|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
Research Article |
Cancer Research Campaign Cell Cycle Genetics Group, University of Cambridge, Department of Genetics, Downing Street, Cambridge CB2 3EH, UK
* Author for correspondence (e-mail: dmg25{at}mole.bio.cam.ac.uk )
Accepted 12 November 2001
| Summary |
|---|
|
|
|---|
Key words: Pavarotti, MKLP-1, Actinomyosin, Drosophila oogenesis, Contractile rings
| Introduction |
|---|
|
|
|---|
A characteristic of gametogenesis in Drosophila is that sperm and
the oocyte develop within a cyst of cells. These are derived from a cystoblast
that undergoes four rounds of mitosis with incomplete cytokinesis to produce
16 cells interconnected through 15 cytoplasmic bridges that pass through ring
canals. The ring canals are built around the remnants of the cleavage furrow
and contain several of its molecular components. Pav-KLP is one such component
and is retained in the ring canals of spermatocytes
(Carmena et al., 1998
). In
oogenesis, two of the 16 cells of the egg develop the potential to become
oocytes, but then one of these cells loses its synaptonemal complexes and the
other adopts the oocyte fate (Carpenter,
1975
; Huynh and St Johnston,
2000
; Koch et al.,
1976
). The remaining 15 cells become the highly polyploid nurse
cells that are synthetically active and contribute cytoplasm to the oocyte
(Verheyen and Cooley, 1994
).
Oocyte growth begins slowly during stages 7-10 and then accelerates during
stages 10B and 11 owing to fast transport of nurse cell cytoplasm through the
ring canals accompanied by regression of the nurse cells. The distribution of
Pav-KLP in the early stages of oogenesis had not previously been examined,
although the motor protein was described to be associated with the central
pole body of the tandem second meiotic spindles
(Riparbelli et al., 2000
).
Microtubules are required both for oocyte specification and for the
accumulation of specific mRNAs in the oocyte at early stages (reviewed in
Cooley and Theurkauf, 1994
;
Theurkauf, 1994
). A posterior
microtubule organising centre persists from stage 1 to 6 but is lost during
stages 7 and 8 (Theurkauf et al.,
1992
) and is required to establish an anterior-posterior
microtubule gradient for asymmetric localisation of axis determinants in the
oocyte (reviewed in St Johnston,
1995
). Three distinct populations of microtubules coexist within
the nurse cell cytoplasm: one associated with the surface of polyploid nuclei;
a second extends from the ring canal junctions; and a third dispersed
throughout the cytoplasm (Grieder et al.,
2000
).
The outer rims of the ovarian ring canals, derived from the arrested
cleavage furrow, contain F-actin, the tyrosine kinase Tec29 and in younger egg
chambers also anillin (Cooley,
1998
; Robinson et al.,
1994
). The inner rim also contains the Hu-li tai shao, Kelch and
filamin proteins (Li et al.,
1999
; Robinson et al.,
1994
). In addition to disrupting the inner rim of ring canals,
mutations in cheerio/shi kong, which encodes filamin, disrupt actin
filament organisation and so compromise membrane integrity
(Li et al., 1999
;
Robinson et al., 1997
). Before
the dumping of nurse cell cytoplasm, F-actin cables are formed that radiate
from the nurse cell nuclei to the cell cortex to ensure that nuclei do not
block the ring canals. Such a blockage is observed in mutants for
chickadee, which is required for F-actin polymerisation, and
quail and singed, which both encode actin filament bundling
proteins (Cant et al., 1994
;
Cooley et al., 1992
;
Mahajan-Miklos and Cooley,
1994
). Whereas the earlier transfer of particles seems to be
linked to basket-like actin structures at the ring canals
(Riparbelli and Callaini,
1995
), fast transfer of nurse cell cytoplasm is mediated by myosin
II-dependent contraction of F-actin at the nurse cell cortex
(Cooley et al., 1992
;
Edwards and Kiehart, 1996
;
Wheatley et al., 1995
).
We undertook the present study to define domains of Pav-KLP that direct its subcellular localisation. Knowing that the protein mediates crucial interactions with the microtubule and actin cytoskeleton in dividing cells, we wished to know how its subcellular localisation was controlled as the oocyte forms in the transition between the mitotic divisions of the germarium and meiosis. To this end, we expressed mutant forms of Pav-KLP tagged with GFP in the female germ line. We show that several of these exhibit dominant mutant phenotypes during oogenesis that reflect a need to regulate the amounts and spatiotemporal distribution of the motor protein, and thereby its interactions with both the microtubule and the actin cytoskeleton during the development of the egg chamber.
| Materials and Methods |
|---|
|
|
|---|
This plasmid was introduced using standard procedures into w1118 embryos. Surviving adults were mated individually with w1118 virgin females or males, and progeny showing a mosaic w+ phenotype were identified as transformants. Two homozygous viable and fertile lines were eatablished in which the UGP construct had either inserted on the second (w1118;p[w+ Ub-GFP-Pav-KLP]53) or third (w1118;+;p[w+ Ub-GFP-Pav-KLP]31) chromosome. The insert on the second chromosome was able to rescue pav mutants.
