|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
Research Article |
INSERM U505, Université Pierre et Marie Curie, EPHE, 15 rue de l'Ecole de Médecine, 75006 Paris, France
Author for correspondence (e-mail: pincon{at}ccr.jussieu.fr)
Accepted 25 October 2001
| Summary |
|---|
|
|
|---|
6-integrin antibodies and directly induced by a stimulating
anti-ß1-integrin antibody. These results demonstrate that
integrin-dependent cell to ECM adhesion reinforces E-cadherin-dependent
cell-cell adhesion in Caco-2 cells and further support the notion that
enterocyte differentiation is supported by a molecular crosstalk between the
two adhesion systems of the cell.
Key words: Caco-2 cells, ß1 integrin, E-cadherin, Extracellular matrix, Actin cytoskeleton
| Introduction |
|---|
|
|
|---|
The basement membrane is mostly composed of type IV collagen, different
types of laminins, entactin and heparan sulfate proteoglycan
(Beaulieu, 1997
). ECM
molecules, originating from both epithelial and underlying mesenchymal cells,
create a framework that is essential for maintaining tissue integrity
(Simon-Assmann and Kedinger,
1993
). Besides this structural role, ECM proteins are involved in
the control of adhesion, migration, proliferation, differentiation and gene
expression of adjacent cells, which emphasizes the dynamic reciprocity between
epithelial and mesenchymal cells (Bissell
et al., 1982
). Additionally, ECM is able to control the effects of
trophic factors by sequestration outside of the cell
(Simon-Assmann et al., 1998
)
and by crosstalk between their signaling pathways
(Yamada and Geiger, 1997
). It
is admitted that cell adhesion to the ECM contributes to the apical-to-basal
axis of polarity, in vivo as well as in vitro. Appearance of polarized cells
coincides with the expression of laminin 1 (LN1) in the developing kidney
(Klein et al., 1990
).
Similarly, the addition of laminin boosts the formation of polarized alveoles
in various types of epithelial cells, including mouse mammary
(Li et al., 1987
), human
salivary (Hoffman et al.,
1996
) and rat lung (Matter and
Laurie, 1994
) cells in culture. ECM-integrin interactions have
either been demonstrated to be directly involved in ECM control of cell
functions or found to be aberrant in embryos or animals carrying mutations in
integrin genes (Wang et al.,
1999
).
Both cell-ECM and cell-cell adhesion systems are connected to the
cytoskeleton, which controls cell polarization. Numerous studies have
established that the interaction between ECM and integrin results in
cytoskeletal rearrangements (Larjava et
al., 1990
; Wang et al.,
1999
). Integrins are heterodimeric transmembrane receptors
composed of
and ß subunits associated in a noncovalent manner
(Hynes, 1987
;
Yamada and Miyamoto, 1995
).
Integrin initiates, through its ß1 cytoplasmic domain, the assembly of
specialized cytoskeletal and signaling protein complexes at the contacting
membrane (Gimond et al.,
1999
). In the same way, epithelial cells forming strong cell-cell
junctions assemble a subcortical actin skeleton instead of focal adhesion and
actin stress fibers (Larjava et al.,
1990
). Cadherins are also dependent on cytoskeletal organization
(Tsukita et al., 1992
);
correct function of the E-cadherincatenin complex requires association
with the cytoskeleton (Skoudy et al.,
1996
). In epithelial cells, about one half of plasma membrane
E-cadherin is connected to the actin cytokeleton: the rest is free within the
membrane (Sako et al., 1998
).
The linkage between E-cadherin and the F-actin cytoskeleton is mediated
through direct binding of the cytoplasmic domain of E-cadherin to
ß-catenin, which binds to
-catenin
(Aberle et al., 1994
;
Jou et al., 1995
) in a 1:1:1
stochiometry. Crosstalk between the two adhesion systems has also been
demonstrated in mammary epithelial cells through the integrin signaling
pathway. In these cells, integrins promote the formation of morphologically
differentiated acini-like structures, which involves the assembly of adherens
junctions through the relocalization of E-cadherin at the lateral side of the
cells (Weaver et al.,
1997
).
The mammalian intestinal epithelium is peculiar in that it is a constantly
renewing monocellular epithelium, which migrates `en cohorte' along the
basement membrane from the proliferative undifferentiated compartment in the
crypts to the tips of the villi. Enterocytes can probably glide over the
basement membrane through loose adhesion, through them being tied to each
other by strong cell-cell junctions. Whereas type IV collagen is constantly
present in the basement membrane, LN2 is preferentially found in the
proliferative compartment, LN5 in the villus and LN1 at the junction of the
two compartments (Vachon et al.,
1993
; Lorentz et al.,
1997
). Similarly, villus and crypt epithelial cells display a
different pattern of integrins, ß1-containing integrins being more
abundant in the villi than in the crypts. Furthermore, ß1 is mainly
associated with
2 in the crypt and with
3 integrins in the
villus (Beaulieu, 1992
).
Whereas
2ß1 integrin preferentially binds to collagen IV but also
to LN1 and LN2,
3ß1 integrin binds to both collagen IV and LN5
(Beaulieu, 1999
;
Rousselle and Garrone, 1998
).
Integrin
6ß4 binds to both LN1 and LN5
(Fleischmajer et al., 1998
).
This differential pattern of expression of ECM proteins and their receptors
along the crypt-to-villus axis parallels the differentiation process of
epithelial cells. One can wonder whether changes in ECM-integrin interactions
at the crypt to villus junction are accompanied by changes in cell-cell
adhesion, which allow cell migration to the tip of the villus.
The colon cancer Caco-2 cell line in culture mimics enterocyte
differentiation. We previously showed that ECM was required for the expression
of the apoA-IV gene, an intestinal differentiation marker
(Le Beyec et al., 1997
). Here,
we observed that the functional polarization of Caco-2 cells, assessed by dome
formation and permeability of the monolayer, is under the control of
integrin-mediated adhesion to ECM. Furthermore, we demonstrate that integrin
activation by ECM reinforces cell-cell adhesion by targeting E-cadherin at the
lateral membrane in functional complexes with actin cytoskeleton.
| Materials and Methods |
|---|
|
|
|---|
6
(NKI-GoH3) human integrins with a blocking activity and anti-ß1-integrin
(B3B11) with a stimulating activity and purified control mouse anti-IgG
(Chemicon); polyclonal anti-human E-cadherin (HECD-1) (Zymed); monoclonal
anti-ß-catenin (clone 14) (Transduction Laboratories); FITC-labeled
antibodies (Sigma) and RITC-labeled antibodies (Boehringer). TRITC- or
FITC-labeled phalloidin (Sigma) was used to visualize the actin cytoskeleton.
