|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
Research Article |

1 Imperial College of Science, Technology and Medicine, Department of Biology,
Sir Alexander Fleming Building, Imperial College Road, London, SW7 2AZ,
UK
2 ZMBH Im Neuheimer Feld 28, 69120 Heidelberg, Germany
3 W. Harry Feinstone Department of Molecular Microbiology and Immunology, Johns
Hopkins University Bloomberg School of Public Health, Baltimore, MD 21205,
USA
4 UMR CNRS 8576 Université des Sciences et
Technologies de Lille, France
5 Department of Pathology, Tennis Court Road, Cambridge CB2 1QP, UK
Author for correspondence (e-mail:
d.soldati{at}ic.ac.uk)
Accepted 26 October 2001
| Summary |
|---|
|
|
|---|
Key words: Apicomplexa, Toxoplasma gondii, Micronemes, Epidermal growth factor-like domain, Secretion, Processing, Escorter
| Introduction |
|---|
|
|
|---|
To determine if additional, potentially paralogous, transmembrane proteins
exist, we searched the Toxoplasma expressed sequence tag (EST) database
(Ajioka, 1998
) and found ESTs
with significant similarity to the transmembrane and cytoplasmic tail domains
of TRAP. This database proved to be a valuable resource for the identifying
genes/proteins phylogenetically restricted to the Apicomplexa that may be
crucial for the establishment of intracellular parasitism
(Ajioka et al., 1998
). The
cloning of the first of these novel genes, TgMIC6, revealed the
presence of three epidermal growth factor (EGF)-like domains in the
extracellular domain of the molecule. Such domains were previously identified
on proteins anchored by lipids at the surface of Plasmodium ookinetes
and merozoites (Kaslow et al.,
1988
; Blackman et al.,
1991
). Additional searches led to the identification of three more
micronemal proteins, which are structurally similar to TgMIC6 and thus
constitute a novel family of transmembrane proteins containing multiple
EGF-like domains. We have localized these proteins to the micronemes and
studied their processing and patterns of expression during stage
differentiation of T. gondii. Two of these members, TgMIC6 and
TgMIC8, are expressed in the tachyzoite stage and function as escorters,
targeting soluble adhesins to the micronemes.
| Materials and Methods |
|---|
|
|
|---|
ZAPII clones. Restriction enzymes were
purchased from New England Biolabs.
Toxoplasma cDNA library screening
Complete cDNA clones of the TgMIC6 gene were obtained by screening
the RH (EP)
cDNA expression library in
ZAPII from NIH AIDS
reagent repository. The non-radioactive labeling of nucleic acids based on the
digoxigenin system from Boehringer Mannheim was used for the screening. A
DIG-dUTP-labeled PCR DNA fragment amplified from one EST clone
(Ctoxqual2_2870) was used as the probe. The detection of positive clones was
achieved by chemiluminecsence with CPDS according to the manufacturer (Roche).
The cDNA corresponding to TgMIC7, MIC8 and MIC9 were amplified by RT-PCR and
sequenced. Analysis of the DNA and protein sequences was performed using
programs available on the NCBI web site and Expasy server
(http://www.expasy.ch/tools). Prediction of signal peptide cleavage sites and
transmembrane spanning domains have been obtain using the software at:
http://www.cbs.dtu.dk/services/SignalP/index.html and
http://www.biokemi.su.se/
server/toppred2/toppredServer.cgi
Toxoplasma gDNA library screening
Cosmid clones containing the TgMIC6, MIC7 and MIC8 loci were
isolated from a cosmid library. The library was made in a SuperCos vector
modified with SAG1/ble T. gondii selection cassette inserted into its
HindIII site. The library was prepared from a Sau3AI partial
digestion of RH genomic DNA ligated into the BamHI cloning site and
was kindly provided by D. Sibley and D. Howe. Probes were labeled using
DIG-11-dUTP. The hybridization and chemiluminescent CSPD® detection were
carried according to the manufacturer (Roche).
DNA and RNA preparations and semi-quantitative RT-PCR
Parasites were harvested after complete lysis of the host cells and
purified by passage through 3.0 µm filters and centrifugation in PBS.
Genomic DNA was isolated from purified parasites by sodium dodecyl
sulfate/proteinase K lysis followed by phenol/chloroform, chloroform
extractions and ethanol precipitation
(Sibley and Boothroyd, 1992
).
Total RNAs were prepared using RNA clean from AGS GmbH according to the
manufacturer. mRNA expression levels were measured by semi-quantitiative
RT-PCR as previously described (Yahiaoui
et al., 1999
). T. gondii cysts were isolated from mice
chronically infected with tachyzoites of the 76K strain for 2 months. In vivo
bradyzoites were freed by pepsin digestion (0.05 mg/ml pepsin in 170 mM NaCl,
60 mM HCl) for 5-10 minutes at 37°C. These in vivo bradyzoites and
tachyzoites cultivated in HFF were lysed with 1% SDS, 50 mM sodium acetate pH
5.2, 10 mM EDTA and total RNA was isolated following two phenol extractions at
65°C and ethanol precipitation. For controls, total RNA from uninfected
brain cells of mice and HFF were also isolated. For reverse transcriptase PCR,
total RNA was digested with DNase and checked by PCR to confirm that no DNA
remained in these samples before reverse transcription was done.
Semi-quantitative RT-PCR was performed by using tenfold serial dilutions of
tachyzoite and bradyzoite cDNAs. The cDNA products were amplified with 50 pmol
of each primer and 2.5 U of AmpliTaq DNA polymerase (Promega) in 50 µl
reaction volumes (5 mM Tris-HCl pH 8.0, 10 mM NaCl, 0.01 M EDTA, 0.1 mM DTT,
5% glycerol, 0.1% Triton X-100, 1.5 mM MgCl2 and 200 µM dNTP).
Thermal cycling conditions were: (1) denaturation at 94°C for 10 minutes;
(2) denaturation at 94° C for 1 minute followed by the annealing at
50-60°C (depending of each pair primer); (3) elongation for 3 minutes at
72°C; (4) at the end, a 10 minutes at 72°C additional extension was
done. Usually, 30-35 cycles were performed. Primers used in this experiment
were as follows: the T. gondii housekeeping
-tubulin gene
(Nagel and Boothroyd, 1988
)
5'-ATGAGAGAG- GTTATCAGCATC-3' and
5'-T-TAGTACTCGTCACCATAGCC-3'.
TgMIC2 5'-CGGAATTCGCCAGTTACCACTACTATTTGA-3' and 5'-CGGAATTCAGCTCCAGTGTCGGATCCCCAT-3'.
TgMIC4 5'-TGCATGCATTTCTGCGATTTTGGCGGTAGC-3' and 5'-CCTTAATTAAACTGCAGCTTCTGTGTCTTTCGCTTC-3'.
TgMIC6 5'-CGGAATTCGACTCAACAGAACCGGGGA-3' and 5'-CGGAATTCCAATGTTTTGGCTAATCC-3'.