Transformants carrying UAS-GFP-Pav-KLP constructs
Full-length and domain-specific wild-type Pav-KLP constructs
The full-length 3.1 kb pav cDNA 40B15 was first subcloned into
pET28a as an NdeI/NotI fragment to produce construct
A1. A blunt-ended 0.7 kb BglII/SalI DNA fragment
encoding the GFP variant MmGFP was then inserted into the blunt-ended
NdeI site of construct A1 to produce construct A2.
This construct was subsequently digested with SmaI and NotI and the resulting
3.8 kb fragment, which included both the GFP and Pav-KLP genes, was then
ligated into the corresponding sites of the cloning vector pSK to produce
clone A3. The same SmaI/NotI fragment was also
ligated into NotI and blunt-ended KpnI of the
Drosophila transformation vector pUASp
(Rorth, 1998
) to produce the
final construct pUASp-GFP-Pav-KLP (PGP).
The A1construct was digested with BsrGI and
BssHII and then incubated with Klenow enzyme to remove overhanging
nucleotides. A construct B1 was produced by inserting the resulting
blunt-ended 0.6 kb DNA fragment, which encodes the central stalk domain of
Pav-KLP (Pavcoil), into the blunt-ended SalI site of the vector
pßGFP/RN3P+AT. This vector is based on the construct pßGFP/RN3P
(Zernicka-Goetz et al., 1996
)
and contains a
5'-XhoI-SalI-ApaI-HindIII-StuI-3'
linker downstream of the MmGFP gene (A. Tavares, unpublished).
Construct B1 was digested with EcoRI and StuI to
produce a 1.3 kb DNA fragment that includes the Pavcoil coding sequence
downstream of the MmGFP gene. This fragment was subsequently inserted
into EcoRI and blunt-ended XhoI of the other
Drosophila transformation vector pUAST
(Brand and Perrimon, 1993
) to
produce the construct pUAST-GFP-Pavcoil. This product was digested with
BamHI and XbaI and the resulting 1.3 kb GFP-Pavcoil fragment
inserted into the corresponding sites of pUASp to produce the final construct
pUASp-GFP-PavSTALK.
Mutated full-length Pav-KLP constructs
The QuickChangeTM Site-Directed Mutagenesis Kit
(Stratagene) was used to introduce point mutations into either the ATP-binding
site of the motor domain or the C-terminal nuclear localisation signals (NLSs)
of Pavarotti (Fig. 2).
Construct A3 above was used as the initial template unless stated
otherwise.
|
The G131E mutation was introduced into the ATP-binding site using the oligonucleotides GGCGTGACTGGAAGTGAGAAAACGTACACCATG and CATGGTGTACGTTTTCTCACTTCCAGTCACGCC. This mutated form of A3 was digested with SmaI and NotI and the resulting 3.8 kb DNA fragment inserted between the NotI and blunt ended KpnI sites of pUASp to produce pUASp-GFP-PavDEAD.
A three amino-acid K770NR to AAA mutation was introduced into nuclear localisation sequence (NLS) 5 using the oligonucleotides CTATTATGCAGCCGTATCTGGCGGCGGCGAAATCCGTAACG AAACTAAC and GTTAGTTTCGTTACGGATTTCGCCGCCGCCAGATACGGCTGCATAATAG. The resulting mutant SmaI and NotI fragment was purified and inserted into the NotI and blunt-ended KpnI sites of pUASp to produce pUASp-GFP-PavNLS5*.
Successive rounds of mutagenesis were carried out on the previous mutant fragment to introduce first the K770NR to AAA mutation and then the R843KR to AAA mutation. This utilised the following respective pairs of oligonucleotides: CTATTATGCAGCCGTATCTGGCGGCGGCGAAATCCGTAACGAAACTAAC and GTTAGTTTCGTTACGGATTTCGCCGCCGCCAGATACGGCTGCATAATA G; and CCGGTTCACTCGCCCACGGCGGCGGCGCCCAGCAATGGCAACATTTCG and CGAAATGTTGCCATTGCTGGGCGCCGCCGCCGTGGGCGAGTGAACCGG. The final product was inserted into NotI and blunt-ended KpnI of pUASp to produce the final construct pUASp-GFP-PavNLS(4-7)*.
