spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schreider, C.
Right arrow Articles by Pinçon-Raymond, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schreider, C.
Right arrow Articles by Pinçon-Raymond, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Journal of Cell Science 115, 543-552 (2002)
© 2002 The Company of Biologists Limited


Research Article

Integrin-mediated functional polarization of Caco-2 cells through E-cadherin—actin complexes

Cyrille Schreider, Gregory Peignon, Sophie Thenet, Jean Chambaz and Martine Pinçon-Raymond*

INSERM U505, Université Pierre et Marie Curie, EPHE, 15 rue de l'Ecole de Médecine, 75006 Paris, France

Author for correspondence (e-mail: pincon{at}ccr.jussieu.fr)

Accepted 25 October 2001


    Summary
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 Note in Proof
 References
 
Enterocyte differentiation is a dynamic process during which reinforcement of cell-cell adhesion favours migration along the crypt-to-villus axis. Functional polarization of Caco-2 cells, the most commonly used model to study intestinal differentiation, is assessed by dome formation and tightness of the monolayer and is under the control of the extracellular matrix (ECM). Furthermore, our biochemical and confocal microscopy data demonstrate that the ECM dramatically reinforces E-cadherin targeting to the upper lateral membrane, formation of the apical actin cytoskeleton and its colocalization with E-cadherin in functional complexes. In our model, these effects were produced by native laminin-5-enriched ECM as well as by type IV collagen or laminin 2, which suggests a common pathway of induction through integrin receptors. Indeed, these effects were antagonized by blocking anti-ß1- and anti-{alpha}6-integrin antibodies and directly induced by a stimulating anti-ß1-integrin antibody. These results demonstrate that integrin-dependent cell to ECM adhesion reinforces E-cadherin-dependent cell-cell adhesion in Caco-2 cells and further support the notion that enterocyte differentiation is supported by a molecular crosstalk between the two adhesion systems of the cell.

Key words: Caco-2 cells, ß1 integrin, E-cadherin, Extracellular matrix, Actin cytoskeleton


    Introduction
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 Note in Proof
 References
 
The epithelium forms a barrier made of polarized cells joined by a complex set of cell-cell junctions. The assembly of adherens junctions through the interaction of E-cadherin of adjacent cells initiates this process (Gumbiner, 1996Go; Kemler, 1992Go). The importance of cell-cell adhesion in differentiation and in the maintenance of the differentiated phenotype is well established in epithelial cells (Braga et al., 1999Go). In addition, epithelial cells are separated from the underlying connective tissue by a basement membrane that is composed of a variety of extracellular matrix (ECM) molecules that control cell differentiation in many tissues through interactions with their cellular receptors, for example, with integrins (Boudreau and Bissell, 1998Go).

The basement membrane is mostly composed of type IV collagen, different types of laminins, entactin and heparan sulfate proteoglycan (Beaulieu, 1997Go). ECM molecules, originating from both epithelial and underlying mesenchymal cells, create a framework that is essential for maintaining tissue integrity (Simon-Assmann and Kedinger, 1993Go). Besides this structural role, ECM proteins are involved in the control of adhesion, migration, proliferation, differentiation and gene expression of adjacent cells, which emphasizes the dynamic reciprocity between epithelial and mesenchymal cells (Bissell et al., 1982Go). Additionally, ECM is able to control the effects of trophic factors by sequestration outside of the cell (Simon-Assmann et al., 1998Go) and by crosstalk between their signaling pathways (Yamada and Geiger, 1997Go). It is admitted that cell adhesion to the ECM contributes to the apical-to-basal axis of polarity, in vivo as well as in vitro. Appearance of polarized cells coincides with the expression of laminin 1 (LN1) in the developing kidney (Klein et al., 1990Go). Similarly, the addition of laminin boosts the formation of polarized alveoles in various types of epithelial cells, including mouse mammary (Li et al., 1987Go), human salivary (Hoffman et al., 1996Go) and rat lung (Matter and Laurie, 1994Go) cells in culture. ECM-integrin interactions have either been demonstrated to be directly involved in ECM control of cell functions or found to be aberrant in embryos or animals carrying mutations in integrin genes (Wang et al., 1999Go).

Both cell-ECM and cell-cell adhesion systems are connected to the cytoskeleton, which controls cell polarization. Numerous studies have established that the interaction between ECM and integrin results in cytoskeletal rearrangements (Larjava et al., 1990Go; Wang et al., 1999Go). Integrins are heterodimeric transmembrane receptors composed of {alpha} and ß subunits associated in a noncovalent manner (Hynes, 1987Go; Yamada and Miyamoto, 1995Go). Integrin initiates, through its ß1 cytoplasmic domain, the assembly of specialized cytoskeletal and signaling protein complexes at the contacting membrane (Gimond et al., 1999Go). In the same way, epithelial cells forming strong cell-cell junctions assemble a subcortical actin skeleton instead of focal adhesion and actin stress fibers (Larjava et al., 1990Go). Cadherins are also dependent on cytoskeletal organization (Tsukita et al., 1992Go); correct function of the E-cadherin—catenin complex requires association with the cytoskeleton (Skoudy et al., 1996Go). In epithelial cells, about one half of plasma membrane E-cadherin is connected to the actin cytokeleton: the rest is free within the membrane (Sako et al., 1998Go). The linkage between E-cadherin and the F-actin cytoskeleton is mediated through direct binding of the cytoplasmic domain of E-cadherin to ß-catenin, which binds to {alpha}-catenin (Aberle et al., 1994Go; Jou et al., 1995Go) in a 1:1:1 stochiometry. Crosstalk between the two adhesion systems has also been demonstrated in mammary epithelial cells through the integrin signaling pathway. In these cells, integrins promote the formation of morphologically differentiated acini-like structures, which involves the assembly of adherens junctions through the relocalization of E-cadherin at the lateral side of the cells (Weaver et al., 1997Go).

The mammalian intestinal epithelium is peculiar in that it is a constantly renewing monocellular epithelium, which migrates `en cohorte' along the basement membrane from the proliferative undifferentiated compartment in the crypts to the tips of the villi. Enterocytes can probably glide over the basement membrane through loose adhesion, through them being tied to each other by strong cell-cell junctions. Whereas type IV collagen is constantly present in the basement membrane, LN2 is preferentially found in the proliferative compartment, LN5 in the villus and LN1 at the junction of the two compartments (Vachon et al., 1993Go; Lorentz et al., 1997Go). Similarly, villus and crypt epithelial cells display a different pattern of integrins, ß1-containing integrins being more abundant in the villi than in the crypts. Furthermore, ß1 is mainly associated with {alpha}2 in the crypt and with {alpha}3 integrins in the villus (Beaulieu, 1992Go). Whereas {alpha}2ß1 integrin preferentially binds to collagen IV but also to LN1 and LN2, {alpha}3ß1 integrin binds to both collagen IV and LN5 (Beaulieu, 1999Go; Rousselle and Garrone, 1998Go). Integrin {alpha}6ß4 binds to both LN1 and LN5 (Fleischmajer et al., 1998Go). This differential pattern of expression of ECM proteins and their receptors along the crypt-to-villus axis parallels the differentiation process of epithelial cells. One can wonder whether changes in ECM-integrin interactions at the crypt to villus junction are accompanied by changes in cell-cell adhesion, which allow cell migration to the tip of the villus.

The colon cancer Caco-2 cell line in culture mimics enterocyte differentiation. We previously showed that ECM was required for the expression of the apoA-IV gene, an intestinal differentiation marker (Le Beyec et al., 1997Go). Here, we observed that the functional polarization of Caco-2 cells, assessed by dome formation and permeability of the monolayer, is under the control of integrin-mediated adhesion to ECM. Furthermore, we demonstrate that integrin activation by ECM reinforces cell-cell adhesion by targeting E-cadherin at the lateral membrane in functional complexes with actin cytoskeleton.