TgMIC7 5'-CGGGATCCTTCGAGTGCAGATGTAATGAATACCGG-3' and 5'-GCGGATCCGAAGCGGTTTGCATTCTCCCTTCCTGC-3'.
TgMIC8 5'-GGTTGACCTTTTCGCCGC-3' and 5'-GGCACCTGCCGCACACA-3'.
TgMIC9 5'-CATGAACGCATGCGCAGCC-3' and 5'-GCAGTGGACGCGTGAGAAGG-3'.
Construction of plasmids
Fragments corresponding to partial coding sequences of the MICs were
amplified by PCR using RH cDNA as template, with specific primers containing
restriction sites. The PCR products were digested with restriction enzymes and
ligated into pGEX4T-1 (AMRAD Pharmacia Biotech, Melbourne, Victoria,
Australia) or pET in which a C-terminal his-tag was included (Invitrogen,
Carlsbad, CA) vectors. MIC6 EGF domains: MIC6-1
5'-CGGGATCCCATGCATGAATCGTTACTGTGGCTGAAG-3'; MIC6-2
5'-CGGGATCCATGCATGTCCACTTCCTTCCTCT-3'.
MIC6 cytoplasmic tail: MIC6-3 5'-CGGAATTCGTTGCATACATGAGAAAGAGTGGGAGC-3'; MIC6-4 5'-CTGCAGTCGACCTTAATCCCATGTTTTGCTATCCAAAT-3'.
MIC7 EGF domains: MIC7-1 CGGGATCCCTCGAGGCGGACTTGTGCCGCAATGAT; MIC7-2 5'-CGGGATCCCCGGGACCCAATTGACTGAGGTGTGT-3'.
MIC7 cytoplasmic tail: MIC7-3 5'-GGCGGATCCGGAGGAATTTCTTACGCCAGAAACA-3' MIC7-4 5'-CGCGGATCCTTAGGACCAGATACCGCCCGA-3'.
MIC8 EGF domains: MIC8-1 5'-CGGGATCCTGCAGAGCACCACAGCCAAAGGGG-3'. MIC8-2 5'-GGCGGATCCAAGGATATCAACGAATGTGAAGAACC-3'.
MIC9 EGF domains: MIC9-1 5'-CGGAATTCTGTTCCTCTCAACCGTGTGGT-3';
MIC9-2 5'-AAAACTGCAGACTCGAGCCACTGGGTCATGTCTGACTCG-3'.
Expression vectors for T. gondii were constructed based on the
pTHXGPRT vector previously described
(Hettmann et al., 2000
). The
coding sequences for the MICs were cloned between EcoRI site and
PacI sites. The construct pTMIC6Ty-1 contains a Ty-1 epitope tag,
which was inserted between the EGF-like domain 3 and the acidic region as
previously described (Reiss et al.,
2001
). The pTmycMIC6 was obtained by cloning the cDNA of MIC6
downstream of the myc tag of the pT expression vector, as described before
(Soldati et al., 1998
). The
two T. gondii expression constructs pTMIC8-Ty1 and pTMIC9-Ty-1 were
cloned into pTGFPHX vector previously described
(Hettmann et al., 2000
). The
coding sequence of MIC9 was amplified from a cosmid clone and the cDNA of MIC7
were amplified by RT-PCR using primers hybridizing upstream of the signal
peptide and at the STOP codon of each respective genes. The following primers
were used: MIC9-3
5'-CGGAATTCCCTTTTTCGACAAAATGAGGGTTTCGTTTAACGGACC-3' and MIC9-4
5'-CCTTAATTAAGCTGCAGGATACATTCCTTCAAAATCGTGTGCAT-3' MIC7-3
5'-CGGCAATTGCCTTTTTCGACAAAATGGGAGGCTGGGAGTCAAAAG-3' and MIC7-4
5'-CCTTAATTAAGATGCATTCCCTCTGAACGAATGCGCCG-3'. A Ty-1 epitope was
introduced at the C-terminus just preceding the stop codon. pTMIC8TyGPI was
obtained in two steps. An inverse PCR reaction on pTMIC8 allowed introducing a
Ty1 tag and a unique NsiI site. MIC8-5
5'-CCTTAATTAAGATGCATCGAGGGGGTCCTGGTTGGTGTGGACTTCTGGTAAACACTGCAACTTTGACCC-3',
MIC8-6 5'CCAATGCATCTACTGATCAGACAGATTTCGATTCC-3'. Subsequently, the
transmembrane and cytosolic domains (TMCD) of MIC8 were exchanged with the GPI
anchor signal of SAG1 using the NsiI and BamHI sites. The
construct of pTMIC6
E1-2GPI was constructed by inverse PCR using
pTMIC6GPI as template, as previously described
(Reiss et al., 2001
).
Transfection and selection of recombinant parasites
T. gondii tachyzoites (RHhxgprt-) were
transfected by electroporation as previously described
(Soldati and Boothroyd, 1993
).
Hypoxanthinexanthine-guanine-phosphoribosyltransferase (HXGPRT) was used as
positive selectable marker gene in the presence of mycophenolic acid and
xanthine as described (Donald et al.,
1996
). Freshly egressed parasites (5x107) of
RHhxgprt- strain were resuspended in cytomix buffer in presence of
80 µg of plasmid carrying the HXGPRT selectable marker gene and the
expression cassette. Alternatively, in HXGPRT+ background
strains, chloramphenicol acetyltransferase was used as selectable marker gene
in co-transformation.
Expression and purification of recombinant fusion proteins in E.
coli
Expression of fusion proteins was induced with 2 mM
isopropyl-ß-D-thiogalactopyranoside (IPTG). The gluthathione
S-transferase (GST) fusion protein were purified by affinity chromatography on
glutathione agarose according to the manufacturer (Stratagene). The
hexahistidine fusion was purified with NiTA agarose column, under denaturating
conditions according to the manufacturer's instructions. The purity and
integrity of fusion proteins were assessed by Coomassie blue staining of
sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and
protein concentration was determined using a BioRad protein assay.
Generation of polyclonal antisera
For production of antisera to the MIC fragments, rabbits were injected with
0.1-1 mg of recombinant proteins in complete Freund's adjuvant and boosted up
to five times. The reactivity of antibodies was tested by immunoblots and IFA.
Antibodies raised against the EGF-like domains of the MICs were named
-Nter, and the antibodies raised against the cytoplasmic tails were
named
-Cter.
SDS-PAGE and western blotting
Protein preparations were solubilized either directly in SDS loading buffer
or in RIPA buffer (50 mM Tris pH 7.5, 150 mM NaCl, 0.1% sodium dodecyl
sulfate, 0.5% NP-40, 0.5% sodium deoxycholate, protease inhibitors Complete,
Roche) followed by centrifugation for 15 minutes at 13,000 g
at 4°C. The supernatant was mixed with SDS-PAGE loading buffer in presence
of DTT. Western blot analysis was undertaken as previously described
(Reiss et al., 2001
).