The UASp constructs were transformed into w1118 flies using standard approaches and several homozygous viable and fertile transformants for each of the construct were obtained.
Immunocytochemistry
For Hoechst or rhodamine-phalloidin staining, ovaries were dissected in
PBS, fixed for 15 minutes in 5% Paraformaldehyde (PFA) in PBS, rinsed
extensively with PBS and then incubated in either 0.5 µg/ml Hoechst or 5
u/ml rhodamine-phalloidin (Molecular Probes) in PBS for 20 minutes. After
several washes with PBS, ovaries were mounted in Vectashield mounting medium
H-1000 (Vector Laboratories) and visualized by confocal microscopy (BioRad MRC
1024).
For immunostaining, ovaries were dissected in TriPBS (0.2% Triton-X100 in
PBS), washed 3x with PBS and then incubated for 45 seconds in one volume
of freshly prepared PBS, 1.3% PFA and 1.25 volumes Heptane under vigorous
shaking. Fixation was done in PBS, 3.3% PFA, 5% DMSO for 20 minutes. The
ovaries were washed twice with methanol prior to incubating them in methanol
containing 2% hydrogen peroxide for 30 minutes. After a short wash in TriPBS,
the ovaries were first blocked in TriPBS, 5% FCS for 1 to 3 hours and then
incubated overnight at 4°C in primary antibody diluted in TriPBS
(anti-
-tubulin YL1/2 (Harlan Sera lab) at 1/20; anti-Pavarotti Rb3301
(Adams et al., 1998
) at 1/250,
anti-Hu-li tai shao 6554A (Robinson et
al., 1994
) at 1/1, anti-Staufen
(St Johnston et al., 1991
) at
1/3000, anti-Orbit (Inoue et al.,
2000
) at 1/200, anti-Mini spindles
(Cullen et al., 1999
) at 1/500
and anti-Myosin II 656 (Kiehart and
Feghali, 1986
) at 1/1000). Ovaries were washed twice in TriPBS and
then incubated in secondary antibody diluted in TriPBS for 2 to 3 hours. After
two wash steps with TriPBS and an additional one with PBS, ovaries were
incubated in PBS containing 1 µM TOTO-3 (Molecular Probes) for 45 minutes
to stain DNA. The ovaries were finally mounted in Vectashield mounting medium
H-1000 (Vector Laboratories) overnight at 4°C before visualizing them by
confocal microscopy (BioRad MRC 1024).
Germ-line clone analysis of the pav-klp
In order to study germ line pav clones, we recombined pav
onto an FRT chromosome and then generated females of the genotype yw
FLP22; pav-klp, FRT/TM3 which we crossed to w/Y;
ovoD1, FRT/TM3 males. Eggs were collected daily over a period
of 16 days and the progeny subjected to a 2 hour heat shock at 37°C on two
consecutive days during their late L2 to L3 larval stages. The adult yw
FLP22; pav-klp, FRT/ ovoD1, FRT female progeny were
then checked for fertility over a period of 5 days. The ovoD1
mutation arrests oogenesis at stage 3-4. Thus ovaries of yw
FLP22; pav-klp, FRT/ ovoD1, FRT females should not
form mature egg chambers. Eggs were also not produced after heat shock,
indicating that homozygous pav-klp, FRT clones do not permit egg
formation. In a parallel experiment with vihar, a gene encoding an E2
ubiquitin-conjugating enzyme essential for the development of the syncytial
embryo, we identified approximately 10% of females as egg laying. In each case
we examined about 1000 females for fertility.
| Results |
|---|
|
|
|---|
|
Overexpression of wild-type GFP-Pav-KLP disrupts nurse cell
dumping
All extant pavarotti mutant alleles arrest cell division in cycle
16 of embryogenesis as a result of the failure of cytokinesis
(Adams et al., 1998
). Thus in
order to observe the effect of such mutations upon cell division at later
stages of development, it is necessary to generate homozygous mutant clones of
cells. When we used the ovoD1 system
(Chou et al., 1993
) to generate
clones of homozygous pav cells in the germ line we were unable to
detect the production of eggs or indeed any development beyond oogenesis stage
3-4 when ovoD1 itself causes arrest. Thus pav
appears to be essential for the early stages of oogenesis, most probably for
cell division in the germarium. We therefore turned to address the effects of
overexpressing wild-type and mutant forms of Pav-KLP in the female germ line.