    Materials and Methods
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 Note in Proof
 References
 
Antibodies and products
Antibodies used included monoclonal anti-ß1 (6S6) and anti-{alpha}6 (NKI-GoH3) human integrins with a blocking activity and anti-ß1-integrin (B3B11) with a stimulating activity and purified control mouse anti-IgG (Chemicon); polyclonal anti-human E-cadherin (HECD-1) (Zymed); monoclonal anti-ß-catenin (clone 14) (Transduction Laboratories); FITC-labeled antibodies (Sigma) and RITC-labeled antibodies (Boehringer). TRITC- or FITC-labeled phalloidin (Sigma) was used to visualize the actin cytoskeleton. We also used human merosin LN2 (Gibco) and mouse collagen type IV and synthetic poly-D-lysine (Becton-Dickinson).

Cell culture
Caco-2 cells (43rd to 50th passage) and HT29 cells adapted to 10-5 M of methotrexate (Lesuffleur et al., 1990Go) and cultured without the drug and named HT29-MTX (9th passage) were cultured at 37°C with 10% CO2 in Dulbecco's minimal essential medium (DMEM), 25 mM glucose (Gibco), pen/strept (50 µg/ml) and non-essential amino acid (1%) (Gibco) supplemented with 5% foetal calf serum (Boehringer). Mesenchymal intestinal cells C9, C11, C20 obtained from M. Kedinger (Fritsch et al., 1999Go) (28th, 29th and 14th passages, respectively) were cultured at 37°C with 7.5% CO2 in RPMI 1640 medium, pen/strept (50 µg/ml) (Gibco), supplemented with 10% foetal calf serum (Boehringer). Muscle 129CB3 cells were cultured as described (Pinçon-Raymond et al., 1991Go) to form contracting myotubes and secrete a large amount of ECM.

Extracellular matrix preparation and coating
Native ECM was prepared from 129CB3 myotubes, mesenchymal C9, C11, C20 cells (at confluence), HT29-MTX cells (3 days postconfluence) or Caco-2 cells (12d post-confluence) as described previously (Le Beyec et al., 1997Go). Coating of plastic petri dishes was performed by overnight incubation with poly-D-lysine, 5 µg/cm2, collagen type IV, 10 µg/cm2 and merosin LN2, 8.4 µg/cm2 at 4°C.

Perturbation experiments
Caco-2 cells were seeded at 125,000 cells/cm2 (pre-confluence) in 24-well plates coated or not with native ECM or ECM components. At the time of plating, cells were mixed with control mouse IgG or anti-ß1-integrin monoclonal blocking antibody (6S6) or anti-{alpha}6-integrin used to block ß4 integrin (CD49F) or anti-E-cadherin monoclonal blocking antibody (HECD-1) at the indicated dilutions. Under these conditions, control cells were confluent within 24 hours. For each kinetics experiment, triplicate wells were observed using a phase contrast microscope. Confluence was evaluated, and counting triplicate wells on a phase contrast microscope numerated the domes.

Ribonuclease protection assay
A specific 400 bp cDNA encoding the human apoA-IV gene was obtained by RT-PCR using the coding oligonucleotide HindIII-AIV (5'-CTGGAGAAGCTT+149ACACTTACGCAGGTGACCTG-CAG+171-3') and the noncoding oligonucleotide Xba-AIV (5'-CT-GCAGTCTAGA+550AGGGCGTAAGGCGTCCCTTGA+530-3'). The PCR product was digested using XbaI and HindIII, and ligated into the XbaI/HindIII-digested PSK vector to obtain the pAIV-RPA plasmid. For E-cadherin mRNA analysis, a specific 407 bp cDNA encoding the human E-cadherin gene was obtained using the coding oligonucleotide (5'-+2660GACCAGGACTATGACTACTTG-AACG+2684-3') and the noncoding oligonucleotide (5'-+3067ATC-TGCAAGGTGCTGGGTGAACCTT+3043-3') inserted into PCR 2.1 vector. An antisense AIV RNA probe (445 bp) was generated by in vitro transcription of the HindIII-digested pAIV-RPA plasmid using [{alpha}-32P]UTP and T3 RNA polymerase (Promega). An antisense E-cadherin RNA probe (523 bp) was generated by in vitro transcription of the kpn1-digested E-cadherin-PCR2.1 plasmid using [{alpha}-32P]UTP and T7 RNA polymerase (Promega). An antisense ß-actin RNA probe (Human Internal Standards kit, Ambion Inc.) was synthesized with T3 as an internal control. Total RNA was extracted from cells using an RNAzol kit (Bioprobe Systems). Equal amounts (6 µg) of total RNA samples were subjected to the RNase protection assay using the RPAII kit (Ambion Inc) following the manufacturer's recommendations. The protected A-IV RNA (400 bp), E-cadherin RNA (407 bp) and ß-actin RNA (245 bp) probes were separated on a 5% denaturing polyacrylamide-urea gel in Tris borate-EDTA buffer. The gel was dried and exposed to X-ray film at -80°C.

Cell surface biotinylation
Caco-2 cells were seeded on plastic coated or uncoated dishes with native ECM or ECM components and grown for 6 days. All manipulations were performed at 4°C according to Sander et al. (Sander et al., 1998Go). Briefly, cells were incubated for 15 minutes in phosphate-buffered saline (supplemented with 1 mM MgCl2 and 0.5 mM CaCl2) containing 500 µg/ml sulfo-NHS-biotin (Pierce Chemical Co.), washed three times in phosphate-buffered saline containing 50 mM glycine, pH 7.4, lysed in RIPA buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% Nonidet P40, 0.5% sodium deoxycholate, 0.1% SDS, protease inhibitors, 10% glycerol, 1 mM EDTA, 3 mM MgCl2, 1 mM dithiothreitol) and centrifuged for 15 minutes at 13,000 g. The supernatant was incubated with avidin-coated agarose beads (Sigma Chemical Co.) for 1 hour. Immunoprecipitates of biotinylated surface proteins bound to avidin-agarose were washed five times in RIPA buffer and analysed for E-cadherin (HECD-1) by western blotting.

Western blotting
The protein concentration of Caco-2 lysates, biotinylated or not, was assessed by the Biorad `Dc' protein assay. A 20 µg aliquot of each sample mixed with Laëmmli buffer was boiled and submitted to 7% SDS polyacrylamide gel electrophoresis. Samples were then transferred onto nitrocellulose and blocked in 1% non-fat milk overnight at 4°C. After a 2 hour incubation with the primary antibody in the blocking solution at room temperature, blots were washed in PBS 1x pH 7.4, incubated with appropriate HRP-conjugated secondary antibody and washed again. The blots were visualized by chemiluminescence (Amersham ECL system). Signals were scanned (Umax vistaScan S6E) from chemiluminescence into Adobe Photoshop.

Immunofluorescence studies
Caco-2 cells were grown on Lab-Tek chambered borosilicate coverglasses (Nunc), coated or not with native ECM or ECM components. At the indicated time, cells were fixed in 4% paraformaldehyde in phosphate-buffer saline, then permeabilised in 0.1% Triton X-100 during all incubations. Non-specific antigens were blocked for 30 minutes in 3% bovine serum albumin. Double labeling was performed sequentially to avoid crossreactions. Anti-ß1-integrin (6S6) primary antibodies diluted in the blocking solution were incubated for 1 hour 30 minutes, followed by a 1 hour 30 minute incubation with RITC-labeled secondary antibodies, followed by overnight incubation at 4°C with an anti-E-cadherin antibody (HECD-1). These antibodies were visualized with FITC-labeled secondary antibodies after a 1 hour 30 minute incubation. Images were acquired with a Zeiss LSM-510 laser-scanning confocal microscope (Carl Zeiss, Oberkochen, Germany) equiped with Zeiss Axiovert 100M (plan Apochromat 63x1.40 NA oil immersion objective). The contrast and brightness settings were constant during the course of image acquisition. The E-cadherin/actin colocalization visualized by confocal analysis was quantified using a program from Zeiss LSM 510 confocal. The data were recorded from cells in the upper half of the cell in six random fields from three independent experiments.