Determination of transmembrane proteins topology
Transient permeabilization followed by proteinase K treatments were carried
out as previously described for P. falciparum
(Gunther et al., 1991
).
Freshly lysed parasites were washed and resuspended in PBS at
108/ml and slowly frozen at -80°C. The frozen cells were thawed
on ice and incubated for 60 minutes in presence of increasing concentrations
of proteinase K (0.05 to 1 mg/ml) in the presence or absence of a final
concentration of 0.3% Triton X-100. The total cell lysate was precipitated
with trichloroacetic acid (TCA) and analyzed by western blot.
Indirect-immunofluorescence assays
For the indirect immunofluorescence assay, tachyzoites were used to infect
human foreskin fibroblast (HFF) cells that were growing on cover slides in
24-well plates. After 24-36 hours, cells were fixed with 4% paraformaldehyde
or 4% paraformaldehyde, 0.005% glutaraldehyde in PBS for 15 minutes,
permeabilized for 20 minutes with PBS containing 0.2% Triton X-100 and blocked
in PBS containing 0.2% Triton and 2% Albumin fraction V. The antibodies were
diluted in the permeabilization buffer with BSA. The primary antibodies were
polyclonal rabbit
-T. gondii MICs (dilution 1:500 to 1:1000)
and mouse monoclonal
-MIC2 (dilution 1:3000). The secondary antibodies
were AlexaTM 488 goat
-mouse IgG and AlexaTM 594 goat
-rabbit IgG antibodies (Molecular Probes, Netherlands) diluted 1:1000.
Cells were washed three times with PBS+0.2% Triton X-100 and mounted in a
mounting solution (fluoromount G, Southern Biotechnologies). Confocal images
were collected with a Leica laser scanning confocal microscope (TCS-NT DM/IRB)
using a 63x Plan-Apo objective with NA 1.40. Optical sections were
recorded at 250 nm per vertical step with four times averaging. All other
micrographs were obtained with a Zeiss Axiophot with a camera (Photometrics
Type CH-250). Adobe PhotoShop (Adobe Systems, Mountain View, CA) was used for
processing of images.
Secretion assays
For large-scale preparation of excretory-secretory antigens (ESA),
approximately 5x109 tachyzoites were washed and resuspended
in 1 ml of HHE and stimulated to discharge micronemes by addition of ethanol
to a final concentration of 1.0% and incubation at 37°C for 30 minutes as
described previously (Carruthers et al.,
1999
). Cells were removed by centrifugation at 2000
g and the supernatant was kept frozen at -70°C.
Immunoaffinity purification of microneme protein
Immunoaffinity purification of MIC6Ty was obtained by using
-Ty1
monoclonal antibodies BB2, crosslinked to protein A sepharose (Pharmacia) with
dimethylpimelimidate as described in the laboratory manual
(Harlow and Lane, 1988
).
Freshly lysed parasites (9x109) from mic6ko strain expressing
MIC6Ty were harvested, washed once in PBS and lysed in RIPA for 30 minutes on
ice. The lysate was then spun at 50,000 g for 60 minutes at
4°C and the supernatant was incubated with antibodies coupled to the beads
for 12 hours at 4°C with gentle shaking. The beads were washed three times
with 15 ml of RIPA. Proteins were eluted in by boiling for 5 minutes in
non-reducing SDS-PAGE sample buffer. Samples were separated on 12% SDS-PAGE
gels and stained with Coomassie R-250.
Mass spectrometry analysis
Mass spectrometry was carried out at the ZMBH Biopolymer facility, similar
to described procedures (Shevchenko et
al., 1996
; Wilm et al.,
1996
). Briefly, the bands were cut out of a stained SDS-PAGE gel.
The gel piece was washed twice with H2O, twice with 50%
acetonitrile and once with 100% acetonitrile. Proteins were reduced in gel
with 10 mM DTT in 100 mM NH4HCO3 at 56°C for 1 hour.
Alkylation was performed in 10 mM iodoacetamide. The gel piece was washed
again as described above. In gel, tryptic digest was performed with 1.25
ng/µl trypsin in 50 mM ammonium bicarbonate overnight at 37°C and
stopped by addition of acetic acid. The digestion mixture was desalted on a
capillary packed with POROS R2 sorbent (Applied Biosystems). Peptides were
eluted with 70% methanol/1% acetic acid. Mass spectrometric analysis was
performed according to the manufacturer, on a Q-STAR (Applied Biosystems) mass
spectrometer equipped with a Nano ESI ion source.
| Results |
|---|
|
|
|---|
|
Further searching of the EST database for EGF-like domains led to the
identification of two additional putative transmembrane proteins structurally
similar to TgMIC6. These new proteins were named TgMIC7 and TgMIC8. The
sequences obtained from the corresponding ESTs were used to screen a genomic
library and several clones for each gene were isolated and sequenced. While
sequencing the TgMIC8 locus, a fourth gene coding for a putative
transmembrane protein exhibiting three EGF-like domains (TgMIC9) was
identified upstream of the TgMIC8 gene. The cDNAs corresponding to
TgMIC7, TgMIC8 and TgMIC9 were obtained by RT-PCR, cloned and sequenced.
TgMIC7 is the only one of the four genes that contains introns. The
predicted amino acid sequence of each of the four genes and their signal
peptide and putative transmembrane spanning domains are depicted in
Fig. 2. The amino acid
sequences of their transmembrane and cytoplasmic domains are aligned and
compared with the same domains present in other apicomplexan microneme
proteins (Fig. 1B). In addition
to the EGF-like domains, TgMIC8 also possesses a lectin-like domain similar to
the one recently described in the non-membrane protein TgMIC3
(Garcia-Reguet et al., 2000
).
The cysteine rich lectin-like domain of TgMIC3 has recently been implicated in
binding to host cells (Soldati et al., 2001). This lectin domain is also
present on a microneme protein of Neospora caninum (NcMIC3), which is
closely related to TgMIC3 (Sonda et al.,
2000
), and in an as yet uncharacterized E. tenella
partial open reading frame present in the EST database
(Fig. 1C).
|
Members of this microneme protein family display different patterns
of expression in the proliferative and encysted life stages of T.
gondii
Two life stages of T. gondii are present in intermediate hosts.