We also used human merosin LN2 (Gibco) and mouse collagen type IV and
synthetic poly-D-lysine (Becton-Dickinson).
Cell culture
Caco-2 cells (43rd to 50th passage) and HT29 cells
adapted to 10-5 M of methotrexate
(Lesuffleur et al., 1990
) and
cultured without the drug and named HT29-MTX (9th passage) were
cultured at 37°C with 10% CO2 in Dulbecco's minimal essential
medium (DMEM), 25 mM glucose (Gibco), pen/strept (50 µg/ml) and
non-essential amino acid (1%) (Gibco) supplemented with 5% foetal calf serum
(Boehringer). Mesenchymal intestinal cells C9, C11, C20 obtained from M.
Kedinger (Fritsch et al.,
1999
) (28th, 29th and 14th
passages, respectively) were cultured at 37°C with 7.5% CO2 in
RPMI 1640 medium, pen/strept (50 µg/ml) (Gibco), supplemented with 10%
foetal calf serum (Boehringer). Muscle 129CB3 cells were cultured as described
(Pinçon-Raymond
et al., 1991
) to form contracting myotubes and secrete a large
amount of ECM.
Extracellular matrix preparation and coating
Native ECM was prepared from 129CB3 myotubes, mesenchymal C9, C11, C20
cells (at confluence), HT29-MTX cells (3 days postconfluence) or Caco-2 cells
(12d post-confluence) as described previously
(Le Beyec et al., 1997
).
Coating of plastic petri dishes was performed by overnight incubation with
poly-D-lysine, 5 µg/cm2, collagen type IV, 10
µg/cm2 and merosin LN2, 8.4 µg/cm2 at 4°C.
Perturbation experiments
Caco-2 cells were seeded at 125,000 cells/cm2 (pre-confluence)
in 24-well plates coated or not with native ECM or ECM components. At the time
of plating, cells were mixed with control mouse IgG or anti-ß1-integrin
monoclonal blocking antibody (6S6) or anti-
6-integrin used to block
ß4 integrin (CD49F) or anti-E-cadherin monoclonal blocking antibody
(HECD-1) at the indicated dilutions. Under these conditions, control cells
were confluent within 24 hours. For each kinetics experiment, triplicate wells
were observed using a phase contrast microscope. Confluence was evaluated, and
counting triplicate wells on a phase contrast microscope numerated the
domes.
Ribonuclease protection assay
A specific 400 bp cDNA encoding the human apoA-IV gene was
obtained by RT-PCR using the coding oligonucleotide HindIII-AIV
(5'-CTGGAGAAGCTT+149ACACTTACGCAGGTGACCTG-CAG+171-3')
and the noncoding oligonucleotide Xba-AIV
(5'-CT-GCAGTCTAGA+550AGGGCGTAAGGCGTCCCTTGA+530-3').
The PCR product was digested using XbaI and HindIII, and
ligated into the XbaI/HindIII-digested PSK vector to obtain
the pAIV-RPA plasmid. For E-cadherin mRNA analysis, a specific 407 bp cDNA
encoding the human E-cadherin gene was obtained using the coding
oligonucleotide
(5'-+2660GACCAGGACTATGACTACTTG-AACG+2684-3')
and the noncoding oligonucleotide
(5'-+3067ATC-TGCAAGGTGCTGGGTGAACCTT+3043-3')
inserted into PCR 2.1 vector. An antisense AIV RNA probe (445 bp) was
generated by in vitro transcription of the HindIII-digested pAIV-RPA
plasmid using [
-32P]UTP and T3 RNA polymerase (Promega). An
antisense E-cadherin RNA probe (523 bp) was generated by in vitro
transcription of the kpn1-digested E-cadherin-PCR2.1 plasmid using
[
-32P]UTP and T7 RNA polymerase (Promega). An antisense
ß-actin RNA probe (Human Internal Standards kit, Ambion Inc.) was
synthesized with T3 as an internal control. Total RNA was extracted from cells
using an RNAzol kit (Bioprobe Systems). Equal amounts (6 µg) of total RNA
samples were subjected to the RNase protection assay using the RPAII kit
(Ambion Inc) following the manufacturer's recommendations. The protected A-IV
RNA (400 bp), E-cadherin RNA (407 bp) and ß-actin RNA (245 bp) probes
were separated on a 5% denaturing polyacrylamide-urea gel in Tris borate-EDTA
buffer. The gel was dried and exposed to X-ray film at -80°C.
Cell surface biotinylation
Caco-2 cells were seeded on plastic coated or uncoated dishes with native
ECM or ECM components and grown for 6 days. All manipulations were performed
at 4°C according to Sander et al.
(Sander et al., 1998
).
Briefly, cells were incubated for 15 minutes in phosphate-buffered saline
(supplemented with 1 mM MgCl2 and 0.5 mM CaCl2)
containing 500 µg/ml sulfo-NHS-biotin (Pierce Chemical Co.), washed three
times in phosphate-buffered saline containing 50 mM glycine, pH 7.4, lysed in
RIPA buffer (50 mM Tris-HCl, pH 7.5, 150 mM NaCl, 1% Nonidet P40, 0.5% sodium
deoxycholate, 0.1% SDS, protease inhibitors, 10% glycerol, 1 mM EDTA, 3 mM
MgCl2, 1 mM dithiothreitol) and centrifuged for 15 minutes at
13,000 g. The supernatant was incubated with avidin-coated
agarose beads (Sigma Chemical Co.) for 1 hour. Immunoprecipitates of
biotinylated surface proteins bound to avidin-agarose were washed five times
in RIPA buffer and analysed for E-cadherin (HECD-1) by western blotting.
Western blotting
The protein concentration of Caco-2 lysates, biotinylated or not, was
assessed by the Biorad `Dc' protein assay. A 20 µg aliquot of each sample
mixed with Laëmmli buffer was boiled and
submitted to 7% SDS polyacrylamide gel electrophoresis. Samples were then
transferred onto nitrocellulose and blocked in 1% non-fat milk overnight at
4°C. After a 2 hour incubation with the primary antibody in the blocking
solution at room temperature, blots were washed in PBS 1x pH 7.4,
incubated with appropriate HRP-conjugated secondary antibody and washed again.
The blots were visualized by chemiluminescence (Amersham ECL system). Signals
were scanned (Umax vistaScan S6E) from chemiluminescence into Adobe
Photoshop.
Immunofluorescence studies
Caco-2 cells were grown on Lab-Tek chambered borosilicate coverglasses
(Nunc), coated or not with native ECM or ECM components. At the indicated
time, cells were fixed in 4% paraformaldehyde in phosphate-buffer saline, then
permeabilised in 0.1% Triton X-100 during all incubations. Non-specific
antigens were blocked for 30 minutes in 3% bovine serum albumin. Double
labeling was performed sequentially to avoid crossreactions.