    Results
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 Note in Proof
 References
 
Native ECM induces the expression of a differentiation marker gene and cell polarity
Of the criteria for epithelial cell differentiation, modifications in cell shape (polarization) and gene expression are those most often reported. We have previously reported that the expression of a differentiation marker gene of enterocytes, apolipoprotein A-IV (apoA-IV), was induced in human colon carcinoma Caco-2 cells when they were grown on filters coated with a native extracellular matrix (ECM) (Le Beyec et al., 1997Go). To determine whether this effect was due either to ECM-cell adhesion or to cell polarization, which would be induced independently by culturing cells on a filter, we grew Caco-2 cells on native ECM deposited on a plastic support. Fig. 1 clearly shows that ECM is able to induce apoA-IV expression independently of the polarization effect of the filter. Furthermore, the level of induction varies according to the origin of the different ECM tested. Table 1 summarizes available data on the production of ECM components by the various mesenchymal and epithelial cell types used to deposit native ECM on the plastic support. Most of these data were obtained by measuring mRNA levels by RT-PCR, which is insufficient to predict the amount of laminin synthesized and deposed by the cells. Indeed discrepancies between mRNA and protein measurements were reported for {alpha}1 laminin in HT29-MTX and Caco-2 cells. Furthermore, C9, C11 and C20 intestinal mesenchymal cells have been reported to express laminin chain mRNA in the same range. Nevertheless, the native ECM deposited by C20 cells was much more efficient in inducing apoA-IV gene expression than that from the other clones. However, Fig. 1 indicates that the most effective ECM to induce apoA-IV expression is the native LN5-rich ECM from HT29 cells adapted to 10-5 M methotrexate.



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 1. Native ECM differentially increases expression of the differentiation marker apoA-IV in Caco-2 cells. The Caco-2 cells were grown until confluence on plastic or on different native ECM previously secreted and deposited by mesenchymal cells from the intestine (C9; C11; C20) or the muscle (129CB3), or by colon tumour epithelial cells (HT29-MTX; Caco-2 at 12 day post confluence). Composition of these ECMs is described in Table 1. Total RNA was isolated, and the abundance of apoA-IV transcripts was assayed by RNAse Protection Assay, using ß actin mRNA as an internal control. The mRNA ratio of apoA-IV:ß actin (mean±s.e.m. of three independent cultures performed in triplicate) is expressed as a percentage of the value obtained from Caco-2 on plastic. * and ** differ from the control at P<0.05 and P<0.01 (t-test), respectively. Note that LN5-rich ECM deposited from HT29 MTX cells is the most effective ECM to induce apoA-IV expression in Caco-2 cells.

 

View this table:
[in this window]
[in a new window]
 
Table 1. ECM components produced by mesenchymal and epithelial cells used in this study

 

Observation of Caco-2 cells during these experiments revealed that cells grown on native LN5-rich ECM formed domes 2 days earlier than cells grown on the plastic support, and the ECM-grown domes were larger (Fig. 2A). It is known that, at confluence, epithelial cells grown on a non-porous support such as plastic are elevated by the fluid accumulated under the monolayer and form domes (Pinto et al., 1983Go). Comparison, every 2 days for 14 days, of Caco-2 cells grown on native ECM or on plastic shows that this dramatic increase in domes formed by Caco-2 cells on native LN5-rich ECM (Fig. 2C) does not rely on the confluence rate of the cells (Fig. 2B), which is the same under both conditions. The permeability of the monolayer was further assessed by the use of FITC-biotin, an outside marker to which cells are impermeable. Fig. 2D confirms an overall inductive effect of ECM on the tightness of cell-cell junctions and functionality of tight junctions by displaying the ability of FITC-labelled biotin to penetrate between adjacent cells within the monolayer. Clearly, this molecule remained apical on the monolayer grown on ECM substrate (Fig. 2Db) whereas it penetrated much deeper between cells grown on plastic without ECM (a) or on polylysine (not shown), an artificial substrate which does not binds to integrins (Machesky and Hall, 1997Go). In contrast to the purpose of the experiment, which was to differentiate between the effects of ECM and filter-induced cell polarization, it suggests that functional polarization of Caco-2 cells, as assessed by dome formation and permeability of the monolayer, is under the control of ECM.



View larger version (49K):
[in this window]
[in a new window]
 
Fig. 2. Native LN5-rich ECM reinforces cell-cell interactions between Caco-2 cells. Caco-2 cells were plated at 20,000 cells/cm2 on plastic ({square}) or on native LN5-rich ECM ({blacksquare}) deposited by HT29-MTX cells. (A) Phase contrast micrography (X 25; bar, 200 µm) shows that domes appear on cultures grown on ECM 2 days earlier than on plastic support. (B) shows the confluence rates observed by phase microscopy. (C) At the indicated times, domes were counted. Values represent mean±s.m.d. from triplicate wells from three independent cultures. (D) shows a 3D confocal reconstruction of the diffusion of FITC-conjugated biotin added at the apical side of Caco-2 cultures grown on plastic (a) or on LN5-rich ECM (b). (bar, 10 µm). Note that the presence of ECM restricts biotin diffusion at the apical compartment, which indicates a reinforcement of cell-cell interactions as compared to cultures grown on plastic without ECM. The result is representative of three independent experiments.

 

Native ECM triggers E-cadherin accumulation at the lateral membrane and colocalization with actin cytoskeleton
The aggregation of E-cadherin molecules at the adherens junctions is the primary event, which organizes the formation of the other cell-cell junctions, that is gap, desmosome, and tight junctions, which ensure the formation of an impermeable polarized epithelium (Cereijido et al., 2000Go; Fujimoto et al., 1997Go; Jongen et al., 1991Go; Lampe et al., 1998Go). We therefore studied the expression of E-cadherin in our system. We saw that native LN5-rich ECM induced a threefold increase in apoA-IV gene expression. At the same time, the total amount of E-cadherin protein (Fig. 3B) and mRNA (Fig. 3A) remained in the same range, as did that of ß-catenin protein, a partner of E-cadherin required for an efficient exit from endoplasmic reticulum in MDCK cells (Chen et al., 1999Go). The amount of E-cadherin associated with the membrane was obtained after surface biotinylation in the presence of 0.5 mM Ca2+, a concentration resulting in a slight loosening of tight junctions but still too high for inducing the disruption of adherens junctions, which occurs under 0.1 mM Ca2+ (Cereijido et al. 2001; Braga et al., 1997Go) (Fig. 3C). Similar to the observation by Sander et al. in MDCK cells expressing Tiam1/Rac (Sander et al. 1998Go), Figure 3C shows that the association of E-cadherin with the membrane was increased fourfold in cells grown on ECM compared with those grown on plastic without ECM, although ECM did not influence the total amount of E-cadherin—ß-catenin.



View larger version (18K):
[in this window]
[in a new window]
 
Fig. 3. Native LN5-rich ECM induces E-cadherin targeting to the lateral membrane. Caco-2 cells were plated at 20,000 cells/cm2 on glass or on native LN5-rich-ECM deposited by HT29-MTX cells, and RNA and proteins were prepared for further analysis. (A) RNase Protection Assay of apoA-IV and E-cadherin mRNA, using ß actin mRNA as a control. The ratio of apoA-IV or E-cadherin to ß actin mRNA on LN5-rich ECM was compared to that measured in Caco-2 cells grown on glass and expressed as a percentage. Note that ECM increases apoA-IV but not E-cadherin mRNA levels. (B) Western blot analysis of the total amount of E-cadherin and ß-catenin. Note that the total amount of either E-cadherin or ß-catenin proteins does not vary. (C) Western blot analysis of E-cadherin after immunoprecipipation of biotinylated membrane-associated proteins. Total E-cadherin (a,c) and biotinylated E-cadherin (b,d) amounts of E-cadherin in cells grown on plastic without ECM (a,b) or LN5-rich ECM (c,d). Note the increase in E-cadherin localized at the cell surface in cultures grown on ECM. The data are means ±s.e.m. of three independent cultures performed in triplicate. * differs from the control at P<0.05.