The tachyzoite, a rapidly dividing form is responsible for acute infection and
the slowly growing encysted bradyzoite form is associated with chronic
infection. We examined the stage-specific expression of the members of this
novel gene family by measuring the level of their transcripts in the two life
stages by semi-quantitative RT-PCR. 76K strain bradyzoite cysts were isolated
from mice chronically infected for two months and 76K tachyzoites were
obtained from in vitro culture in HFF cells. To ensure that equal quantities
of each mRNAs were being compared, the housekeeping gene
-tubulin was
used as control (Fig. 3). The
results revealed that TgMIC6 is preferentially expressed in tachyzoites,
whereas TgMIC8 transcripts are evenly distributed between the two stages. By
contrast, TgMIC7 and TgMIC9 are preferentially or exclusively transcribed in
the encysted form of T. gondii. TgMIC2 and TgMIC4 were also included
as controls because they are expressed in both parasite stages (Brecht et al.,
2001).
|
TgMIC6 and TgMIC8 undergo proteolytic processing at their C-terminus
upon secretion
To characterize and study the properties of TgMIC6 and TgMIC8, we expressed
and purified bacterial recombinant fragments of the extracellular or
cytoplasmic domains of these two proteins. The cytoplasmic tails of these
proteins were fused to GST and purified under native conditions, while the
entire extracellular region of TgMIC6 or five EGF-like domains of TgMIC8 were
fused to a hexahistidine tag and purified under denaturating conditions. These
fragments were used to raise specific rabbit antisera to characterize the
expression of the corresponding proteins by western blotting and indirect
immunofluorescence. All antisera reacted similarly on lysates prepared from RH
and Prugniaud strains of T. gondii and gave no signal on lysates
prepared from Vero cells. Western blot analysis with
-NterMIC6 revealed
one predominant product of 45 kDa, a faint band at 53 kDa, and two
crossreacting bands of higher molecular weight, which persist in the mic6ko
lysate. The
-CterMIC6 antibodies recognized both the 53 and the 45 kDa
products (Fig. 4A). Polyclonal
antisera raised against either the cytoplasmic tail or the EGF-like domains of
TgMIC8 detected a single product of about 70 kDa
(Fig. 4B).
|
To determine the compartments where these processing events take place, we
stimulated microneme secretion and compared the contents of micronemes with
the material released in the supernatant (ESA) after stimulation with ethanol.
As previously shown for TgMIC2, TgMIC6 and TgMIC8 lost their C-terminal domain
upon release from the parasite surface since a soluble, secreted 35 kDa
product of TgMIC6 was not detectable with the
-CterMIC6 antibodies and
a
65 kDa secreted processed form of TgMIC8 was not detectable with
-CterMIC8 antibodies (Fig.
4C,D). The three distinct forms of TgMIC6 corresponding to
53-, 45- and 35- kDa are absent in a T. gondii mic6ko mutant
strain, confirming that these polypeptides are the products of the same gene
(Reiss et al., 2001
). The sera
raised against the cytoplasmic tail of TgMIC6 and TgMIC8 failed to recognize
the 35 and 65 kDa forms, respectively, indicating that a cleavage occurred
close to the putative transmembrane spanning domain, in a way similar to the
processing of TgMIC2 (Carruthers et al.,
2000
).
The protease responsible for TgMIC6 and TgMIC8 C-terminal cleavage is
presumably shared between all transmembrane microneme proteins and corresponds
to the MPP1 activity. MPP1 was recently defined as the proteolytic activity
responsible for the removal of the C-terminus of TgMIC2
(Carruthers et al., 2000
).
While TgMIC6 was previously demonstrated to localize in the micronemes
(Reiss et al., 2001
), indirect
double immunofluorescence analysis by confocal microscopy confirmed the
perfect co-localization of TgMIC8 with the previously characterized microneme
marker TgMIC2 (Fig. 4E).
TgMIC6 is cleaved at the N-terminus during its transport to the
micronemes
In addition to the C-terminal cleavage, TgMIC6 is cleaved in parasites at
the N-terminus, causing the removal of the first EGF-like domain
(Reiss et al., 2001
). We
engineered recombinant parasites expressing TgMIC6 with a myc-tag epitope
introduced immediately downstream of the signal peptide cleavage site of the
protein in order to follow the biogenesis of the protein within the cells.
This construct was stably transformed in mic6ko strain. We failed to detect
the 53 kDa precursor by western blot with
-myc; however, a specific
signal was detectable by IFA in less than 30% of the vacuoles
(Fig. 5A). Interestingly, the
-myc antibodies failed to stain the micronemes, suggesting that the
N-terminal processing occurred during transport along the secretory pathway,
most likely in the trans-Golgi network (TGN). A series of overlays have been
chosen to illustrate several points. In
Fig. 5B, the transgenic product
mycMIC6 (green) is exclusively targeted to the micronemes as seen by
colocalization (yellow) with TgMIC2 (red). Additionally, mycMIC6 is also
present in significant amounts in the ER and Golgi.
Fig. 5C provides evidence that
the precursor of mycMIC6, as detected by
-myc (red), accumulates in the
early compartments of the secretory pathway but was absent from the micronemes
(green) labeled with
-TgMIC4. Interestingly, the precursor of mycMIC6
appears to move in wave along the secretory pathway, likely in a cell
cycle-dependent fashion. This potential cell cycle dependency of TgMIC6
traffic has been previously observed in mic1ko
(Reiss et al., 2001
).
Definitive evidence for this processing taking place in the late Golgi came
from the analysis of the lipid anchored MIC6GPI mutant
(Reiss et al., 2001
). The
protein covalently linked to GPI was targeted directly to the plasma membrane
without routing through the micronemes and still underwent N-terminal
processing, suggesting that this event occurs prior to the branch point where
microneme and surface proteins segregate. By contrast and as a control,
GPI-anchored MIC6 with a deletion of the first EGF domain was not processed
(Fig. 5D).
|
The exact cleavage site at the N-terminus of TgMIC6 was determined by mass spectrometry analysis after immunoprecipitation of MIC6Ty and purification of the 35 kDa species by SDS-PAGE. The protein was clearly identified by MALDI TOF mass spectrometry (data not shown). To determine the cleavage site we digested the purified 35 kDa form from MIC6Ty with trypsin and analyzed the digestion products by ESI Hybrid Quadrupole TOF MS. We calculated all theoretical masses of peptides potentially generated upstream of the K114 (in the EGF-2 domain). Only one of these masses was detected in the mass spectrum as a doubly charged ion of 689.0 m/z, which was then sequenced by tandem MS (Fig. 5E). The resulting fragmentation pattern clearly showed that this peak results from the peptide ETPAACSSNPCGPEAAGTCK. Since a cleavage between S94 and E95 could not arise from tryptic activity, we concluded that the N-terminal cleavage site of the 35 kDa fragment occurs between the serine and the glutamic acid residues (VQLS*ETP).