The expression of GFP-Pav-KLP in ovaries from the polyubiquitin
promoter emphasised two aspects of localisation of the protein that are also
seen in proliferating cells, namely its localisation to interphase nuclei and
to the remnants of the central telophase spindle known as the mid-bodies
(Adams et al., 1998
). We wished
to determine which domains within the protein were responsible for these
features of localisation and to this end chose to construct and express
GFP-tagged mutant and wild-type forms of the gene introduced as transgenes
into flies. Conscious that the expression of such mutant proteins may lead to
lethality, we chose to use a variant on the GAL4/UAS conditional system
(Brand and Perrimon, 1993
) that
enables germ line expression during oogenesis
(Rorth, 1998
). Flies carrying
the appropriate mutant transgenes in the pUASp vector were then crossed with
flies carrying GAL4-VP16 (Sadowski et al.,
1988
) under control of the maternal
4-tubulin
promoter (a kind gift of D. St Johnston). We used this system to express
full-length wild-type Pav-KLP and several mutant forms each fused to GFP to
facilitate localisation of the encoded protein. The construction of mutants
was influenced by a preliminary report that the stalk domain of MKLP-1 appears
to target the motor protein to the midzone of mammalian mitotic spindles
(Matuliene and Kuriyama, 1998
)
and that sequences in the C-terminal domain of MKLP-1 specify its nuclear
localisation (Deavours and Walker,
1999
). We therefore constructed a gene encoding only the central
stalk region of the molecule fused to GFP (GFP-PavSTALK) and several variants
of the full-length Pav-KLP molecule containing mutations in putative nuclear
localisation sequences (NLSs) in its C-terminus (GFP-PavKLPNLS5*
and GFP-PavKLPNLS(4-7)*). It had also been shown that mutations in
a conserved ATP-binding domain of Kar3 protein, a yeast kinesin-related motor,
caused the mutant protein to bind and stabilise cytoplasmic microtubules
(Meluh and Rose, 1990
). We
therefore constructed an equivalent mutation in the ATP-binding site of
Pav-KLP that we expected would direct the synthesis of an inactive protein
(GFP-PavDEAD) (Fig. 2). We have
examined the consequences of the expression of each of these proteins in
females carrying one copy of the UASp construct and one copy of the
4-tubulin-driven GAL4-VP16 transgene.
Whereas expression of the wild-type Pav-KLP tagged with GFP from the polyubiquitin promoter permitted the development of fertile females, we found expression of the equivalent protein from the GAL4-VP16/UASp system resulted in female sterility. This was associated with an increase in expression level by 5-10 fold over wild-type as indicated by western blots on whole ovaries (Fig. 2B). We observed that a common defect in the ovaries of these sterile flies was that nurse cells were not contained within the anterior half of the egg chamber, instead whole nurse cells or nurse cell nuclei protruded into the oocyte compartment (Fig. 3B,C). Moreover such mislocalised nurse cells did not regress as normally occurs when nurse cells dump their contents, so leading to the formation of eggs with several large nuclei. In up to 40% of egg chambers there was no fast cytoplasmic streaming from the nurse cells into the oocyte, the nurse cells failed to regress, and eggs never reached full size (Fig. 3D). Most stage 2 to 10A egg chambers overexpressing the protein contained a speckled distribution of GFP-Pav-KLP within their nurse cell nuclei (arrow, Fig. 3A) and ring canals (arrowhead, Fig. 3A). This frequently developed into a filamentous network in the nuclei of oocytes (inset, Fig. 3A and arrowhead, Fig. 3E) and nurse cells (small arrow, Fig. 3B and arrow, Fig. 3E). These filamentous structures were not stained with antibodies against tubulin or myosin or by the F-actin-binding toxin phalloidin. Nevertheless, knowing the Pav-KLP can interact with microtubules we wished to investigate whether the network was sensitive to colchicine and so isolated ovarioles from females fed with 1 mg/ml of this drug for 24 hours. The egg chambers from such ovarioles contained only a punctate GFP-Pav-KLP fluorescence in their nurse cell nuclei (arrow, Fig. 3F) and uniform fluorescence in the oocyte nucleus (arrowhead, Fig. 3F). This colchicine sensitivity implies that the network is microtubule based. It suggests that tubulin may be drawn into the nuclei by the abundance of the Pav-KLP protein in which case the failure of anti-tubulin antibodies to recognise the structure might be due to the steric hindrance imposed by the high levels of the motor protein. However, other explanations cannot be discounted, and it is possible that destabilisation of cytoplasmic microtubules may result in failure of some other protein essential for the stability of the nuclear filaments to associate with the nucleus.
|
We also found that the oocyte (identified by Staufen localisation) was often misplaced within earlier stage egg chambers. In wild-type egg chambers, the oocyte moves around the cortex in region 2 of the germarium to reach its final destination at the posterior. Egg chambers overexpressing GFP-Pav-KLP sometimes had an oocyte that was not positioned at the posterior (Fig. 3G). Nevertheless, stage 10 egg chambers containing nurse cells within the oocyte compartment (arrow, Fig. 3H) were still able to localise Staufen protein properly at the posterior pole (arrowhead, Fig. 3H), indicating that some intercellular transport functions were still intact.