 

The targeting of E-cadherin to the membrane induced by ECM was further characterized by confocal analysis. The signal detected by indirect immunofluorescence was stronger and cell-cell junctions were better delineated in cells grown on ECM (Fig. 4Ab) compared with cells grown on an inert support (Fig. 4Aa). In addition, confocal 3D analysis shows that E-cadherin was clearly visible at the base of cells, which form a flat monolayer on an inert support (Fig. 4Ac), whereas the signal almost disappeared from the base of cells forming domes on ECM and concentrated in focal spots in the upper third of the lateral membrane (Fig. 4Ad). Fig. 4B (c,d,e) shows that purified ECM components such as type IV collagen and laminin 2 were as efficient as native ECM in inducing E-cadherin targeting to the lateral membrane of cells that do not form domes. Since E-cadherin localized to adherens junctions is intimately associated with actin cytoskeleton in polarized epithelial cells, we also investigated by confocal analysis the actin cytoskeleton and its association with E-cadherin. In addition, culturing cells on ECM components reinforced the formation of the apical actin cytoskeleton and its colocalization with E-cadherin at the upper part of the lateral membrane (Fig. 4Bc', d', e'), as revealed by the merge yellow signal, as compared to an inert support (Fig. 4Ba'). Similar observations were made using a stimulating anti-ß1-integrin antibody in Caco-2 cells grown on an inert support, resulting in the formation of a cortical network of actin at the apical side of the cell (Fig. 4C). Altogether, these results favour a role of native ECM or of its components in the accumulation of E-cadherin at the lateral membrane in functional complexes anchored to the apical actin cytoskeleton.



View larger version (53K):
[in this window]
[in a new window]
 
Fig. 4. Effect of ECM on cell-cell interactions, E-cadherin and actin subcellular localization. (A) Caco-2 cells were plated at 20,000 cells/cm2 on glass (a) or on native LN5-rich ECM (b), processed for immunofluorescence with anti E-cadherin at confluence and analysed by confocal microscopy. Note that E-cadherin is mostly located at the cell-cell junction membrane on domes formed by cells grown on ECM. 3D confocal reconstruction (XZ) shows an E-cadherin signal at the basal side of the Caco-2 cells grown on glass (c), which disappears in cells grown on ECM (d) where the localization of E-cadherin aggregation (i.e. 25 µm from the basal side out of a 30 µm total height) is compatible with the position adherens junction (bar, 10 µm). (B) Caco-2 cells were plated at 50,000 cells/cm2 on glass (a,a'), polylysine (b,b'), native LN5-rich ECM (c,c') type IV collagen (d,d'), or LN2 (e,e'), processed for immunofluorescence with anti-E-cadherin and FITC (green) and TRITC-conjugated phalloidin (red) after 72 hours of culture and analysed by confocal microscopy. Note that ECM increases E-cadherin-actin colocalization (yellow merge signal) and allows the formation of cortical actin cytoskeleton (bar, 10 µm). (C) Actin labelling in cells grown (72 hours) on glass in presence of the ß1-integrin-activating antibody (bar, 10 µm). The results are representative of three independent experiments.

 

E-cadherin targeting to the lateral membrane involves ß1 integrin
ECM components interact at the cell surface with their receptor integrins, which are mainly {alpha}3ß1 and {alpha}6ß4 for LN5, in differentiated intestinal epithelial cells. In order to see whether ECM induced modification in integrin distribution in Caco-2 cells, we performed confocal analysis after double labeling against ß1 or ß4 integrin and E-cadherin. As expected, we observed that ß1 integrin colocalized with E-cadherin at the lateral membrane of cells forming domes, mostly when cells were grown on ECM, a condition in which domes are much more numerous than in cells grown on an inert support (data not shown). We also verified that ß4 integrin was only found at the basal membrane of cells forming domes on ECM but not on an inert support (data not shown).

To further establish the role of ECM on Caco-2 cell polarization and E-cadherin targeting to the membrane, we performed perturbation experiments using functional blocking antibodies against ß1 integrin, the ß chain of the major integrin receptor for laminins and type IV collagen. Indeed, dome formation in cells grown on ECM was drastically impaired by the anti-ß1-integrin blocking antibody, in a dose dependent manner, and it was reduced to the range observed in cells grown on plastic support (Fig. 5A). Similarly, upon treatment with antibodies, cells grown on ECM reached confluence 1 day later than those not treated, at a time similar to that observed with cells grown on plastic. The effect of anti-ß1 antibody on dome formation was observed when cells were at confluence whereas non-specific mouse IgG displayed no effect (Fig. 5B).



View larger version (14K):
[in this window]
[in a new window]
 
Fig. 5. Dome formation is under the control of both E-cadherin and ß1 integrin expressions. Caco-2 cells were plated at 125,000 cells/cm2 on plastic ([UNK]) or on native LN5-rich ECM ({blacksquare}) in the presence of 10 µg/ml mouse non-specific IgG ({diamondsuit}), 10 µg/ml ({circ}) or 2.5µg/ml ({square}) anti-ß1-integrin blocking antibody. (A) shows the appearance of domes as a function of time. Note that anti-ß1-integrin antibody dose dependently decreases the number of domes formed on ECM substrate as early as 2 days in culture. These perturbations are not correlated with the confluence rate. (B) shows the confluence rate of Caco-2 cells. The presence of ß1-integrin antibody or plastic support delays confluence, which is reached 2 days later than in untreated cells grown on ECM or in the presence of control IgG antibody.

 

Under these conditions, we investigated the effects of anti-ß1 or anti-{alpha}6 blocking antibodies on E-cadherin accumulation at the lateral membrane and anchoring to the cortical actin cytoskeleton. Colocalization of E-cadherin and actin at the apical-lateral side of cells was estimated by computer analysis of confocal stack series. Pixel count and pixel intensity measurements gave the same results. Fig. 6A shows that Col IV and LN2 increased the amount of colocalization of E-cadherin and actin signals up to 30% as compared to cells grown on plastic. Thus, either ECM component could be used in the experiments. Confocal 3D reconstruction of cells grown on Col IV reveals double, cortical and basal rows of actin cytoskeleton with an important level of E-cadherin and actin colocalization (Fig. 6Ba). The addition of anti-ß1-integrin blocking antibody resulted in dramatic disorganization of the cortical row of the actin cytoskeleton and, in parallel, a reduction in E-cadherin and actin colocalization (Fig. 6Bb). The blockade of either of the ß1 integrins in cells grown on LN2 (Fig. 6C) or {alpha}6ß4 integrin in cells grown on native ECM (Fig. 6D) resulted in a significant reduction in the colocalization of E-cadherin and actin at the apical lateral side of Caco-2 cells. Altogether, these results demonstrate that ECM, by interacting with its receptor integrins, influences the association of E-cadherin and actin at the level of adherens junction as functional complexes responsible for Caco-2 cell polarization.



View larger version (22K):
[in this window]
[in a new window]
 
Fig. 6. ß1 integrin mediates the effects of ECM on E-cadherin targeting to the lateral membrane. Caco-2 cells were plated at 125,000 cells/cm2 on plastic, native LN5-rich ECM, type IV collagen or LN2 in the presence or absence of either anti-ß1- or anti-{alpha}6-integrin blocking antibodies. Cells were then processed for immunofluorescence with anti-E-cadherin and FITC (green) or TRITC-conjugated phalloidin (red) and analysed by confocal microscopy. Colocalization (yellow merge signal) of E-cadherin and actin at the apical-lateral side of cells was estimated by computer analysis of confocal stack series. (A) shows that ECM components increase the colocalization of E-cadherin and actin as compared to plastic without ECM, as expressed in arbitrary units. (B) 3D reconstruction of cells grown on type IV collagen in the absence (a) or in the presence (b) of anti-ß1-integrin blocking antibody (bar, 10µm). The result is representative of three independent experiments. (C) Effect of anti-ß1-integrin blocking antibody on the colocalization of E-cadherin and actin in cells grown on LN2. (D) Effect of anti-{alpha}6-integrin blocking antibody on the colocalization of E-cadherin and actin in cells grown on native LN5-rich ECM. Note that anti-ß1 antibody treatment results in delocalization of the E-cadherin-actin in cells grown on native ECM, type IV collagen and LN2. Data, expressed as the percentage of control in absence of blocking antibody, are means ±s.e.m. of three independent cultures performed in triplicate. *, **, and *** differ from the control at P<0.05, P<0.01 and P<0.001, respectively.