TgMIC6 adopts a classical type I membrane topology both during
transport along the secretory pathway and during its storage within the
micronemes
The transmembrane proteins stored in the secretory organelles of T.
gondii including the micronemes and dense granules are unexpectedly
soluble in absence of detergent. Within the micronemes, TgMIC2 is completely
soluble, whereas at least 50% of TgMIC6 is readily soluble without detergent
(C. Opitz and D.S., unpublished). This observation raised concerns about the
topology adopted by these proteins in the membrane. To elucidate the topology
of TgMIC6 during its transport and when stored in the organelles, we applied a
proteinase K treatment after a transient permeabilization of the cells
(Gunther et al., 1991
). The
cells were frozen and thawed slowly in cold. This treatment lyses cells and
permits microsomes and organelles to reseal with proteins in their original
orientation. In wild-type RH parasites, the majority of TgMIC6 localizes to
the micronemes and is N-terminally processed into a 45 kDa form. In mic 1 ko
strain, the 53 kDa precursor (N-terminally unprocessed) of TgMIC6 accumulated
predominantly in the early compartments of the secretory pathway (in the ER
and Golgi apparatus) (Reiss et al.,
2001
). Finally, the 35 kDa product corresponds to the fully
processed form released by the parasites
(Fig. 6A). After treatment with
proteinase K in absence of detergent, both the precursor
(Fig. 6B, right panel) and the
mature forms (Fig. 6B, left
panel) were converted into slightly smaller products corresponding to
truncation of their C-terminal tail. This assumption was confirmed by the
inability to detect these products with the
-CterMIC6 antibodies
(Fig. 6C). A similar pattern of
protection was observed in RH and in mic 1ko, suggesting that TgMIC6 adopts a
type I membrane topology both during its transport through the ER and Golgi
and upon storage into the micronemes. The same experiment was repeated several
times including using PMSF at the end of the reaction to neutralize the
proteinase K. Other microneme proteins were also analyzed as controls. In
Fig. 6C, parasites expressing
MIC6Ty in the mic 1ko mutant were used to analyze both TgMIC6Ty and TgM2AP, a
newly characterized microneme protein tightly associated with TgMIC2 along the
secretory pathway and in the micronemes
(Rabenau et al., 2001
).
Despite its high susceptibility to proteolysis, TgM2AP is completely protected
in this assay, which is consistent with its retention in the lumenal side via
binding to TgMIC2 (Fig. 6D). A
classical type II transmembrane protein, Toxomepsin (X.
Jäkle and D.S., unpublished), was also used as a
control in this assay and it exhibited the expected results with removal of
its large cytoplasmic domain (data not shown).
|
Epitope-tagged TgMIC7 and TgMIC9 are targeted to the micronemes
We raised polyclonal antibodies against the EGF-like domains of TgMIC7 and
TgMIC9 to characterize these proteins. As expected from the RT-PCR results,
both proteins are poorly or not expressed in tachyzoites of the Prugniaud
(Fig. 7A) or RH (data not
shown) strains. The polyclonal antibodies raised against TgMIC9 revealed a
strong signal around 70 kDa. This signal is most likely due to an
immuno-crossreaction with another parasite antigen since it is not detectable
in Vero cells lysates (data not shown) and the anti Ty-1 antibodies failed to
detect such a high molecular weight product in recombinant parasites
expressing TgMIC9Ty. To analyze these proteins in tachyzoites, we generated
stable parasite cell lines expressing TgMIC7Ty and TgMIC9Ty under the control
of the constitutive tubulin promoter with the Ty-1 epitope tag positioned at
the C-terminus of each protein. Western blot analysis of these recombinant
parasite lysates revealed the presence of polypeptides of the expected size as
anticipated from the predicted amino acid compositions of their coding
sequences. IFA analysis of recombinant parasites expressing epitope tagged
TgMIC7Ty and TgMIC9Ty confirmed their localization to the micronemes
(Fig. 7B,C). TgMIC9Ty also
partially accumulated to the rhoptries as seen by colocalization with ROP2
(Fig. 7D). This imperfect
sorting of TgMIC9Ty might reflect some problems of overexpression, stage
specificity or interference due to the presence of the tag.
|
TgMIC7 and TgMIC9 exhibit shorter tails than the other transmembrane microneme proteins and they lack the strictly conserved tryptophan residue at the extreme C-terminus (Fig. 1B). We did not detect the secreted forms of these proteins, which might reflect a defect in secretion or in processing due to expression in the inappropriate stage of differentiation. Currently, the analysis of the endogenous TgMIC7 and TgMIC9 in bradyzoites is hampered by the extremely limited source of material available for this stage. In addition, polyclonal antibodies to TgMIC7 and TgMIC9 did not deliver signals on bradyzoite cysts by immunoelectron microscopy.
TgMIC8 serves as an escorter for the adhesin MIC3
TgMIC6 plays an essential escorter role in the targeting of TgMIC1 and
TgMIC4 to the micronemes (Reiss et al.,
2001
). The overall structural homology between TgMIC8 and TgMIC6
prompted us to investigate whether MIC8 would fulfill a similar function. To
rapidly address this question, we engineered a vector to express TgMIC8
covalently linked to a lipid by fusing the MIC8
TMCD (deleted
transmembrane and cytoplasmic domains) to SAG1 glycosylphoshpatidylinositol
(GPI) anchor signal. As anticipated, the expression of MIC8GPI resulted in the
plasma membrane localization of the transgenic product
(Fig. 8A). We then screened for
any of the known microneme proteins that would redistribute to the plasma
membrane as a consequence of the illegitimate presence of TgMIC8. TgMIC1,
TgMIC2, TgMIC4, TgMIC5 and TgMIC6 are correctly sorted to the micronemes in
the presence of MIC8GPI (data not shown). So far, TgMIC3 is the only microneme
protein we have observed rerouted to the plasma membrane in this transformant.
By contrast, TgMIC3 was typically localized to the micronemes in wild-type
parasites (Fig. 8A). Most
interestingly, like TgMIC1 and TgMIC4, TgMIC3 is a protein that lacks a
membrane-spanning domain and is capable of binding host cells
(Garcia-Reguet et al., 2000
).
The extensive relocalization of TgMIC3 to the plasma membrane in the presence
of MIC8GPI strongly suggests the existence of a stable complex between the two
proteins. In contrast to MIC6GPI, we failed to generate stable cell lines
expressing MIC8GPI, possibly because of the constitutive presence of the
MIC3-MIC8 complex at the surface of the parasite is not tolerated. By reducing
the amount of vector used in the transfection and waiting 48 hours
post-electroporation, we noticed that the pattern of MIC8GPI localization was
significantly different in the parasites expressing lower amounts of the
transgene. Interestingly, MIC8GPI did not distribute evenly at the surface of
the parasites but was clearly confined in regions of cell-cell contacts
between parasites residing within a vacuole
(Fig. 8B).
|
| Discussion |
|---|
|
|
|---|
We recently elucidated one aspect of TgMIC6 function by gene disruption. The absence of TgMIC6 does not interfere with the survival of T. gondii tachyzoites in culture despite the fact that its absence caused the complete mistargeting of two adhesins to the parasitophorous vacuole. A role as escorter implies that the protein carries sorting signals capable of recruiting the cytoplasmic components of the sorting machinery. These signals have been mapped to the C-terminal domain of TgMIC2 and are conserved on TgMIC6 C-terminal domain. However, transmembrane microneme proteins in T. gondii and Eimeria species (F. Tomley personal communication) are unexpectedly partially or completely soluble in the parasites. This biophysical feature is in contradiction with a type I topology predicted from the amino acids sequences of the protein and the identification of tyrosine-based sorting signals in the C-terminal tail. To clarify this point, we performed proteinase K digestion experiments after transient permeabilization. The results unambiguously establish that TgMIC6 adopts a type I membrane topology both during its transport through the ER and Golgi (mic 1ko) and when stored in the micronemes.