The central stalk of Pav-KLP is responsible for its localisation to
the outer rim of ring canals
In contrast to the female sterility seen when full-length Pav-KLP is
overexpressed using the GAL4-VP16/UASp system, females expressing only the
stalk domain fused to GFP in this way were fully viable and fertile.
Strikingly, the fusion protein was specifically seen in the 15 ring canals
connecting the nurse cells and the oocyte at all stages of oogenesis
(Fig. 4). When expression was
driven by daughterless-GAL4, we also found staining in the
cytoplasmic bridges between follicular cells (not shown). This suggests that
the coiled coil domain alone is sufficient for ring canal localisation of
Pav-KLP. We looked to see when and where GFP-PavSTALK localised to the ring
canals with respect to either the Hu-li tai shao isoform ADD-60 and actin
(Theurkauf et al., 1993
;
Tilney et al., 1996
;
Warn et al., 1985
;
Yue and Spradling, 1992
;
Zaccai and Lipshitz, 1996a
;
Zaccai and Lipshitz, 1996b
).
Both of these proteins are recruited to ring canals at the same time in region
2a of the germarium and are enriched toward the inner surface of the ring
canal (Robinson et al., 1994
).
We found that in stage 3-5 egg chambers GFP-PavSTALK fluorescence always
surrounded Hu-li tai shao (Fig.
4) or actin (not shown) staining, suggesting that GFP-Pav-KLP is a
component of the outer rim.
|
Mutant Pav-KLPs incapable of nuclear localisation or putatively
immotile stabilise cytoplasmic microtubules
In dividing cells, members of the MKLP-1 family of kinesin-like proteins
associate with microtubules only during mitosis; during interphase they are
found in the nucleus except KRP110, which shows a perinuclear
distribution (Chui et al.,
2000
). In the founder member of the family, mammalian MKLP-1, this
appears to be mediated by a classic nuclear localisation sequences (NLSs) in
the C-terminal domain of the molecule
(Deavours and Walker, 1999
).
The equivalent region of Pav-KLP appeared to contain four out of seven such
NLS motifs recognised by the PSORT II program (http://psort.nibb.ac.jp/), two
of which (NLS 6 and 7) were overlapping. To determine whether these sequences
were responsible for the nuclear localisation of Pav-KLP we made mutations in
either NLS 5 or NLS elements 4-7 (Materials and Methods) and placed the mutant
genes tagged with GFP downstream of the UAS regulatory element
(GFP-PavNLS5* and GFP-PavNLS(4-7)* respectively)
(Fig. 2). When expressed using
the GAL4-VP16/UASp system we found that GFP-PavNLS5* showed the
same distribution as the GFP-tagged wild-type protein and was most abundant in
the nurse cell and oocyte nuclei (arrow,
Fig. 5A) and in the ring canals
(arrowhead, Fig. 5A). This
indicates that NLS 5 is not required for nuclear localisation. Females showing
overexpression of GFP-PavNLS(4-7)* in their ovaries were completely
sterile and showed no GFP fluorescence in any nuclei
(Fig. 5B,C). Instead they
showed very strong filamentous GFP fluorescence in the cytoplasm (arrowhead,
Fig. 5B) and at the cortex of
nurse cells as well as in ring canals. These filaments correspond to
microtubules that appear to be more stable than usual microtubules as feeding
flies yeast paste containing 50 µg/ml colchicine for 48 hours resulted only
in their partial depolymerisation. A complete disruption of the network was
achieved however, following feeding with up to 1 mg/ml of colchicine for 24
hours (data not shown).
|
We also observed similar defects following the overexpression of a variant of Pav-KLP with a mutation in the ATP-binding site of the motor domain (GFP-PavDEAD) (Fig. 2). Females overexpressing this molecule were completely sterile and did not lay any eggs. GFP fluorescence was associated with a filamentous cytoplasmic network and ring canals but was not seen within nuclei (arrow, Fig. 5D). This cytoplasmic network appears to become denser as egg chambers become older leading to an accumulation of nurse cell nuclei in the middle of the egg chamber (arrowhead, Fig. 5D). In lines expressing GFP-PavNLS(4-7)* or GFP-PavDEAD, the early stages of nurse cell development and the specification of the oocyte did not appear to be affected. Immunostaining to reveal the Staufen protein indicated that each egg chamber developed a single oocyte, but nevertheless this cell became mispositioned (arrowhead, Fig. 7B) as we had observed following the overexpression of GFP-Pav-KLP (Fig. 3G). However, whereas at later stages in wild-type oogenesis the nurse cells (arrowhead, Fig. 5E) regressed concomitantly with oocyte growth (arrow, Fig. 5E), they failed to do so in egg chambers expressing GFP-PavDEAD, which rarely develop beyond stage 10 (arrowheads, Fig. 5F).