Anti-ß1-integrin (6S6) primary antibodies diluted in the blocking
solution were incubated for 1 hour 30 minutes, followed by a 1 hour 30 minute
incubation with RITC-labeled secondary antibodies, followed by overnight
incubation at 4°C with an anti-E-cadherin antibody (HECD-1). These
antibodies were visualized with FITC-labeled secondary antibodies after a 1
hour 30 minute incubation. Images were acquired with a Zeiss LSM-510
laser-scanning confocal microscope (Carl Zeiss, Oberkochen, Germany) equiped
with Zeiss Axiovert 100M (plan Apochromat 63x1.40 NA oil immersion
objective). The contrast and brightness settings were constant during the
course of image acquisition. The E-cadherin/actin colocalization visualized by
confocal analysis was quantified using a program from Zeiss LSM 510 confocal.
The data were recorded from cells in the upper half of the cell in six random
fields from three independent experiments.
| Results |
|---|
|
|
|---|
1 laminin in HT29-MTX and Caco-2 cells. Furthermore, C9,
C11 and C20 intestinal mesenchymal cells have been reported to express laminin
chain mRNA in the same range. Nevertheless, the native ECM deposited by C20
cells was much more efficient in inducing apoA-IV gene expression
than that from the other clones. However,
Fig. 1 indicates that the most
effective ECM to induce apoA-IV expression is the native LN5-rich ECM
from HT29 cells adapted to 10-5 M methotrexate.
|
|
Observation of Caco-2 cells during these experiments revealed that cells
grown on native LN5-rich ECM formed domes 2 days earlier than cells grown on
the plastic support, and the ECM-grown domes were larger
(Fig. 2A). It is known that, at
confluence, epithelial cells grown on a non-porous support such as plastic are
elevated by the fluid accumulated under the monolayer and form domes
(Pinto et al., 1983
).
Comparison, every 2 days for 14 days, of Caco-2 cells grown on native ECM or
on plastic shows that this dramatic increase in domes formed by Caco-2 cells
on native LN5-rich ECM (Fig.
2C) does not rely on the confluence rate of the cells
(Fig. 2B), which is the same
under both conditions. The permeability of the monolayer was further assessed
by the use of FITC-biotin, an outside marker to which cells are impermeable.
Fig. 2D confirms an overall
inductive effect of ECM on the tightness of cell-cell junctions and
functionality of tight junctions by displaying the ability of FITC-labelled
biotin to penetrate between adjacent cells within the monolayer. Clearly, this
molecule remained apical on the monolayer grown on ECM substrate
(Fig. 2Db) whereas it
penetrated much deeper between cells grown on plastic without ECM (a) or on
polylysine (not shown), an artificial substrate which does not binds to
integrins (Machesky and Hall,
1997
). In contrast to the purpose of the experiment, which was to
differentiate between the effects of ECM and filter-induced cell polarization,
it suggests that functional polarization of Caco-2 cells, as assessed by dome
formation and permeability of the monolayer, is under the control of ECM.
|
Native ECM triggers E-cadherin accumulation at the lateral membrane
and colocalization with actin cytoskeleton
The aggregation of E-cadherin molecules at the adherens junctions is the
primary event, which organizes the formation of the other cell-cell junctions,
that is gap, desmosome, and tight junctions, which ensure the formation of an
impermeable polarized epithelium
(Cereijido et al., 2000
;
Fujimoto et al., 1997
;
Jongen et al., 1991
;
Lampe et al., 1998
). We
therefore studied the expression of E-cadherin in our system. We saw that
native LN5-rich ECM induced a threefold increase in apoA-IV gene
expression. At the same time, the total amount of E-cadherin protein
(Fig. 3B) and mRNA
(Fig. 3A) remained in the same
range, as did that of ß-catenin protein, a partner of E-cadherin required
for an efficient exit from endoplasmic reticulum in MDCK cells
(Chen et al., 1999
). The
amount of E-cadherin associated with the membrane was obtained after surface
biotinylation in the presence of 0.5 mM Ca2+, a concentration
resulting in a slight loosening of tight junctions but still too high for
inducing the disruption of adherens junctions, which occurs under 0.1 mM
Ca2+ (Cereijido et al. 2001;
Braga et al., 1997
)
(Fig. 3C). Similar to the
observation by Sander et al. in MDCK cells expressing Tiam1/Rac
(Sander et al. 1998
),
Figure 3C shows that the
association of E-cadherin with the membrane was increased fourfold in cells
grown on ECM compared with those grown on plastic without ECM, although ECM
did not influence the total amount of E-cadherinß-catenin.
|
The targeting of E-cadherin to the membrane induced by ECM was further characterized by confocal analysis. The signal detected by indirect immunofluorescence was stronger and cell-cell junctions were better delineated in cells grown on ECM (Fig. 4Ab) compared with cells grown on an inert support (Fig. 4Aa). In addition, confocal 3D analysis shows that E-cadherin was clearly visible at the base of cells, which form a flat monolayer on an inert support (Fig. 4Ac), whereas the signal almost disappeared from the base of cells forming domes on ECM and concentrated in focal spots in the upper third of the lateral membrane (Fig. 4Ad). Fig. 4B (c,d,e) shows that purified ECM components such as type IV collagen and laminin 2 were as efficient as native ECM in inducing E-cadherin targeting to the lateral membrane of cells that do not form domes. Since E-cadherin localized to adherens junctions is intimately associated with actin cytoskeleton in polarized epithelial cells, we also investigated by confocal analysis the actin cytoskeleton and its association with E-cadherin. In addition, culturing cells on ECM components reinforced the formation of the apical actin cytoskeleton and its colocalization with E-cadherin at the upper part of the lateral membrane (Fig. 4Bc', d', e'), as revealed by the merge yellow signal, as compared to an inert support (Fig. 4Ba'). Similar observations were made using a stimulating anti-ß1-integrin antibody in Caco-2 cells grown on an inert support, resulting in the formation of a cortical network of actin at the apical side of the cell (Fig. 4C). Altogether, these results favour a role of native ECM or of its components in the accumulation of E-cadherin at the lateral membrane in functional complexes anchored to the apical actin cytoskeleton.
|
E-cadherin targeting to the lateral membrane involves ß1
integrin
ECM components interact at the cell surface with their receptor integrins,
which are mainly
3ß1 and
6ß4 for LN5, in
differentiated intestinal epithelial cells. In order to see whether ECM
induced modification in integrin distribution in Caco-2 cells, we performed
confocal analysis after double labeling against ß1 or ß4 integrin
and E-cadherin. As expected, we observed that ß1 integrin colocalized
with E-cadherin at the lateral membrane of cells forming domes, mostly when
cells were grown on ECM, a condition in which domes are much more numerous
than in cells grown on an inert support (data not shown). We also verified
that ß4 integrin was only found at the basal membrane of cells forming
domes on ECM but not on an inert support (data not shown).