As previously shown for TgMIC2, both TgMIC6 and TgMIC8 undergo a
proteolytic processing event upon secretion, which removes their cytoplasmic
tails. The protease, which cleaves at the C-terminus of TgMIC2, has been
recently defined as MPP1 (Carruthers et
al., 2000
). This protease is most likely responsible for the
cleavage of TgMIC6 and TgMIC8 and appears to be functionally conserved
throughout the Apicomplexa (C. Opitz and D.S., unpublished). In addition to
proteolytic processing occurring at the parasite surface, TgMIC6 is
N-terminally cleaved during its transport to micronemes. We established here
that the processing occurs late in the secretory pathway (Golgi/TGN) and we
precisely determined the cleavage site on the protein. The protease
responsible for this activity and the biological significance of this
intracellular processing remain to be determined. Deletion of the first EGF
domain was previously reported to abrogate the processing; however, the
absence of the prosequence did not detectably alter sorting or its role as an
escorter. Other microneme proteins, TgMIC3, TgMIC5, TgMIC10, and TgM2AP, are
also processed during their transport, possibly in the same compartment of the
secretory pathway (J. F. Dubremetz, personal communication)
(Brydges et al., 2000
;
Hoff et al., 2001
;
Rabenau et al., 2001
).
Interestingly, the TgMIC6 N-terminal cleavage site (VQLS*ETP)
strikingly resembles the pro-peptide cleave site for TgM2AP
(AQLS*TFL), suggesting that these proteins might be cleaved by the
same protease. Further experiments will be required to test this
possibility.
In this study, we identified two additional transmembrane proteins
containing EGF-like domains. Based on RT-PCR, TgMIC7 and TgMIC9 appeared to be
predominantly transcribed in bradyzoites. Their accurate characterization has
been hampered by the limited availability of material and inability to
cultivate or genetically manipulate this dormant stage. The TgMIC9
gene is positioned just upstream of the TgMIC8 locus. The presence of
two genes coding for related proteins, being in close proximity on a
chromosome has been reported before in the case of the T. gondii
surface antigens SAG1 and SR1 (Hehl et
al., 1997
). In P. falciparum, the genes coding for MSP2,
MSP4 and MSP5 are also arranged in tandem on chromosome 2
(Marshall et al., 1998
).
We provide here compelling genetic evidence that TgMIC8 interacts directly
or indirectly with TgMIC3, which, by analogy to what is known concerning
TgMIC6, strongly suggests that this transmembrane protein may assist in
sorting the soluble adhesin TgMIC3 to the micronemes. Biochemical evidence of
the existence of this complex based on immunopreciptation has been hampered by
the strong tendency of TgMIC3 to precipitate in detergent extracts. In
addition to their role as escorters, TgMIC6 and TgMIC8 are likely to be
actively participating as an adhesin complex during the invasion process. The
presence of the conserved tryptophan residue in their tails suggests a role in
parasite gliding motility. Indeed, as observed for TgMIC2, TgMIC3 was recently
shown to redistribute toward the posterior pole of the parasites during
invasion (Garcia-Reguet et al.,
2000
). The posterior capping of TgMIC3 presumably occurs via its
interaction with TgMIC8. In contrast to TgMIC6, which does not seem to bind
directly to host cells, the presence of a lectin-like domain in TgMIC8
suggests that it could fulfil an adhesive function as well. Interestingly, the
adhesive activity of TgMIC3 depends both on the ability of this protein to
form homodimers and on the presence of the lectin-like domain (Soldati et al.,
2001). The concentration of MIC8GPI in the region of contact between the
parasites (Fig. 8B) suggests
that TgMIC8 can self-associate. This property does not depend on the presence
of TgMIC3 since the same phenomenon of aggregation was observed in mic3ko
parasites (M. Meissner, unpublished). Recently, a third complex of microneme
proteins, composed of TgMIC2 and TgM2AP, has been characterized
(Rabenau et al., 2001
). The
absence of each one of the two proteins drastically compromises the sorting of
the other (C. Opitz and D.S., unpublished; V.B.C., personal
communication).
The existence of specific complexes, not only between microneme proteins but also between rhoptry and dense granule proteins suggest that this mode of sorting might be generally and successfully exploited by apicomplexan parasites. In these parasites, the sorting in the secretory pathway is complicated by the existence of multiple distinct secretory organelles, which fulfil specific and crucial tasks in the establishment of intracellular parasitism. These findings build a new and general concept as to how soluble secretory proteins are accurately sorted to their appropriate organelles in these primitive eukaryotes.
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Ajioka, J. W. (1998). Toxoplasma gondii: ESTs and gene discovery. Int. J. Parasitol. 28,1025 -1031.[Medline]
Ajioka, J. W., Boothroyd, J. C., Brunk, B. P., Hehl, A., Hiller,
L., Manger, I. D., Overton, G. C., Marra, M., Roos, D., Wan, K.-L. et al.
(1998). Gene discovery by EST sequencing in Toxoplasma
gondii reveals sequences restricted to the Apicomplexa. Genome
Res. 8,18
-28.
Barnes, D. A., Bonnin, A., Huang, J. X., Gousset, L., Wu, J., Gut, J., Doyle, P., Dubremetz, J. F., Ward, H. and Petersen, C. (1998). A novel multi-domain mucin-like glycoprotein of Cryptosporidium parvum mediates invasion. Mol. Biochem. Parasitol. 96,93 -110.[Medline]
Blackman, M. J., Ling, I. T., Nicholls, S. C. and Holder, A. A. (1991). Proteolytic processing of the Plasmodium falciparum merozoite surface protein-1 produces a membrane-bound fragment containing two epidermal growth factor-like domains. Mol. Biochem. Parasitol. 49,29 -33.[Medline]
Brecht, S., Carruthers, V. B., Ferguson, D. J., Giddings, O. K.,
Wang, G., Jaekle, U., Harper, J. M., Sibley, L. D. and Soldati, D.
(2000). The toxoplasma micronemal protein MIC4 is an adhesin
composed of six conserved apple domains. J. Biol.
Chem. 276,4119
-4127.
Brydges, S. D., Sherman, G. D., Nockemann, S., Loyens, A., Daubener, W., Dubremetz, J. F. and Carruthers, V. B. (2000). Molecular characterization of TgMIC5, a proteolytically processed antigen secreted from the micronemes of Toxoplasma gondii. Mol. Biochem. Parasitol. 111,51 -66.[Medline]
Campbell, I. D. and Bork, P. (1993). Epidermal growth factor-like modules. Curr. Opin. Struct. Biol. 3, 385-292.