|
To understand further the properties of the cytoplasmic network seen
following expression of either GFP-PavDEAD or GFP-PavNLS(4-7)*, we
asked whether the filaments contained tubulin and whether they were associated
with two microtubule-associated proteins (MAPs) encoded by the orbit
(Inoue et al., 2000
) and
mini spindles (msps)
(Cullen et al., 1999
) genes.
We found extensive colocalisation of GFP-PavDEAD with both tubulin and the
Orbit protein along the cytoplasmic filaments
(Fig. 6A,D; Fig. B,E,
respectively). In contrast, Msps protein did not bind to the filaments in
spite of a high cytoplasmic concentration of the protein (arrow,
Fig. 6C,F). Similar results
were obtained in ovaries overexpressing GFP-PavNLS(4-7)* (data not
shown). This indicates that the filaments contain microtubules to which the
two MAPs show differing affinities. This may reflect an ability of Orbit to
bind to both interphase and M-phase microtubules in contrast to Msps having a
preference for M-phase ones. Alternatively, GFP-PavDEAD may compete with Msps
for microtubule binding. We found, in contrast to wild-type, that egg chamber
microtubules in flies overexpressing GFP-PavDEAD could only be partially
disrupted by feeding yeast paste containing 50 µg/ml colchicine. Following
such treatment, microtubules were found predominantly at the nurse cell cortex
(arrow, Fig. 6H), suggesting
the possibility of stabilising interactions with molecules at the cortex such
as actin (see also below). The oocyte remained void of microtubules following
this treatment (arrowheads, Fig.
6G,H). A concentration of 1 mg/ml of the drug was required in the
food to substantially destabilise microtubules, and even at this concentration
there are residual microtubules that surround the nurse cell nuclei (arrow,
Fig. 6I).
|
Overexpression of putatively immotile Pav-KLP leads to loss of
cortical actin, membrane breakdown and formation of cytoskeletal
aggregates
We were frequently able to observe egg chambers containing 32 cells in the
ovaries of flies overexpressing GFP-PavDEAD or GFP-PavNLS(4-7)*.
These could be seen at early stages (germarial region 3,
Fig. 7A) when we also observed
defects in oocyte positioning (Fig.
7B), and also at later stages of oogenesis
(Fig. 7D-F). The origins of
such egg chambers could be explained either by fusion of two chambers or by an
extra round of mitosis in the germarium, as occurs in encore mutants
(Hawkins et al., 1996
). We
were able to eliminate the latter possibility by counting the number of ring
canals in each egg chamber. Egg chambers arising because of an additional
fifth round of mitosis would have two cells with 5 ring canals only one of
which would become an oocyte. Instead all of the 32-cell cysts in the dominant
Pav-KLP mutants had two independent oocytes each with 4 ring canals indicating
that fusion of egg chambers had occurred
(Fig. 7E). Staining of
ovarioles with fluorescent phalloidin revealed a number of localised defects
in the actin cytoskeleton in these mutant flies. In the wild-type egg chamber,
F-actin filaments are conspicuous in the nurse cell boundaries (arrowhead,
Fig. 7C) and especially at the
oocyte cortex (OC). Fused egg chambers showed varying degrees of loss of the
actin cytoskeleton. When fusion had taken place early in oogenesis, all nurse
cells within the cyst were similar in size
(Fig. 7E). However we also
observed cysts containing fused egg chambers of different ages where, for
example, the older one (cyst 1 in Fig.
7F) had higher levels of the GFP-tagged protein (in this case
PavNLS(4-7)*) associated with the microtubular network. The older
egg chamber in this fused cyst is particularly interesting as it exemplifies
the collapse of ring canals (RC) and breakdown of the actin cytoskeleton
between nurse cells (arrowhead) that we observed in both fused and non-fused
egg chambers at this stage. It also reveals the colocalisation of microtubules
with cortical actin. Thus the accumulation of GFP-Pav in the cytoplasm on
stabilised microtubules appears to disrupt the organisation of cortical actin
and thereby compromises membrane integrity. In its extreme form all of the
internal membranes of the egg chamber collapse and both actin and tubulin
accumulate in large aggregates (Fig.