To further establish the role of ECM on Caco-2 cell polarization and E-cadherin targeting to the membrane, we performed perturbation experiments using functional blocking antibodies against ß1 integrin, the ß chain of the major integrin receptor for laminins and type IV collagen. Indeed, dome formation in cells grown on ECM was drastically impaired by the anti-ß1-integrin blocking antibody, in a dose dependent manner, and it was reduced to the range observed in cells grown on plastic support (Fig. 5A). Similarly, upon treatment with antibodies, cells grown on ECM reached confluence 1 day later than those not treated, at a time similar to that observed with cells grown on plastic. The effect of anti-ß1 antibody on dome formation was observed when cells were at confluence whereas non-specific mouse IgG displayed no effect (Fig. 5B).
|
Under these conditions, we investigated the effects of anti-ß1 or
anti-
6 blocking antibodies on E-cadherin accumulation at the lateral
membrane and anchoring to the cortical actin cytoskeleton. Colocalization of
E-cadherin and actin at the apical-lateral side of cells was estimated by
computer analysis of confocal stack series. Pixel count and pixel intensity
measurements gave the same results. Fig.
6A shows that Col IV and LN2 increased the amount of
colocalization of E-cadherin and actin signals up to 30% as compared to cells
grown on plastic. Thus, either ECM component could be used in the experiments.
Confocal 3D reconstruction of cells grown on Col IV reveals double, cortical
and basal rows of actin cytoskeleton with an important level of E-cadherin and
actin colocalization (Fig.
6Ba). The addition of anti-ß1-integrin blocking antibody
resulted in dramatic disorganization of the cortical row of the actin
cytoskeleton and, in parallel, a reduction in E-cadherin and actin
colocalization (Fig. 6Bb). The
blockade of either of the ß1 integrins in cells grown on LN2
(Fig. 6C) or
6ß4
integrin in cells grown on native ECM (Fig.
6D) resulted in a significant reduction in the colocalization of
E-cadherin and actin at the apical lateral side of Caco-2 cells. Altogether,
these results demonstrate that ECM, by interacting with its receptor
integrins, influences the association of E-cadherin and actin at the level of
adherens junction as functional complexes responsible for Caco-2 cell
polarization.
|
| Discussion |
|---|
|
|
|---|
In the present paper, we show in vitro that cell-ECM adhesion improves cell-cell adhesion through the reinforcement of E-cadherinactin complexes at the level of adherens junctions in Caco-2 cells. This effect is specific for cell-ECM adhesion as it is antagonized by function-blocking anti-integrin antibodies.
In vitro, epithelial cells form polarized monolayers at confluence, even
though full differentiation is not reached. Studying the influence of native
ECM on the expression of the apoA-IV gene, an enterocytic marker, in
Caco-2 cells we observed that the ECM boosted the formation of domes by the
monolayer. Formation of domes by confluent epithelial cells cultured on a
non-porous support signals the formation of an impermeable monolayer, which
rises owing to the fluid accumulated underneath. This requires the setting of
intercellular tight junctions, the activation of pumps for electrolytes and
water and a decrease in adherence to the substrate. The formation of domes,
while occurring spontaneously on plastic support
(Pinto et al., 1983
), has been
shown to be enhanced by differentiation inducers such as dimethyl sulfoxide
(DMSO) or 8-Br-cAMPC in LA7 epithelial cells
(Zucchi et al., 1998
). Here,
time of dome formation, their number and size and monolayer tightness
specifically depend on cell-ECM interactions, as FITC-labelled biotin
penetrated much deeper between Caco-2 cells grown on plastic or polylysine as
compared to cells grown on native ECM. It should be emphasized that the time
for the delayed formation of domes by Caco-2 cells grown on plastic was
compatible with the time necessary for the deposition of ECM material produced
by Caco-2 cells themselves (Vachon and
Beaulieu, 1995
).
Assembly of tight junctions, as well as gap and desmosomal junctions,
depends on E-cadherin recruitment at adherens junctions
(Cereijido et al., 2000
;
Jongen et al., 1991
;
Matsuzaki et al., 1990
;
Mege et al., 1988
;
Fujimoto et al., 1997
;
Green et al., 1987
;
Gumbiner et al., 1988
;
van Hengel et al., 1997
).
Therefore, we investigated E-cadherin status in our cells. Native ECM did not
affect the total amount of E-cadherin and of ß-catenin protein, as shown
by biochemical analysis and confocal microscopy, but we demonstrated that ECM
dramatically increases E-cadherin localization to the plasma membrane.
Confocal microscopy revealed that, in cells grown on native LN5-rich ECM, the
E-cadherin signal focused at the cell-cell junction domain in the upper third
of the lateral membrane, where adherens junctions are known to be localized.
Furthermore, the observation that ECM induced an increase in
E-cadherinactin colocalization suggests a reinforcement of E-cadherin
anchoring to the actin cytoskeleton and a better organization of the
subcortical network of actin by ECM. It is well established that tethering of
E-cadherin to the actin cytoskeleton underlies strong cell-cell adhesion and
is loosened in weak adhesion (Adams and
Nelson, 1998
; Kaibuchi et al.,
1999b
). The lateral membrane targeting of E-cadherin is produced
not only by a native LN5-rich ECM but also by Col IV alone, which is a common
component of all native ECMs (Rousselle
and Garrone, 1998
).
In our model, the coordinated reorganization of cell-cell adhesion and the
F-actin cytoskeleton was produced by native laminin-5-enriched ECM as well as
by type IV collagen or laminin 2, suggesting a common pathway of induction. We
therefore questioned the role of ECM receptors expressed in Caco-2 cells (i.e.
3ß1 and
6ß4 integrins). Blocking experiments with
anti-ß1-integrin or anti-
6-integrin antibodies in Caco-2 cells
grown on ECM substrates resulted in a phenotype similar to that obtained on an
inert support: a random distribution of E-cadherin along the basolateral
membrane, a looser organisation of the F-actin network and a reduction in the
merge signal from E-cadherin and F-actin cytoskeleton. These results
demonstrate that recruitment of integrin receptors by their external ligands
results in the reinforcement of E-cadherinactin functional complexes.