Carruthers, V. B., Moreno, S. N. and Sibley, L. D. (1999). Ethanol and acetaldehyde elevate intracellular [Ca2+] and stimulate microneme discharge in Toxoplasma gondii.Biochem. J. 342,379 -386.
Carruthers, V. B., Sherman, G. D. and Sibley, L. D.
(2000). The Toxoplasma adhesive protein MIC2 is proteolytically
processed at multiple sites by two parasite-derived proteases. J.
Biol. Chem. 275,14346
-14353.
Di Cristina, M., Spaccapelo, R., Soldati, D., Bistoni, B. and Crisanti, A. (2000). Two conserved amino acid motifs mediate protein targeting to the micronemes of the apicomplexan parasite Toxoplasma gondii. Mol. Cell. Biol. 29,7332 -7341.
Donahue, C. G., Carruthers, V. B., Gilk, S. D. and Ward, G. E. (2000). The toxoplasma homolog of plasmodium apical membrane antigen-1 (AMA-1) is a microneme protein secreted in response to elevated intracellular calcium levels. Mol. Biochem. Parasitol. 111,15 -30.[Medline]
Donald, R., Carter, D., Ullman, B. and Roos, D. S.
(1996). Insertional tagging, cloning, and expression of the
Toxoplasma gondii hypoxanthine-xanthine-guanine
phosphoribosyltransferase gene. Use as a selectable marker for stable
transformation. J. Biol. Chem.
271,14010
-14019.
Garcia-Reguet, N., Lebrun, M., Fourmaux, M. N., Mercereau-Puijalon, O., Mann, T., Beckers, C. J., Samyn, B., Van Beeumen, J., Bout, D. and Dubremetz, J. F. (2000). The microneme protein MIC3 of Toxoplasma gondii is a secretory adhesin that binds to both the surface of the host cells and the surface of the parasite. Cell Microbiol. 2,353 -364.[Medline]
Gunther, K., Tummler, M., Arnold, H. H., Ridley, R., Goman, M., Scaife, J. G. and Lingelbach, K. (1991). An exported protein of Plasmodium falciparum is synthesized as an integral membrane protein. Mol. Biochem. Parasitol. 46,149 -157.[Medline]
Harlow, E. and Lane, D. (1988). Immunoprecipitation. In Antibodies: A Laboratory Manual, pp. 421-471. Cold Spring Harbor Laboratory, New York.
Hehl, A., Krieger, T. and Boothroyd, J. C. (1997). Identification and characterization of SRS1, a Toxoplasma gondii surface antigen upstream of and related to SAG1. Mol. Biochem. Parasitol. 89,271 -282.[Medline]
Hehl, A. B., Lekutis, C., Grigg, M. E., Bradley, P. J.,
Dubremetz, J. F., Ortega-Barria, E., Boothroyd, J. C. (2000).
Toxoplasma gondii homologue of plasmodium apical membrane antigen 1
is involved in invasion of host cells. Infect. Immun.
68,7078
-7086.
Hettmann, C., Herm, A., Geiter, A., Frank, B., Schwarz, E.,
Soldati, T. and Soldati, D. (2000). A dibasic motif in the
tail of an Apicomplexan myosin is an essential determinant of plasma membrane
localization. Mol. Biol. Cell.
11,1385
-1400.
Hoff, E. F., Cook, S. H., Sherman, G. D., Harper, J. M., Ferguson, D. J., Dubremetz, J. F. and Carruthers, V. B. (2001). Toxoplasma gondii: molecular cloning and characterization of a novel 18-kDa secretory antigen, TgMIC10. Exp. Parasitol. 97,77 -88.[Medline]
Kappe, S., Bruderer, T., Gantt, S., Fujioka, H., Nussenzweig, V.
and Menard, R. (1999). Conservation of a gliding motility and
cell invasion machinery in apicomplexan parasites. J. Cell
Biol. 147,937
-944.
Kaslow, D. C., Quakyi, I. A., Syin, C., Raum, M. G., Keister, D. B., Coligan, J. E., McCutchan, T. F. and Miller, L. H. (1988). A vaccine candidate from the sexual stage of human malaria that contains EGF-like domains. Nature 333, 74-76.[Medline]
Marshall, V. M., Tieqiao, W. and Coppel, R. L. (1998). Close linkage of three merozoite surface protein genes on chromosome 2 of Plasmodium falciparum. Mol. Biochem. Parasitol. 94,13 -25.[Medline]
Nagel, S. D. and Boothroyd, J. C. (1988). The
- and ß-tubulins of Toxoplasma gondii are encoded by
single copy genes containing multiple introns. Mol. Biol.
Parasitol. 29,261
-273.
Rabenau, K. E., Sohrabi, A., Tripathy, A., Reitter, C., Ajioka, J. W., Tomley, F. M. and Carruthers, V. B. (2001). TgM2AP participates in Toxoplasma gondii invasion of host cells and is tightly associated with the adhesive protein TgMIC2. Mol. Microbiol. 41,537 -547.[Medline]
Reiss, M., Viebig, N., Brecht, S., Fourmaux, M.-N., Soete, M.,
Di Cristina, M., Dubremetz, J. F. and Soldati, D. (2001).
Identification and characterisation of an Escorter for two secretory adhesins
in Toxoplasma gondii. J. Cell Biol.
152,563
-578.
Shevchenko, A., Wilm, M., Vorm, O. and Mann, M. (1996). Mass spectrometric sequencing of proteins silver-stained polyacrylamide gels. Anal Chem 68,850 -858.[Medline]
Sibley, L. D. and Boothroyd, J. C. (1992). Virulent strains of Toxoplasma gondii comprise a single clonal lineage. Nature 359,82 -85.[Medline]
Soldati, D. and Boothroyd, J. C. (1993).
Transient transfection and expression in the obligate intracellular parasite
Toxoplasma gondii. Science
260,349
-352.
Soldati, D., Dubremetz, J. F. and Lebrun, M. (2002). Microneme proteins: structural and functional requirements to promote adhesion and invasion by the apicomplexan parasite Toxoplasma gondii. Int. J. Parasitol. (in press).
Soldati, D., Lassen, A., Dubremetz, J. F. and Boothroyd, J. C. (1998). Processing of Toxoplasma ROP1 protein in nascent rhoptries. Mol. Biochem. Parasitol. 96, 37-48.[Medline]
Sonda, S., Fuchs, N., Gottstein, B. and Hemphill, A. (2000). Molecular characterization of a novel microneme antigen in Neospora caninum. Mol. Biochem. Parasitol. 108, 39-51.[Medline]
Tomley, F. M., Billington, K. J., Bumstead, J. M., Clarke, J. M. and Monaghan, P. (2002). EtMIC4: A microneme protein from Eimeria tenella that contains tandem arrays of epidermal growth factor- like repeats and thrombospondin type-I repeats. Int. J. Parasitol. (in press).