 


    Discussion
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 Note in Proof
 References
 
Enterocyte differentiation is a dynamic process that takes place within a polarized epithelium migrating `en cohorte' from the proliferative compartment located in the crypt. Proliferative cells arise by successive asymmetric divisions from stem cells, which themselves are part of the polarized intestinal epithelium, the integrity of which is essential for its barrier function. The localization of stem cells at a fixed position within the crypt, the gradual loss of stem cell properties in the upwardly migrating cells and changes in cell adhesion to the ECM during cell migration toward the villus indicate that the cell environment may control differentiation through different attachment properties (Booth and Potten, 2000Go). The composition of ECM varies, as does the integrin repertoire expressed by enterocytes (Potten et al., 1997Go). At the same time, E-cadherin is mostly localized at the apical junctional complexes in the villus, contrary to the crypt (Hermiston et al., 1996Go). Altogether, these changes might allow enterocytes to glide over the basement membrane through a looser type of adhesion and might reinforce cell-cell junctions to perform the driving force.

In the present paper, we show in vitro that cell-ECM adhesion improves cell-cell adhesion through the reinforcement of E-cadherin—actin complexes at the level of adherens junctions in Caco-2 cells. This effect is specific for cell-ECM adhesion as it is antagonized by function-blocking anti-integrin antibodies.

In vitro, epithelial cells form polarized monolayers at confluence, even though full differentiation is not reached. Studying the influence of native ECM on the expression of the apoA-IV gene, an enterocytic marker, in Caco-2 cells we observed that the ECM boosted the formation of domes by the monolayer. Formation of domes by confluent epithelial cells cultured on a non-porous support signals the formation of an impermeable monolayer, which rises owing to the fluid accumulated underneath. This requires the setting of intercellular tight junctions, the activation of pumps for electrolytes and water and a decrease in adherence to the substrate. The formation of domes, while occurring spontaneously on plastic support (Pinto et al., 1983Go), has been shown to be enhanced by differentiation inducers such as dimethyl sulfoxide (DMSO) or 8-Br-cAMPC in LA7 epithelial cells (Zucchi et al., 1998Go). Here, time of dome formation, their number and size and monolayer tightness specifically depend on cell-ECM interactions, as FITC-labelled biotin penetrated much deeper between Caco-2 cells grown on plastic or polylysine as compared to cells grown on native ECM. It should be emphasized that the time for the delayed formation of domes by Caco-2 cells grown on plastic was compatible with the time necessary for the deposition of ECM material produced by Caco-2 cells themselves (Vachon and Beaulieu, 1995Go).

Assembly of tight junctions, as well as gap and desmosomal junctions, depends on E-cadherin recruitment at adherens junctions (Cereijido et al., 2000Go; Jongen et al., 1991Go; Matsuzaki et al., 1990Go; Mege et al., 1988Go; Fujimoto et al., 1997Go; Green et al., 1987Go; Gumbiner et al., 1988Go; van Hengel et al., 1997Go). Therefore, we investigated E-cadherin status in our cells. Native ECM did not affect the total amount of E-cadherin and of ß-catenin protein, as shown by biochemical analysis and confocal microscopy, but we demonstrated that ECM dramatically increases E-cadherin localization to the plasma membrane. Confocal microscopy revealed that, in cells grown on native LN5-rich ECM, the E-cadherin signal focused at the cell-cell junction domain in the upper third of the lateral membrane, where adherens junctions are known to be localized. Furthermore, the observation that ECM induced an increase in E-cadherin—actin colocalization suggests a reinforcement of E-cadherin anchoring to the actin cytoskeleton and a better organization of the subcortical network of actin by ECM. It is well established that tethering of E-cadherin to the actin cytoskeleton underlies strong cell-cell adhesion and is loosened in weak adhesion (Adams and Nelson, 1998Go; Kaibuchi et al., 1999bGo). The lateral membrane targeting of E-cadherin is produced not only by a native LN5-rich ECM but also by Col IV alone, which is a common component of all native ECMs (Rousselle and Garrone, 1998Go).

In our model, the coordinated reorganization of cell-cell adhesion and the F-actin cytoskeleton was produced by native laminin-5-enriched ECM as well as by type IV collagen or laminin 2, suggesting a common pathway of induction. We therefore questioned the role of ECM receptors expressed in Caco-2 cells (i.e. {alpha}3ß1 and {alpha}6ß4 integrins). Blocking experiments with anti-ß1-integrin or anti-{alpha}6-integrin antibodies in Caco-2 cells grown on ECM substrates resulted in a phenotype similar to that obtained on an inert support: a random distribution of E-cadherin along the basolateral membrane, a looser organisation of the F-actin network and a reduction in the merge signal from E-cadherin and F-actin cytoskeleton. These results demonstrate that recruitment of integrin receptors by their external ligands results in the reinforcement of E-cadherin—actin functional complexes. But, upon ligand binding, integrin linkage to the F-actin cytoskeleton is known to be reinforced (Calderwood et al., 2000Go). This apparent contradiction might be explained by the existence of distinct pools of F-actin forming functional complexes with E-cadherin and integrin. Alternatively, translocation of regulatory proteins from E-cadherin to integrin complexes has been proposed to mediate crosstalk between N-cadherin and ß1 integrin in neural retina explants (Arregui et al., 2000Go). Both hypotheses are challenged by the colocalization of E-cadherin and ß1 or ß4 integrin that we observed by confocal microscopy in the lateral membrane of Caco-2 cells grown on ECM, whereas no colocalization was found on an inert support. Such a colocalization of ß1 integrin and E-cadherin has already been reported at cell-cell junctions in keratinocytes (Braga et al., 1997Go), although keratinocytes form a different system in which integrin loses contact with ECM while migrating towards the superficial layers of this stratified epithelium, where E-cadherin finally downregulates integrin expression (Hodivala and Watt, 1994Go).

Our results favour cooperation between ligand-bound integrin and E-cadherin in the organization of the subcortical F-actin cytoskeleton. In accordance with our results, it has been shown in kidney epithelial cells that E-cadherin—catenin complexes at cell-cell junctions were not sufficient to maintain the subcortical F-actin cytoskeleton in the absence of {alpha}3ß1 integrin (Wang et al., 1999Go). Similarly, laminin-5-activated {alpha}3ß1 integrin has been demonstrated to promote gap junctional communication in keratinocytes (Lampe et al., 1998Go). In contrast, expression of ß1 integrin splice variants in ß1-deficient epithelium-like cells resulted in downregulation of cadherin function, disruption of cell-cell adhesion and induction of cell scattering (Gimond et al., 1999Go), all of which underlie the cell-type specificity of cadherin localization (Braga et al., 1999Go).

The extrinsic spatial cues mediated by cell-cell and cell-substratum adhesions and trophic factor signaling need to be coordinated to ensure a differentiated phenotype. The Rho family GTPases (Rho, Rac and Cdc42) are good candidates for a central role in coordinating adhesion systems. Rho GTPases have been demonstrated to intervene in the inside-outside control of cell-substrate adhesion (Calderwood et al., 2000Go). Reciprocally, Rho, Rac1 and Cdc42 play roles in parallel and convergent signaling pathways triggered by cell adhesion to an ECM substrate (Clark et al., 1998Go). The control of E-cadherin-mediated cell-cell adhesion by the Rho family GTPases and their modulators has been recently characterized in the context of epithelial-mesenchymal transition, where the loss of cell-cell junctions promotes cell migration (Braga et al., 1997Go; Hordijk et al., 1997Go; Takaishi et al., 1997Go; Kuroda et al., 1998Go; Braga et al., 1999Go; Fukata et al., 1999Go). At the same time, it was established that Rho GTPases play a key role in the control of actin polymerization, cell shape and motility (Kaibuchi et al., 1999aGo).

Our findings lend support to the notion that enterocyte differentiation is an active process supported by molecular crosstalk involving cell-ECM and cell-cell adhesions (Hermiston and Gordon, 1995Go). We report for the first time that integrin-dependent cell-ECM adhesion reinforces E-cadherin-dependent cell-cell adhesion in epithelial cells (see Note in Proof). This reinforcement most probably allows cell migration along the crypt to the villus of the intestinal epithelium (Hermiston et al., 1996Go). By contrast, it is well documented that cell migration is promoted by the loss of cell-cell junctions during the epithelial-mesenchymal transition of epithelial cells. Our results supports the hypothesis that crosstalk between integrin and cadherin, as well as regulation of E-cadherin localization and function, depends on the cell fate (Braga et al., 1999Go). The identification of the Rho GTPase and its partners that are involved in the network will contribute to the understanding of the mechanisms set up at the crypt-to-villus transition checkpoint. Coordinated changes in ECM components, integrin repertoire and E-cadherin localization might also result in migration of differentiating enterocytes along the crypt-to-villus axis.