But, upon ligand binding, integrin linkage to the F-actin cytoskeleton is
known to be reinforced (Calderwood et al.,
2000
). This apparent contradiction might be explained by the
existence of distinct pools of F-actin forming functional complexes with
E-cadherin and integrin. Alternatively, translocation of regulatory proteins
from E-cadherin to integrin complexes has been proposed to mediate crosstalk
between N-cadherin and ß1 integrin in neural retina explants
(Arregui et al., 2000
). Both
hypotheses are challenged by the colocalization of E-cadherin and ß1 or
ß4 integrin that we observed by confocal microscopy in the lateral
membrane of Caco-2 cells grown on ECM, whereas no colocalization was found on
an inert support. Such a colocalization of ß1 integrin and E-cadherin has
already been reported at cell-cell junctions in keratinocytes
(Braga et al., 1997
), although
keratinocytes form a different system in which integrin loses contact with ECM
while migrating towards the superficial layers of this stratified epithelium,
where E-cadherin finally downregulates integrin expression
(Hodivala and Watt, 1994
).
Our results favour cooperation between ligand-bound integrin and E-cadherin
in the organization of the subcortical F-actin cytoskeleton. In accordance
with our results, it has been shown in kidney epithelial cells that
E-cadherincatenin complexes at cell-cell junctions were not sufficient
to maintain the subcortical F-actin cytoskeleton in the absence of
3ß1 integrin (Wang et al.,
1999
). Similarly, laminin-5-activated
3ß1 integrin has
been demonstrated to promote gap junctional communication in keratinocytes
(Lampe et al., 1998
). In
contrast, expression of ß1 integrin splice variants in ß1-deficient
epithelium-like cells resulted in downregulation of cadherin function,
disruption of cell-cell adhesion and induction of cell scattering
(Gimond et al., 1999
), all of
which underlie the cell-type specificity of cadherin localization
(Braga et al., 1999
).
The extrinsic spatial cues mediated by cell-cell and cell-substratum
adhesions and trophic factor signaling need to be coordinated to ensure a
differentiated phenotype. The Rho family GTPases (Rho, Rac and Cdc42) are good
candidates for a central role in coordinating adhesion systems. Rho GTPases
have been demonstrated to intervene in the inside-outside control of
cell-substrate adhesion (Calderwood et
al., 2000
). Reciprocally, Rho, Rac1 and Cdc42 play roles in
parallel and convergent signaling pathways triggered by cell adhesion to an
ECM substrate (Clark et al.,
1998
). The control of E-cadherin-mediated cell-cell adhesion by
the Rho family GTPases and their modulators has been recently characterized in
the context of epithelial-mesenchymal transition, where the loss of cell-cell
junctions promotes cell migration (Braga
et al., 1997
; Hordijk et al.,
1997
; Takaishi et al.,
1997
; Kuroda et al.,
1998
; Braga et al.,
1999
; Fukata et al.,
1999
). At the same time, it was established that Rho GTPases play
a key role in the control of actin polymerization, cell shape and motility
(Kaibuchi et al., 1999a
).
Our findings lend support to the notion that enterocyte differentiation is
an active process supported by molecular crosstalk involving cell-ECM and
cell-cell adhesions (Hermiston and Gordon,
1995
). We report for the first time that integrin-dependent
cell-ECM adhesion reinforces E-cadherin-dependent cell-cell adhesion in
epithelial cells (see Note in Proof). This reinforcement most probably allows
cell migration along the crypt to the villus of the intestinal epithelium
(Hermiston et al., 1996
). By
contrast, it is well documented that cell migration is promoted by the loss of
cell-cell junctions during the epithelial-mesenchymal transition of epithelial
cells. Our results supports the hypothesis that crosstalk between integrin and
cadherin, as well as regulation of E-cadherin localization and function,
depends on the cell fate (Braga et al.,
1999
). The identification of the Rho GTPase and its partners that
are involved in the network will contribute to the understanding of the
mechanisms set up at the crypt-to-villus transition checkpoint. Coordinated
changes in ECM components, integrin repertoire and E-cadherin localization
might also result in migration of differentiating enterocytes along the
crypt-to-villus axis.
| Note in Proof |
|---|
|
|
|---|
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Aberle, H., Butz, S., Stappert, J., Weissig, H., Kemler, R. and Hoschuetzky, H. (1994). Assembly of the cadherin-catenin complex in vitro with recombinant proteins. J. Cell Sci. 107,3655 -3663.[Abstract]
Adams, C. L. and Nelson, W. J. (1998). Cytomechanics of cadherin-mediated cell-cell adhesion. Curr. Opin. Cell Biol. 10,572 -577.[Medline]
Arregui, C., Pathre, P., Lilien, J. and Balsamo, J.
(2000). The nonreceptor tyrosine kinase fer mediates cross-talk
between N-cadherin and beta 1-integrins. J. Cell Biol.
149,1263
-1274.
Beaulieu, J. F. (1992). Differential expression
of the VLA family of integrins along the crypt-villus axis in the human small
intestine. J. Cell Sci.
102,427
-36.
Beaulieu, J. F. (1997). Extracellular matrix components and integrins in relationship to human intestinal epithelial cell differentiation. Prog. Histochem. Cytochem. 31, 1-78.[Medline]
Beaulieu, J. F. (1999). Integrins and human intestinal cell functions. Front. Biosci. 4,D310 -D321.[Medline]
Bissell, M. J., Hall, H. G. and Parry, G. (1982). How does the extracellular matrix direct gene expression? J. Theor. Biol. 99,31 -68.[Medline]
Booth, C. and Potten, C. S. (2000). Gut instincts: thoughts on intestinal epithelial stem cells. J. Clin. Invest. 105,1493 -1499.[Medline]
Boudreau, N. and Bissell, M. J. (1998). Extracellular matrix signaling: integration of form and function in normal and malignant cells. Curr. Opin. Cell Biol. 10,640 -646.[Medline]
Braga, V. M., Machesky, L. M., Hall, A. and Hotchin, N. A.
(1997). The small GTPases Rho and Rac are required for the
establishment of cadherin-dependent cell-cell contacts. J. Cell
Biol. 137,1421
-1431.
Braga, V. M., Del Maschio, A., Machesky, L. and Dejana, E.
(1999). Regulation of cadherin function by Rho and Rac:
modulation by junction maturation and cellular context. Mol. Biol.
Cell 10,9
-22.
Calderwood, D. A., Shattil, S. J. and Ginsberg, M. H.
(2000). Integrins and actin filaments: reciprocal regulation of
cell adhesion and signaling. J. Biol. Chem.
275,22607
-22610.
Cereijido, M., Shoshani, L. and Contreras, R. G.