Wilm, M., Shevchenko, A., Houthaeve, T., Breit, S., Schweigerer, L., Fotsis, T. and Mann, M. (1996). Femtomole sequencing of proteins from polyacrylamide gels by nano- electrospray mass spectrometry. Nature 379,466 -469.[Medline]
Yahiaoui, B., Dzierszinski, F., Bernigaud, A., Slomianny, C., Camus, D. and Tomavo, S. (1999). Isolation and characterization of a subtractive library enriched for developmentally regulated transcripts expressed during encystation of Toxoplasma gondii.Mol. Biochem. Parasitol. 99,223 -235.[Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
H. El Hajj, J. Papoin, O. Cerede, N. Garcia-Reguet, M. Soete, J.-F. Dubremetz, and M. Lebrun Molecular Signals in the Trafficking of Toxoplasma gondii Protein MIC3 to the Micronemes Eukaryot. Cell, June 1, 2008; 7(6): 1019 - 1028. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Kessler, A. Herm-Gotz, S. Hegge, M. Rauch, D. Soldati-Favre, F. Frischknecht, and M. Meissner Microneme protein 8 - a new essential invasion factor in Toxoplasma gondii J. Cell Sci., April 1, 2008; 121(7): 947 - 956. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Bhat, A. Joe, M. PereiraPerrin, and H. D. Ward Cryptosporidium p30, a Galactose/N-Acetylgalactosamine-specific Lectin, Mediates Infection in Vitro J. Biol. Chem., November 30, 2007; 282(48): 34877 - 34887. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Periz, A. C. Gill, L. Hunt, P. Brown, and F. M. Tomley The Microneme Proteins EtMIC4 and EtMIC5 of Eimeria tenella Form a Novel, Ultra-high Molecular Mass Protein Complex That Binds Target Host Cells J. Biol. Chem., June 8, 2007; 282(23): 16891 - 16898. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. D. Brydges, X. W. Zhou, M.-H. Huynh, J. M. Harper, J. Mital, K. D. Z. Adjogble, W. Daubener, G. E. Ward, and V. B. Carruthers Targeted Deletion of MIC5 Enhances Trimming Proteolysis of Toxoplasma Invasion Proteins Eukaryot. Cell, December 1, 2006; 5(12): 2174 - 2183. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Treeck, N. S. Struck, S. Haase, C. Langer, S. Herrmann, J. Healer, A. F. Cowman, and T. W. Gilberger A Conserved Region in the EBL Proteins Is Implicated in Microneme Targeting of the Malaria Parasite Plasmodium falciparum J. Biol. Chem., October 20, 2006; 281(42): 31995 - 32003. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. M. Harper, M.-H. Huynh, I. Coppens, F. Parussini, S. Moreno, and V. B. Carruthers A Cleavable Propeptide Influences Toxoplasma Infection by Facilitating the Trafficking and Secretion of the TgMIC2-M2AP Invasion Complex Mol. Biol. Cell, October 1, 2006; 17(10): 4551 - 4563. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. T. Smith, S. D. Tucker-Samaras, A. H. Fairlamb, and W. J. Sullivan Jr. MYST Family Histone Acetyltransferases in the Protozoan Parasite Toxoplasma gondii Eukaryot. Cell, December 1, 2005; 4(12): 2057 - 2065. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Saouros, B. Edwards-Jones, M. Reiss, K. Sawmynaden, E. Cota, P. Simpson, T. J. Dowse, U. Jakle, S. Ramboarina, T. Shivarattan, et al. A Novel Galectin-like Domain from Toxoplasma gondii Micronemal Protein 1 Assists the Folding, Assembly, and Transport of a Cell Adhesion Complex J. Biol. Chem., November 18, 2005; 280(46): 38583 - 38591. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Gargala, A. Baishanbo, L. Favennec, A. Francois, J. J. Ballet, and J.-F. Rossignol Inhibitory Activities of Epidermal Growth Factor Receptor Tyrosine Kinase-Targeted Dihydroxyisoflavone and Trihydroxydeoxybenzoin Derivatives on Sarcocystis neurona, Neospora caninum, and Cryptosporidium parvum Development Antimicrob. Agents Chemother., November 1, 2005; 49(11): 4628 - 4634. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. W. Zhou, B. F. C. Kafsack, R. N. Cole, P. Beckett, R. F. Shen, and V. B. Carruthers The Opportunistic Pathogen Toxoplasma gondii Deploys a Diverse Legion of Invasion and Survival Proteins J. Biol. Chem., October 7, 2005; 280(40): 34233 - 34244. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. J. Bradley, C. Ward, S. J. Cheng, D. L. Alexander, S. Coller, G. H. Coombs, J. D. Dunn, D. J. Ferguson, S. J. Sanderson, J. M. Wastling, et al. Proteomic Analysis of Rhoptry Organelles Reveals Many Novel Constituents for Host-Parasite Interactions in Toxoplasma gondii J. Biol. Chem., October 7, 2005; 280(40): 34245 - 34258. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Cerede, J. F. Dubremetz, M. Soete, D. Deslee, H. Vial, D. Bout, and M. Lebrun Synergistic role of micronemal proteins in Toxoplasma gondii virulence J. Exp. Med., February 7, 2005; 201(3): 453 - 463. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Keller, M. Riesen, A. Naguleswaran, N. Vonlaufen, R. Stettler, A. Leepin, J. M. Wastling, and A. Hemphill Identification and Characterization of a Neospora caninum Microneme-Associated Protein (NcMIC4) That Exhibits Unique Lactose-Binding Properties Infect. Immun., August 1, 2004; 72(8): 4791 - 4800. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. C. Okhuysen, G. A. Rogers, A. Crisanti, F. Spano, D. B. Huang, C. L. Chappell, and S. Tzipori Antibody Response of Healthy Adults to Recombinant Thrombospondin-Related Adhesive Protein of Cryptosporidium 1 after Experimental Exposure to Cryptosporidium Oocysts Clin. Vaccine Immunol., March 1, 2004; 11(2): 235 - 238. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Buscaglia, I. Coppens, W. G. J. Hol, and V. Nussenzweig Sites of Interaction between Aldolase and Thrombospondin-related Anonymous Protein in Plasmodium Mol. Biol. Cell, December 1, 2003; 14(12): 4947 - 4957. [Abstract] [Full Text] [PDF] |
||||
![]() |
T.-W. Gilberger, J. K. Thompson, M. B. Reed, R. T. Good, and A. F. Cowman The cytoplasmic domain of the Plasmodium falciparum ligand EBA-175 is essential for invasion but not protein trafficking J. Cell Biol., July 21, 2003; 162(2): 317 - 327. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. A. Joiner and D. S. Roos Secretory traffic in the eukaryotic parasite Toxoplasma gondii: less is more J. Cell Biol., May 13, 2002; 157(4): 557 - 563. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||