. Biol. 12,944 -950.[CrossRef][Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
Related articles in JCS:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||