    Note in Proof
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 Note in Proof
 References
 
A similar conclusion was drawn from experiments performed in fibroblasts and recently published in this journal (Whittard and Akiyama, 2001aGo; Whittard and Akiyama, 2001bGo).


    Acknowledgments
 
We would like to acknowledge financial support from Université Paris VI, INSERM and CNRS. This work was performed using IFR 58 facilities. Cyrille Schreider is recipient of a fellowship from MRT then FRM (Fondation pour la Recherche Médicale). We would like to thank Christophe Klein (IFR 58) for excellent technical assistance.


    References
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 Note in Proof
 References
 

Aberle, H., Butz, S., Stappert, J., Weissig, H., Kemler, R. and Hoschuetzky, H. (1994). Assembly of the cadherin-catenin complex in vitro with recombinant proteins. J. Cell Sci. 107,3655 -3663.[Abstract]

Adams, C. L. and Nelson, W. J. (1998). Cytomechanics of cadherin-mediated cell-cell adhesion. Curr. Opin. Cell Biol. 10,572 -577.[Medline]

Arregui, C., Pathre, P., Lilien, J. and Balsamo, J. (2000). The nonreceptor tyrosine kinase fer mediates cross-talk between N-cadherin and beta 1-integrins. J. Cell Biol. 149,1263 -1274.[Abstract/Free Full Text]

Beaulieu, J. F. (1992). Differential expression of the VLA family of integrins along the crypt-villus axis in the human small intestine. J. Cell Sci. 102,427 -36.[Abstract/Free Full Text]

Beaulieu, J. F. (1997). Extracellular matrix components and integrins in relationship to human intestinal epithelial cell differentiation. Prog. Histochem. Cytochem. 31, 1-78.[Medline]

Beaulieu, J. F. (1999). Integrins and human intestinal cell functions. Front. Biosci. 4,D310 -D321.[Medline]

Bissell, M. J., Hall, H. G. and Parry, G. (1982). How does the extracellular matrix direct gene expression? J. Theor. Biol. 99,31 -68.[Medline]

Booth, C. and Potten, C. S. (2000). Gut instincts: thoughts on intestinal epithelial stem cells. J. Clin. Invest. 105,1493 -1499.[Medline]

Boudreau, N. and Bissell, M. J. (1998). Extracellular matrix signaling: integration of form and function in normal and malignant cells. Curr. Opin. Cell Biol. 10,640 -646.[Medline]

Braga, V. M., Machesky, L. M., Hall, A. and Hotchin, N. A. (1997). The small GTPases Rho and Rac are required for the establishment of cadherin-dependent cell-cell contacts. J. Cell Biol. 137,1421 -1431.[Abstract/Free Full Text]

Braga, V. M., Del Maschio, A., Machesky, L. and Dejana, E. (1999). Regulation of cadherin function by Rho and Rac: modulation by junction maturation and cellular context. Mol. Biol. Cell 10,9 -22.[Abstract/Free Full Text]

Calderwood, D. A., Shattil, S. J. and Ginsberg, M. H. (2000). Integrins and actin filaments: reciprocal regulation of cell adhesion and signaling. J. Biol. Chem. 275,22607 -22610.[Free Full Text]

Cereijido, M., Shoshani, L. and Contreras, R. G. (2000). Molecular physiology and pathophysiology of tight junctions. I. Biogenesis of tight junctions and epithelial polarity. Am. J. Physiol. Gastrointest. Liver Physiol. 279,G477 -G482.[Abstract/Free Full Text]

Chen, Y. T., Stewart, D. B. and Nelson, W. J. (1999). Coupling assembly of the E-cadherin/beta-catenin complex to efficient endoplasmic reticulum exit and basal-lateral membrane targeting of E-cadherin in polarized MDCK cells. J. Cell Biol. 144,687 -699.[Abstract/Free Full Text]

Clark, E. A., King, W. G., Brugge, J. S., Symons, M. and Hynes, R. O. (1998). Integrin-mediated signals regulated by members of the rho family of GTPases. J. Cell Biol. 142,573 -586.[Abstract/Free Full Text]

De Arcangelis, A., Neuville, P., Boukamel, R., Lefebvre, O., Kedinger, M. and Simon-Assmann, P. (1996). Inhibition of laminin alpha 1-chain expression leads to alteration of basement membrane assembly and cell differentiation. J. Cell Biol. 133,417 -430.[Abstract/Free Full Text]

Fleischmajer, R., Utani, A., MacDonald, E. D., Perlish, J. S., Pan, T. C., Chu, M. L., Nomizu, M., Ninomiya, Y. and Yamada, Y. (1998). Initiation of skin basement membrane formation at the epidermo-dermal interface involves assembly of laminins through binding to cell membrane receptors. J. Cell Sci. 111,1929 -1940.[Abstract]

Fritsch, C., Orian-Rousseaul, V., Lefebvre, O., Simon-Assmann, P., Reimund, J. M., Duclos, B. and Kedinger, M. (1999). Characterization of human intestinal stromal cell lines: response to cytokines and interactions with epithelial cells. Exp. Cell Res. 248,391 -406.[Medline]

Fujimoto, K., Nagafuchi, A., Tsukita, S., Kuraoka, A., Ohokuma, A. and Shibata, Y. (1997). Dynamics of connexins, E-cadherin and alpha-catenin on cell membranes during gap junction formation. J. Cell Sci. 110,311 -322.[Abstract]

Fukata, M., Nakagawa, M., Kuroda, S. and Kaibuchi, K. (1999). Cell adhesion and Rho small GTPases. J. Cell Sci. 112,4491 -4500.[Abstract]

Gimond, C., van Der Flier, A., van Delft, S., Brakebusch, C., Kuikman, I., Collard, J. G., Fassler, R. and Sonnenberg, A. (1999). Induction of cell scattering by expression of betal integrins in beta 1-deficient epithelial cells requires activation of members of the rho family of GTPases and downregulation of cadherin and catenin function. J. Cell Biol. 147,1325 -1340.[Abstract/Free Full Text]

Green, K. J., Geiger, B., Jones, J. C., Talian, J. C. and Goldman, R. D. (1987). The relationship between intermediate filaments and microfilaments before and during the formation of desmosomes and adherens-type junctions in mouse epidermal keratinocytes. J. Cell Biol. 104,1389 -1402.[Abstract/Free Full Text]

Gumbiner, B., Stevenson, B. and Grimaldi, A. (1988). The role of the cell adhesion molecule uvomorulin in the formation and maintenance of the epithelial junctional complex. J. Cell Biol. 107,1575 -1587.[Abstract/Free Full Text]

Gumbiner, B. M. (1996). Cell adhesion: the molecular basis of tissue architecture and morphogenesis. Cell 84,345 -357.[Medline]

Hermiston, M. L. and Gordon, J. I. (1995). In vivo analysis of cadherin function in the mouse intestinal epithelium: essential roles in adhesion, maintenance of differentiation, and regulation of programmed cell death. J. Cell Biol. 129,489 -506.[Abstract/Free Full Text]

Hermiston, M. L., Wong, M. H. and Gordon, J. I. (1996). Forced expression of E-cadherin in the mouse intestinal epithelium slows cell migration and provides evidence for nonautonomous regulation of cell fate in a self-renewing system. Genes Dev. 10,985 -996.[Abstract/Free Full Text]

Hodivala, K. J. and Watt, F. M. (1994). Evidence that cadherins play a role in the downregulation of integrin expression that occurs during keratinocyte terminal differentiation. J. Cell Biol. 124,589 -600.[Abstract/Free Full Text]

Hoffman, M. P., Kibbey, M. C., Letterio, J. J. and Kleinman, H. K. (1996). Role of laminin-1 and TGF-beta 3 in acinar differentiation of a human submandibular gland cell line (HSG). J. Cell Sci. 109,2013 -2021.[Abstract]