7G).
Since actin filaments are also an important component of ovarian ring
canals (Theurkauf et al.,
1993
; Tilney et al.,
1996
; Warn et al.,
1985
), and these are linked to the plasma membrane, it was of
interest to know whether the accumulation of the dominant mutant forms of
Pav-KLP had any effect on their structure. Towards this end we examined the
localisation of the adducin homologue Hu-li tai shao. In contrast to wild-type
egg chambers, where the ADD-60 isoform of Hu-li tai shao is only localised in
ring canals (arrowhead, Fig.
7H), we found that in early egg chambers overexpressing
GFP-PavDEAD it was also present in the cortical cytoplasm of nurse cells
(arrow, Fig. 7I), showing a
similar distribution to cortical actin. We also found that the actin-tubulin
aggregates that accumulate in the egg chambers once cell membranes have broken
down also contain the Hu-li tai shao protein (data not shown). This appears to
occur in concert with the progressive breakdown of the ring canal structures.
Thus cytoplasmic accumulation of Pav-KLP either as a consequence of
inactivating the motor or mutating nuclear localisation signals appears not
only to result in the accumulation of stable arrays of cytoplasmic
microtubules but also leads to the progressive disruption of the actin
cytoskeleton.
| Discussion |
|---|
|
|
|---|
A specific feature of the localisation of Pav-KLP in wild-type oogenesis is
its accumulation in the transcriptionally quiescent oocyte nucleus. It is
likely that mRNA for the motor protein is actively transported from the nurse
cells to the oocyte cytoplasm, where the protein is synthesised for
transportation into the nucleus for storage. Subsequently the protein appears
to be utilised during female meiosis as it is incorporated into the central
spindle pole body that develops between the tandemly arranged spindles of
meiosis II (Riparbelli et al.,
2000
). When expressed at wild-type levels, we cannot see the
protein becoming incorporated into the nurse cell nuclei within the egg
chamber. It is however, possible that it is simply easier to see the nuclear
localisation in the smaller oocyte nucleus. However, we do observe its
incorporation into nurse cell nuclei following its overexpression. This is
consistent with the known properties of members of the MKLP-1 family, that is
following completion of their function in cytokinesis they localise to nuclei
during interphase (Nislow et al.,
1992
; Adams et al.,
1998
). The only exception is sea urchin KRP110, which
seems to have a perinuclear localisation at that stage
(Chui et al., 2000
).
The overexpression of wild-type Pav-KLP in the female germ line appears not
to affect the four rounds of mitosis that take place in the germarium as egg
chambers contain the correct number of cells. We believe that oocyte
specification may be delayed however, as this is a microtubule-dependent
process (Theurkauf et al.,
1993
). The oocyte is specified but then fails to adopt its correct
anterodorsal positioning during stage 2. It has been argued that the defective
oocyte localisation also seen in spindle C mutants is consequential
to a delay in oocyte determination
(González-Reyes
et al., 1997
). The mipositioning of the oocyte in egg chambers
overexpressing wild-type and mutant forms of Pav-KLP could also be explained
as an indirect consequence of a delay to oocyte specification resulting from
defects in microtubule-mediated transport. Mispositioning of the oocyte is
also seen in mutants for spaghetti squash (sq)
(Jordan and Karess, 1997
),
which encodes a regulatory myosin light chain, which points to the additional
possibility of a role for the actin-myosin cytoskeleton in this process.
The major effect resulting from overexpression of GFP-Pav-KLP is a failure
of nurse cells to `dump' their cytoplasm into the oocyte. In wild-type egg
chambers, thick actin filament bundles are required to keep the ring canals
free from nurse cell nuclei to enable such a process to occur. Such structures
are illuminated by GFP-Pav-KLP expressed at lower levels from the
polyubiquitin promoter but are not observed following overexpression
of the motor protein. These filaments are also missing in egg chambers of
mutants for chickadee, singed and quail
(Cant et al., 1994
;
Cooley et al., 1992
;
Mahajan-Miklos and Cooley,
1994
) where fast cytoplasmic flow is also impaired. Similarly,
sqh mutant egg chambers fail to efficiently transport their nurse
cell cytoplasm into the oocyte (Edwards
and Kiehart, 1996
; Wheatley et
al., 1995
). The overexpression of Pav-KLP may therefore similarly
destabilise the actin cytoskeleton, leading to blockage of the ring canals by
nurse cell nuclei and the failure of nurse cell `dumping' that we observe. We
suspect that the breakdown of the oocyte/nurse cell membrane and protrusion of
nurse cell nuclei into the oocyte cytoplasm may result from an increase in
intracellular pressure following the blockage of the ring canals.