(2000). Molecular physiology and pathophysiology of tight
junctions. I. Biogenesis of tight junctions and epithelial polarity.
Am. J. Physiol. Gastrointest. Liver Physiol.
279,G477
-G482.
Chen, Y. T., Stewart, D. B. and Nelson, W. J.
(1999). Coupling assembly of the E-cadherin/beta-catenin complex
to efficient endoplasmic reticulum exit and basal-lateral membrane targeting
of E-cadherin in polarized MDCK cells. J. Cell Biol.
144,687
-699.
Clark, E. A., King, W. G., Brugge, J. S., Symons, M. and Hynes,
R. O. (1998). Integrin-mediated signals regulated by members
of the rho family of GTPases. J. Cell Biol.
142,573
-586.
De Arcangelis, A., Neuville, P., Boukamel, R., Lefebvre, O.,
Kedinger, M. and Simon-Assmann, P. (1996). Inhibition of
laminin alpha 1-chain expression leads to alteration of basement membrane
assembly and cell differentiation. J. Cell Biol.
133,417
-430.
Fleischmajer, R., Utani, A., MacDonald, E. D., Perlish, J. S., Pan, T. C., Chu, M. L., Nomizu, M., Ninomiya, Y. and Yamada, Y. (1998). Initiation of skin basement membrane formation at the epidermo-dermal interface involves assembly of laminins through binding to cell membrane receptors. J. Cell Sci. 111,1929 -1940.[Abstract]
Fritsch, C., Orian-Rousseaul, V., Lefebvre, O., Simon-Assmann, P., Reimund, J. M., Duclos, B. and Kedinger, M. (1999). Characterization of human intestinal stromal cell lines: response to cytokines and interactions with epithelial cells. Exp. Cell Res. 248,391 -406.[Medline]
Fujimoto, K., Nagafuchi, A., Tsukita, S., Kuraoka, A., Ohokuma, A. and Shibata, Y. (1997). Dynamics of connexins, E-cadherin and alpha-catenin on cell membranes during gap junction formation. J. Cell Sci. 110,311 -322.[Abstract]
Fukata, M., Nakagawa, M., Kuroda, S. and Kaibuchi, K. (1999). Cell adhesion and Rho small GTPases. J. Cell Sci. 112,4491 -4500.[Abstract]
Gimond, C., van Der Flier, A., van Delft, S., Brakebusch, C.,
Kuikman, I., Collard, J. G., Fassler, R. and Sonnenberg, A.
(1999). Induction of cell scattering by expression of betal
integrins in beta 1-deficient epithelial cells requires activation of members
of the rho family of GTPases and downregulation of cadherin and catenin
function. J. Cell Biol.
147,1325
-1340.
Green, K. J., Geiger, B., Jones, J. C., Talian, J. C. and
Goldman, R. D. (1987). The relationship between intermediate
filaments and microfilaments before and during the formation of desmosomes and
adherens-type junctions in mouse epidermal keratinocytes. J. Cell
Biol. 104,1389
-1402.
Gumbiner, B., Stevenson, B. and Grimaldi, A.
(1988). The role of the cell adhesion molecule uvomorulin in the
formation and maintenance of the epithelial junctional complex. J.
Cell Biol. 107,1575
-1587.
Gumbiner, B. M. (1996). Cell adhesion: the molecular basis of tissue architecture and morphogenesis. Cell 84,345 -357.[Medline]
Hermiston, M. L. and Gordon, J. I. (1995). In
vivo analysis of cadherin function in the mouse intestinal epithelium:
essential roles in adhesion, maintenance of differentiation, and regulation of
programmed cell death. J. Cell Biol.
129,489
-506.
Hermiston, M. L., Wong, M. H. and Gordon, J. I.
(1996). Forced expression of E-cadherin in the mouse intestinal
epithelium slows cell migration and provides evidence for nonautonomous
regulation of cell fate in a self-renewing system. Genes
Dev. 10,985
-996.
Hodivala, K. J. and Watt, F. M. (1994).
Evidence that cadherins play a role in the downregulation of integrin
expression that occurs during keratinocyte terminal differentiation.
J. Cell Biol. 124,589
-600.
Hoffman, M. P., Kibbey, M. C., Letterio, J. J. and Kleinman, H. K. (1996). Role of laminin-1 and TGF-beta 3 in acinar differentiation of a human submandibular gland cell line (HSG). J. Cell Sci. 109,2013 -2021.[Abstract]
Hordijk, P. L., ten Klooster, J. P., van der Kammen, R. A.,
Michiels, F., Oomen, L. C. and Collard, J. G. (1997).
Inhibition of invasion of epithelial cells by Tiam 1-Rac signaling.
Science 278,1464
-1466.
Hynes, R. O. (1987). Integrins: a family of cell surface receptors. Cell 48,549 -554.[Medline]
Jongen, W. M., Fitzgerald, D. J., Asamoto, M., Piccoli, C.,
Slaga, T. J., Gros, D., Takeichi, M. and Yamasaki, H. (1991).
Regulation of connexin 43-mediated gap junctional intercellular communication
by Ca2+ in mouse epidermal cells is controlled by E-cadherin.
J. Cell Biol. 114,545
-555.
Jou, T. S., Stewart, D. B., Stappert, J., Nelson, W. J. and
Marrs, J. A. (1995). Genetic and biochemical dissection of
protein linkages in the cadherin-catenin complex. Proc. Natl. Acad.
Sci. USA 92,5067
-5071.
Kaibuchi, K., Kuroda, S. and Amano, M. (1999a). Regulation of the cytoskeleton and cell adhesion by the Rho family GTPases in mammalian cells. Annu. Rev. Biochem. 68,459 -486.[Medline]
Kaibuchi, K., Kuroda, S., Fukata, M. and Nakagawa, M. (1999b). Regulation of cadherin-mediated cell-cell adhesion by the Rho family GTPases. Curr. Opin. Cell Biol. 11,591 -596.[Medline]
Kemler, R. (1992). Classical cadherins. Semin. Cell Biol. 3,149 -155.[Medline]
Klein, G., Ekblom, M., Fecker, L., Timpl, R. and Ekblom, P.
(1990). Differential expression of laminin A and B chains during
development of embryonic mouse organs. Development
110,823
-837.
Kuroda, S., Fukata, M., Nakagawa, M., Fujii, K., Nakamura, T.,
Ookubo, T., Izawa, I., Nagase, T., Nomura, N., Tani, H. et al.
(1998). Role of IQGAP1, a target of the small GTPases Cdc42 and
Rac1, in regulation of E-cadherin- mediated cell-cell adhesion.
Science 281,832
-835.