Hordijk, P. L., ten Klooster, J. P., van der Kammen, R. A., Michiels, F., Oomen, L. C. and Collard, J. G. (1997). Inhibition of invasion of epithelial cells by Tiam 1-Rac signaling. Science 278,1464 -1466.[Abstract/Free Full Text]

Hynes, R. O. (1987). Integrins: a family of cell surface receptors. Cell 48,549 -554.[Medline]

Jongen, W. M., Fitzgerald, D. J., Asamoto, M., Piccoli, C., Slaga, T. J., Gros, D., Takeichi, M. and Yamasaki, H. (1991). Regulation of connexin 43-mediated gap junctional intercellular communication by Ca2+ in mouse epidermal cells is controlled by E-cadherin. J. Cell Biol. 114,545 -555.[Abstract/Free Full Text]

Jou, T. S., Stewart, D. B., Stappert, J., Nelson, W. J. and Marrs, J. A. (1995). Genetic and biochemical dissection of protein linkages in the cadherin-catenin complex. Proc. Natl. Acad. Sci. USA 92,5067 -5071.[Abstract/Free Full Text]

Kaibuchi, K., Kuroda, S. and Amano, M. (1999a). Regulation of the cytoskeleton and cell adhesion by the Rho family GTPases in mammalian cells. Annu. Rev. Biochem. 68,459 -486.[Medline]

Kaibuchi, K., Kuroda, S., Fukata, M. and Nakagawa, M. (1999b). Regulation of cadherin-mediated cell-cell adhesion by the Rho family GTPases. Curr. Opin. Cell Biol. 11,591 -596.[Medline]

Kemler, R. (1992). Classical cadherins. Semin. Cell Biol. 3,149 -155.[Medline]

Klein, G., Ekblom, M., Fecker, L., Timpl, R. and Ekblom, P. (1990). Differential expression of laminin A and B chains during development of embryonic mouse organs. Development 110,823 -837.[Abstract/Free Full Text]

Kuroda, S., Fukata, M., Nakagawa, M., Fujii, K., Nakamura, T., Ookubo, T., Izawa, I., Nagase, T., Nomura, N., Tani, H. et al. (1998). Role of IQGAP1, a target of the small GTPases Cdc42 and Rac1, in regulation of E-cadherin- mediated cell-cell adhesion. Science 281,832 -835.[Abstract/Free Full Text]

Lampe, P. D., Nguyen, B. P., Gil, S., Usui, M., Olerud, J., Takada, Y. and Carter, W. G. (1998). Cellular interaction of integrin alpha3beta1 with laminin 5 promotes gap junctional communication. J. Cell Biol. 143,1735 -1747.[Abstract/Free Full Text]

Larjava, H., Peltonen, J., Akiyama, S. K., Yamada, S. S., Gralnick, H. R., Uitto, J. and Yamada, K. M. (1990). Novel function for beta 1 integrins in keratinocyte cell-cell interactions. J. Cell Biol. 110,803 -815.[Abstract/Free Full Text]

Le Beyec, J., Delers, F., Jourdant, F., Schreider, C., Chambaz, J., Cardot, P. and Pincon-Raymond, M. (1997). A complete epithelial organization of Caco-2 cells induces I-FABP and potentializes apolipoprotein gene expression. Exp. Cell Res. 236,311 -320.[Medline]

Lesuffleur, T., Barbat, A., Dussaulx, E. and Zweibaum, A. (1990). Growth adaptation to methotrexate of HT-29 human colon carcinoma cells is associated with their ability to differentiate into columnar absorptive and mucus-secreting cells. Cancer Res. 50,6334 -6343.[Abstract/Free Full Text]

Li, M. L., Aggeler, J., Farson, D. A., Hatier, C., Hassell, J. and Bissell, M. J. (1987). Influence of a reconstituted basement membrane and its components on casein gene expression and secretion in mouse mammary epithelial cells. Proc. Natl. Acad. Sci. USA 84,136 -140.[Abstract/Free Full Text]

Lorentz, O., Duluc, I., Arcangelis, A. D., Simon-Assmann, P., Kedinger, M. and Freund, J. N. (1997). Key role of the Cdx2 homeobox gene in extracellular matrix-mediated intestinal cell differentiation. J. Cell Biol. 139,1553 -1565.[Abstract/Free Full Text]

Machesky, L. M. and Hall, A. (1997). Role of actin polymerization and adhesion to extracellular matrix in Rac- and Rho-induced cytoskeletal reorganization. J. Cell Biol. 138,913 -926.[Abstract/Free Full Text]

Matsuzaki, F., Mege, R. M., Jaffe, S. H., Friedlander, D. R., Gallin, W. J., Goldberg, J. I., Cunningham, B. A. and Edelman, G. M. (1990). cDNAs of cell adhesion molecules of different specificity induce changes in cell shape and border formation in cultured S180 cells. J. Cell Biol. 110,1239 -1252.[Abstract/Free Full Text]

Matter, M. L. and Laurie, G. W. (1994). A novel laminin E8 cell adhesion site required for lung alveolar formation in vitro. J. Cell Biol. 124,1083 -1090.[Abstract/Free Full Text]

Mege, R. M., Matsuzaki, F., Gallin, W. J., Goldberg, J. I., Cunningham, B. A. and Edelman, G. M. (1988). Construction of epithelioid sheets by transfection of mouse sarcoma cells with cDNAs for chicken cell adhesion molecules. Proc. Natl. Acad. Sci. USA 85,7274 -7278.[Abstract/Free Full Text]

Orian-Rousseau, V., Aberdam, D., Rousselle, P., Messent, A., Gavrilovic, J., Meneguzzi, G., Kedinger, M. and Simon-Assmann, P. (1998). Human colonic cancer cells synthesize and adhere to laminin-5. Their adhesion to laminin-5 involves multiple receptors among which is integrin alpha2beta1. J. Cell Sci. 111,1993 -2004.[Abstract]

Patton, B. L., Miner, J. H., Chiu, A. Y. and Sanes, J. R. (1997). Distribution and function of laminins in the neuromuscular system of developing, adult, and mutant mice. J. Cell Biol. 139,1507 -1521.[Abstract/Free Full Text]

Pincon-Raymond, M., Vicart, P., Bois, P., Chassande, O., Romey, G., Varadi, G., Li, Z. L., Lazdunski, M., Rieger, F. and Paulin, D. (1991). Conditional immortalization of normal and dysgenic mouse muscle cells by the SV40 large T antigen under the vimentin promoter control. Dev. Biol. 148,517 -528.[Medline]

Pinto, M., Robine-Leon, S., Appay, M. D., Kedinger, M., Triadou, N., Dussaulx, E., Lacroix, B., Simon-Assmann, P., Haffen, K., Fogh, J. et al. (1983). Enterocyte-like differentiation and polarization of the human colon carcinoma cell line Caco-2 in culture. Biol. Cell 47,323 -330.

Potten, C. S., Booth, C. and Pritchard, D. M. (1997). The intestinal epithelial stem cell: the mucosal governor. Int. J. Exp. Pathol. 78,219 -243.[Medline]

Rao, J. S., Beach, R. L. and Festoff, B. W. (1985). Extracellular matrix (ECM) synthesis in muscle cell cultures: quantitative and qualitative studies during myogenesis. Biochem. Biophys. Res. Commun. 130,440 -446.[Medline]

Rousselle, P. and Garrone, R. (1998). [Collagen and laminin: which messages for which cells?]. Pathol Biol (Paris) 46,543 -554.[Medline]

Sako, Y., Nagafuchi, A., Tsukita, S., Takeichi, M. and Kusumi, A. (1998). Cytoplasmic regulation of the movement of E-cadherin on the free cell surface as studied by optical tweezers and single particle tracking: corralling and tethering by the membrane skeleton. J. Cell Biol. 140,1227 -1240.[Abstract/Free Full Text]

Sander, E. E., van Delft, S., ten Klooster, J. P., Reid, T., van der Kammen, R. A., Michiels, F. and Collard, J. G. (1998). Matrix-dependent Tiam1/Rac signaling in epithelial cells promotes either cell-cell adhesion or cell migration and is regulated by phosphatidylinositol 3-kinase. J. Cell Biol. 143,1385 -1398.[Abstract/Free Full Text]

Simon-Assmann, P. and Kedinger, M. (1993). Heterotypic cellular cooperation in gut morphogenesis and differentiation. Semin. Cell Biol. 4,221 -230.[Medline]

Simon-Assmann, P., Lefebvre, O., Bellissent-Waydelich, A., Olsen, J., Orian-Rousseau, V. and De Arcangelis, A. (1998). The laminins: role in intestinal morphogenesis and differentiation. Ann. N Y Acad. Sci. 859,46 -64.[Medline]

Skoudy, A., Llosas, M. D. and Garcia de Herreros, A. (1996). Intestinal HT-29 cells with dysfunction of E-cadherin show increased pp60src activity and tyrosine phosphorylation of p120-catenin. Biochem. J. 317,279 -284.