Lampe, P. D., Nguyen, B. P., Gil, S., Usui, M., Olerud, J.,
Takada, Y. and Carter, W. G. (1998). Cellular interaction of
integrin alpha3beta1 with laminin 5 promotes gap junctional communication.
J. Cell Biol. 143,1735
-1747.
Larjava, H., Peltonen, J., Akiyama, S. K., Yamada, S. S.,
Gralnick, H. R., Uitto, J. and Yamada, K. M. (1990). Novel
function for beta 1 integrins in keratinocyte cell-cell interactions.
J. Cell Biol. 110,803
-815.
Le Beyec, J., Delers, F., Jourdant, F., Schreider, C., Chambaz, J., Cardot, P. and Pincon-Raymond, M. (1997). A complete epithelial organization of Caco-2 cells induces I-FABP and potentializes apolipoprotein gene expression. Exp. Cell Res. 236,311 -320.[Medline]
Lesuffleur, T., Barbat, A., Dussaulx, E. and Zweibaum, A.
(1990). Growth adaptation to methotrexate of HT-29 human colon
carcinoma cells is associated with their ability to differentiate into
columnar absorptive and mucus-secreting cells. Cancer
Res. 50,6334
-6343.
Li, M. L., Aggeler, J., Farson, D. A., Hatier, C., Hassell, J.
and Bissell, M. J. (1987). Influence of a reconstituted
basement membrane and its components on casein gene expression and secretion
in mouse mammary epithelial cells. Proc. Natl. Acad. Sci.
USA 84,136
-140.
Lorentz, O., Duluc, I., Arcangelis, A. D., Simon-Assmann, P.,
Kedinger, M. and Freund, J. N. (1997). Key role of the Cdx2
homeobox gene in extracellular matrix-mediated intestinal cell
differentiation. J. Cell Biol.
139,1553
-1565.
Machesky, L. M. and Hall, A. (1997). Role of
actin polymerization and adhesion to extracellular matrix in Rac- and
Rho-induced cytoskeletal reorganization. J. Cell Biol.
138,913
-926.
Matsuzaki, F., Mege, R. M., Jaffe, S. H., Friedlander, D. R.,
Gallin, W. J., Goldberg, J. I., Cunningham, B. A. and Edelman, G. M.
(1990). cDNAs of cell adhesion molecules of different specificity
induce changes in cell shape and border formation in cultured S180 cells.
J. Cell Biol. 110,1239
-1252.
Matter, M. L. and Laurie, G. W. (1994). A novel
laminin E8 cell adhesion site required for lung alveolar formation in vitro.
J. Cell Biol. 124,1083
-1090.
Mege, R. M., Matsuzaki, F., Gallin, W. J., Goldberg, J. I.,
Cunningham, B. A. and Edelman, G. M. (1988). Construction of
epithelioid sheets by transfection of mouse sarcoma cells with cDNAs for
chicken cell adhesion molecules. Proc. Natl. Acad. Sci.
USA 85,7274
-7278.
Orian-Rousseau, V., Aberdam, D., Rousselle, P., Messent, A., Gavrilovic, J., Meneguzzi, G., Kedinger, M. and Simon-Assmann, P. (1998). Human colonic cancer cells synthesize and adhere to laminin-5. Their adhesion to laminin-5 involves multiple receptors among which is integrin alpha2beta1. J. Cell Sci. 111,1993 -2004.[Abstract]
Patton, B. L., Miner, J. H., Chiu, A. Y. and Sanes, J. R.
(1997). Distribution and function of laminins in the
neuromuscular system of developing, adult, and mutant mice. J. Cell
Biol. 139,1507
-1521.
Pincon-Raymond, M., Vicart, P., Bois, P., Chassande, O., Romey, G., Varadi, G., Li, Z. L., Lazdunski, M., Rieger, F. and Paulin, D. (1991). Conditional immortalization of normal and dysgenic mouse muscle cells by the SV40 large T antigen under the vimentin promoter control. Dev. Biol. 148,517 -528.[Medline]
Pinto, M., Robine-Leon, S., Appay, M. D., Kedinger, M., Triadou, N., Dussaulx, E., Lacroix, B., Simon-Assmann, P., Haffen, K., Fogh, J. et al. (1983). Enterocyte-like differentiation and polarization of the human colon carcinoma cell line Caco-2 in culture. Biol. Cell 47,323 -330.
Potten, C. S., Booth, C. and Pritchard, D. M. (1997). The intestinal epithelial stem cell: the mucosal governor. Int. J. Exp. Pathol. 78,219 -243.[Medline]
Rao, J. S., Beach, R. L. and Festoff, B. W. (1985). Extracellular matrix (ECM) synthesis in muscle cell cultures: quantitative and qualitative studies during myogenesis. Biochem. Biophys. Res. Commun. 130,440 -446.[Medline]
Rousselle, P. and Garrone, R. (1998). [Collagen and laminin: which messages for which cells?]. Pathol Biol (Paris) 46,543 -554.[Medline]
Sako, Y., Nagafuchi, A., Tsukita, S., Takeichi, M. and Kusumi,
A. (1998). Cytoplasmic regulation of the movement of
E-cadherin on the free cell surface as studied by optical tweezers and single
particle tracking: corralling and tethering by the membrane skeleton.
J. Cell Biol. 140,1227
-1240.
Sander, E. E., van Delft, S., ten Klooster, J. P., Reid, T., van
der Kammen, R. A., Michiels, F. and Collard, J. G. (1998).
Matrix-dependent Tiam1/Rac signaling in epithelial cells promotes either
cell-cell adhesion or cell migration and is regulated by phosphatidylinositol
3-kinase. J. Cell Biol.
143,1385
-1398.
Simon-Assmann, P. and Kedinger, M. (1993). Heterotypic cellular cooperation in gut morphogenesis and differentiation. Semin. Cell Biol. 4,221 -230.[Medline]
Simon-Assmann, P., Lefebvre, O., Bellissent-Waydelich, A., Olsen, J., Orian-Rousseau, V. and De Arcangelis, A. (1998). The laminins: role in intestinal morphogenesis and differentiation. Ann. N Y Acad. Sci. 859,46 -64.[Medline]
Skoudy, A., Llosas, M. D. and Garcia de Herreros, A. (1996). Intestinal HT-29 cells with dysfunction of E-cadherin show increased pp60src activity and tyrosine phosphorylation of p120-catenin. Biochem. J. 317,279 -284.
Takaishi, K., Sasaki, T., Kotani, H., Nishioka, H. and Takai,
Y. (1997). Regulation of cell-cell adhesion by rac and rho
small G proteins in MDCK cells. J. Cell Biol.
139,1047
-1059.