Takaishi, K., Sasaki, T., Kotani, H., Nishioka, H. and Takai, Y. (1997). Regulation of cell-cell adhesion by rac and rho small G proteins in MDCK cells. J. Cell Biol. 139,1047 -1059.[Abstract/Free Full Text]

Tsukita, S., Nagafuchi, A. and Yonemura, S. (1992). Molecular linkage between cadherins and actin filaments in cell-cell adherens junctions. Curr. Opin. Cell Biol. 4,834 -839.[Medline]

Vachon, P. H. and Beaulieu, J. F. (1995). Extracellular heterotrimeric laminin promotes differentiation in human enterocytes. Am. J. Physiol. 268,G857 -G867.[Abstract/Free Full Text]

Vachon, P. H., Durand, J. and Beaulieu, J. F. (1993). Basement membrane formation and re-distribution of the beta 1 integrins in a human intestinal co-culture system. Anat. Rec. 235,567 -576.[Medline]

Vachon, P. H., Loechel, F., Xu, H., Wewer, U. M. and Engvall, E. (1996). Merosin and laminin in myogenesis; specific requirement for merosin in myotube stability and survival. J. Cell Biol. 134,1483 -1497.[Abstract/Free Full Text]

van Hengel, J., Gohon, L., Bruyneel, E., Vermeulen, S., Cornelissen, M., Mareel, M. and von Roy, F. (1997). Protein kinase C activation upregulates intercellular adhesion of alpha-catenin-negative human colon cancer cell variants via induction of desmosomes. J. Cell Biol. 137,1103 -1116.[Abstract/Free Full Text]

Velling, T., Tiger, C. F., Ekblom, P. and Gullberg, D. (1999). Laminin alpha chains in colon carcinoma cell lines: detection of a truncated laminin alpha1 mRNA in Caco-2 cells. Exp. Cell Res. 248,627 -633.[Medline]

Wang, Z., Symons, J. M., Goldstein, S. L., McDonald, A., Miner, J. H. and Kreidberg, J. A. (1999). (Alpha)3(beta)1 integrin regulates epithelial cytoskeletal organization. J. Cell Sci. 112,2925 -2935.[Abstract]

Weaver, V. M., Petersen, O. W., Wang, F., Larabell, C. A., Briand, P., Damsky, C. and Bissell, M. J. (1997). Reversion of the malignant phenotype of human breast cells in three-dimensional culture and in vivo by integrin blocking antibodies. J. Cell Biol. 137,231 -245.[Abstract/Free Full Text]

Whittard, J. D. and Akiyama, S. K. (2001a). Activation of beta1 integrins induces cell-cell adhesion. Exp. Cell Res. 263,65 -76.[Medline]

Whittard, J. D. and Akiyama, S. K. (2001b). Positive regulation of cell-cell and cell-substrate adhesion by protein kinase A. J. Cell Sci. 114,3265 -3272.[Abstract/Free Full Text]

Yamada, K. M. and Geiger, B. (1997). Molecular interactions in cell adhesion complexes. Curr. Opin. Cell Biol. 9,76 -85.[Medline]

Yamada, K. M. and Miyamoto, S. (1995). Integrin transmembrane signaling and cytoskeletal control. Curr. Opin. Cell Biol. 7,681 -689.[Medline]

Zucchi, I., Montagna, C., Susani, L., Vezzoni, P. and Dulbecco, R. (1998). The rat gene homologous to the human gene 9-27 is involved in the development of the mammary gland. Proc. Natl. Acad. Sci. USA 95,1079 -1084.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
O. Beaslas, F. Torreilles, P. Casellas, D. Simon, G. Fabre, M. Lacasa, F. Delers, J. Chambaz, M. Rousset, and V. Carriere
Transcriptome response of enterocytes to dietary lipids: impact on cell architecture, signaling, and metabolism genes
Am J Physiol Gastrointest Liver Physiol, November 1, 2008; 295(5): G942 - G952.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
Y. Imanishi, B. Hu, M. J. Jarzynka, P. Guo, E. Elishaev, I. Bar-Joseph, and S.-Y. Cheng
Angiopoietin-2 Stimulates Breast Cancer Metastasis through the {alpha}5{beta}1 Integrin-Mediated Pathway
Cancer Res., May 1, 2007; 67(9): 4254 - 4263.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
M. Ozaki, H. Ogita, and Y. Takai
Involvement of integrin-induced activation of protein kinase C in the formation of adherens junctions
Genes Cells, May 1, 2007; 12(5): 651 - 662.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Sakamoto, H. Ogita, T. Hirota, T. Kawakatsu, T. Fukuyama, M. Yasumi, N. Kanzaki, M. Ozaki, and Y. Takai
Interaction of Integrin {alpha}vbeta3 with Nectin: IMPLICATION IN CROSS-TALK BETWEEN CELL-MATRIX AND CELL-CELL JUNCTIONS
J. Biol. Chem., July 14, 2006; 281(28): 19631 - 19644.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
M. S. Filla, A. Woods, P. L. Kaufman, and D. M. Peters
{beta}1 and {beta}3 Integrins Cooperate to Induce Syndecan-4-Containing Cross-linked Actin Networks in Human Trabecular Meshwork Cells
Invest. Ophthalmol. Vis. Sci., May 1, 2006; 47(5): 1956 - 1967.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. Peignon, S. Thenet, C. Schreider, S. Fouquet, A. Ribeiro, E. Dussaulx, J. Chambaz, P. Cardot, M. Pincon-Raymond, and J. Le Beyec
E-cadherin-dependent Transcriptional Control of Apolipoprotein A-IV Gene Expression in Intestinal Epithelial Cells: A ROLE FOR THE HEPATIC NUCLEAR FACTOR 4
J. Biol. Chem., February 10, 2006; 281(6): 3560 - 3568.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
N. T. Chartier, M. Laine, S. Gout, G. Pawlak, C. A. Marie, P. Matos, M. R. Block, and M. R. Jacquier-Sarlin
Laminin-5-integrin interaction signals through PI 3-kinase and Rac1b to promote assembly of adherens junctions in HT-29 cells
J. Cell Sci., January 1, 2006; 119(1): 31 - 46.
[Abstract] [Full Text] [PDF]


Home page
J. Exp. Biol.Home page
I. R. Ares, M. C. Louzao, M. R. Vieytes, T. Yasumoto, and L. M. Botana
Actin cytoskeleton of rabbit intestinal cells is a target for potent marine phycotoxins
J. Exp. Biol., November 15, 2005; 208(22): 4345 - 4354.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Fouquet, V.-H. Lugo-Martinez, A.-M. Faussat, F. Renaud, P. Cardot, J. Chambaz, M. Pincon-Raymond, and S. Thenet
Early Loss of E-cadherin from Cell-Cell Contacts Is Involved in the Onset of Anoikis in Enterocytes
J. Biol. Chem., October 8, 2004; 279(41): 43061 - 43069.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Orru, I. Caputo, A. D'Amato, M. Ruoppolo, and C. Esposito
Proteomics Identification of Acyl-acceptor and Acyl-donor Substrates for Transglutaminase in a Human Intestinal Epithelial Cell Line: IMPLICATIONS FOR CELIAC DISEASE
J. Biol. Chem., August 22, 2003; 278(34): 31766 - 31773.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schreider, C.
Right arrow Articles by Pinçon-Raymond, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schreider, C.
Right arrow Articles by Pinçon-Raymond, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?