Tsukita, S., Nagafuchi, A. and Yonemura, S. (1992). Molecular linkage between cadherins and actin filaments in cell-cell adherens junctions. Curr. Opin. Cell Biol. 4,834 -839.[Medline]
Vachon, P. H. and Beaulieu, J. F. (1995).
Extracellular heterotrimeric laminin promotes differentiation in human
enterocytes. Am. J. Physiol.
268,G857
-G867.
Vachon, P. H., Durand, J. and Beaulieu, J. F. (1993). Basement membrane formation and re-distribution of the beta 1 integrins in a human intestinal co-culture system. Anat. Rec. 235,567 -576.[Medline]
Vachon, P. H., Loechel, F., Xu, H., Wewer, U. M. and Engvall,
E. (1996). Merosin and laminin in myogenesis; specific
requirement for merosin in myotube stability and survival. J. Cell
Biol. 134,1483
-1497.
van Hengel, J., Gohon, L., Bruyneel, E., Vermeulen, S.,
Cornelissen, M., Mareel, M. and von Roy, F. (1997). Protein
kinase C activation upregulates intercellular adhesion of
alpha-catenin-negative human colon cancer cell variants via induction of
desmosomes. J. Cell Biol.
137,1103
-1116.
Velling, T., Tiger, C. F., Ekblom, P. and Gullberg, D. (1999). Laminin alpha chains in colon carcinoma cell lines: detection of a truncated laminin alpha1 mRNA in Caco-2 cells. Exp. Cell Res. 248,627 -633.[Medline]
Wang, Z., Symons, J. M., Goldstein, S. L., McDonald, A., Miner, J. H. and Kreidberg, J. A. (1999). (Alpha)3(beta)1 integrin regulates epithelial cytoskeletal organization. J. Cell Sci. 112,2925 -2935.[Abstract]
Weaver, V. M., Petersen, O. W., Wang, F., Larabell, C. A.,
Briand, P., Damsky, C. and Bissell, M. J. (1997). Reversion
of the malignant phenotype of human breast cells in three-dimensional culture
and in vivo by integrin blocking antibodies. J. Cell
Biol. 137,231
-245.
Whittard, J. D. and Akiyama, S. K. (2001a). Activation of beta1 integrins induces cell-cell adhesion. Exp. Cell Res. 263,65 -76.[Medline]
Whittard, J. D. and Akiyama, S. K. (2001b).
Positive regulation of cell-cell and cell-substrate adhesion by protein kinase
A. J. Cell Sci. 114,3265
-3272.
Yamada, K. M. and Geiger, B. (1997). Molecular interactions in cell adhesion complexes. Curr. Opin. Cell Biol. 9,76 -85.[Medline]
Yamada, K. M. and Miyamoto, S. (1995). Integrin transmembrane signaling and cytoskeletal control. Curr. Opin. Cell Biol. 7,681 -689.[Medline]
Zucchi, I., Montagna, C., Susani, L., Vezzoni, P. and Dulbecco,
R. (1998). The rat gene homologous to the human gene 9-27 is
involved in the development of the mammary gland. Proc. Natl. Acad.
Sci. USA 95,1079
-1084.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
O. Beaslas, F. Torreilles, P. Casellas, D. Simon, G. Fabre, M. Lacasa, F. Delers, J. Chambaz, M. Rousset, and V. Carriere Transcriptome response of enterocytes to dietary lipids: impact on cell architecture, signaling, and metabolism genes Am J Physiol Gastrointest Liver Physiol, November 1, 2008; 295(5): G942 - G952. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Imanishi, B. Hu, M. J. Jarzynka, P. Guo, E. Elishaev, I. Bar-Joseph, and S.-Y. Cheng Angiopoietin-2 Stimulates Breast Cancer Metastasis through the {alpha}5{beta}1 Integrin-Mediated Pathway Cancer Res., May 1, 2007; 67(9): 4254 - 4263. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Ozaki, H. Ogita, and Y. Takai Involvement of integrin-induced activation of protein kinase C in the formation of adherens junctions Genes Cells, May 1, 2007; 12(5): 651 - 662. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Sakamoto, H. Ogita, T. Hirota, T. Kawakatsu, T. Fukuyama, M. Yasumi, N. Kanzaki, M. Ozaki, and Y. Takai Interaction of Integrin {alpha}vbeta3 with Nectin: IMPLICATION IN CROSS-TALK BETWEEN CELL-MATRIX AND CELL-CELL JUNCTIONS J. Biol. Chem., July 14, 2006; 281(28): 19631 - 19644. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. S. Filla, A. Woods, P. L. Kaufman, and D. M. Peters {beta}1 and {beta}3 Integrins Cooperate to Induce Syndecan-4-Containing Cross-linked Actin Networks in Human Trabecular Meshwork Cells Invest. Ophthalmol. Vis. Sci., May 1, 2006; 47(5): 1956 - 1967. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Peignon, S. Thenet, C. Schreider, S. Fouquet, A. Ribeiro, E. Dussaulx, J. Chambaz, P. Cardot, M. Pincon-Raymond, and J. Le Beyec E-cadherin-dependent Transcriptional Control of Apolipoprotein A-IV Gene Expression in Intestinal Epithelial Cells: A ROLE FOR THE HEPATIC NUCLEAR FACTOR 4 J. Biol. Chem., February 10, 2006; 281(6): 3560 - 3568. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. T. Chartier, M. Laine, S. Gout, G. Pawlak, C. A. Marie, P. Matos, M. R. Block, and M. R. Jacquier-Sarlin Laminin-5-integrin interaction signals through PI 3-kinase and Rac1b to promote assembly of adherens junctions in HT-29 cells J. Cell Sci., January 1, 2006; 119(1): 31 - 46. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. R. Ares, M. C. Louzao, M. R. Vieytes, T. Yasumoto, and L. M. Botana Actin cytoskeleton of rabbit intestinal cells is a target for potent marine phycotoxins J. Exp. Biol., November 15, 2005; 208(22): 4345 - 4354. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Fouquet, V.-H. Lugo-Martinez, A.-M. Faussat, F. Renaud, P. Cardot, J. Chambaz, M. Pincon-Raymond, and S. Thenet Early Loss of E-cadherin from Cell-Cell Contacts Is Involved in the Onset of Anoikis in Enterocytes J. Biol. Chem., October 8, 2004; 279(41): 43061 - 43069. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Orru, I. Caputo, A. D'Amato, M. Ruoppolo, and C. Esposito Proteomics Identification of Acyl-acceptor and Acyl-donor Substrates for Transglutaminase in a Human Intestinal Epithelial Cell Line: IMPLICATIONS FOR CELIAC DISEASE J. Biol. Chem., August 22, 2003; 278(34): 31766 - 31773. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||