Our findings that a set of overlapping nuclear localisation signals are
present in the C-terminus of Pav-KLP confirms and extends the study by
Deavours and Walker (Deavours and Walker,
1999
) who found similar sequences on the mammalian protein. These
sequences are not in themselves sufficient to mediate nuclear localisation
that can also be prevented by a putative motor inactivating point mutation in
the ATP-binding site of the motor protein. We presume that this is due to
rigour binding of the putatively immotile protein to microtubules that
consequently accumulate in the cytoplasm. It is formally possible that the
functional ATP-binding site is a requirement for nuclear import of Pav-KLP, a
possibility that could be tested in future by defining and mutating the
microtubule-binding site. The rigour-like association of GFP-PavDEAD with
cytoplasmic microtubules is, however, reminiscent of that seen with a yeast
motor protein, Kar3p, carrying the equivalent G131E point mutation in its
ATP-binding site (Meluh and Rose,
1990
). Moreover, when a similar mutant of the mitotic
centromere-associated kinesin (MCAK) was expressed in CHO cells it also
decorated cytoplasmic microtubules and was excluded from the nucleus
(Wordeman et al., 1999
),
suggesting that this may be a common consequence of inhibiting motor function
of kinesin-like proteins.
The microtubule arrays that accumulate when overexpressed Pav-KLP cannot
enter the nucleus are more resistant to the microtubule-depolymerising drug
colchicine than the microtubule arrays of wild-type egg chambers. Although
they retain some specificity for microtubule-associated proteins, shown by
their binding of the Orbit but not the Mini spindles protein, it is unlikely
that they function normally. Ultimately overexpression of
GFP-PavNLS(4-7)* or GFP-PavDEAD leads to a breakdown of the
cortical cytoskeleton of the germ line cells. The GFP-tagged Pav-KLP molecules
and their associated microtubules appear to colocalise with actin in the
cortical cytoplasm, resulting in disruption of cell membranes. This in turn
leads to the formation of aggregates enriched in Pav-KLP, tubulin, actin and
actin-binding proteins such as Huli tai shao, which is a homologue of adducin
that acts as an assembly factor for the spectrin-actin network (Gardner,
1987). It is possibly released from the ring canals as they dissociate and
then associates with the actin aggregates. It is not clear whether this effect
on the actin cytoskeleton is a direct consequence of the accumulation of
microtubules at the cell cortex or whether the ectopic Pav-KLP is sequestering
actin regulatory proteins at this site. This might be detrimental when
permitted to occur at the cell cortex but may have little effect if restricted
to structures such as ring canals, which could occur following overexpression
of the stalk domain alone. The breakdown of nurse cell membranes is also
caused by mutations in sko, a gene encoding filamin, which
cross-links F-actin to nurse cell membranes and ring canals
(Li et al., 1999
). Like the
dominant Pav-KLP mutants, sko mutant egg chambers also have nurse
cell nuclei that transgress into the oocyte compartment in addition to
abnormal ring canals and actin cables (Li
et al., 1999
). Our findings suggest that accumulated cytoplasmic
Pav-KLP leads to a progressively abnormal distribution of actin and its
binding proteins and that this is associated with the breakdown of cell
borders. This may also facilitate the fusion of egg chambers that can occur at
all stages during oogenesis in the dominant mutants.
We will not fully understand the function of Pav-KLP until we know
precisely what molecules it interacts with and the nature of the cargoes it
carries. As a kinesin-like protein, it might be expected to interact with
microtubules as is demonstrated by our studies. Our present findings imply
that the protein may also interact with the contractile actin ring or proteins
that regulate its function during cytokinesis to become incroporated into the
cytokinesis remnant. To date the closest hint of any possible interaction of
the protein with any potential regulator of the actin cytoskeleton is given by
the observation that recruitment of the C. elegans MKLP-1 homologue
ZEN-4 to the spindle midzone requires interaction with a GTPase-activating
protein CYK-4 (Jantsch-Plunger et al.,
2000
). GTPase-activating proteins of this type regulate the
activity of Rho family GTPases, which have a function in contractile ring
assembly. Knowledge of the interactions that Pav-KLP makes with other
molecules to coordinate microtubule and microfilament behaviour together with
the dynamics of these processes will be essential for understanding its roles
in mitosis and interphase.
| Acknowledgments |
|---|
4 tubulin-driven GAL4-VP16 line.
We are grateful for a Programme Grant from the Cancer Research Campaign, and
to the European Union, which supported Gianluca Minestrini through a Training
Network. | References |
|---|
|
|
|---|
Adams, R., Tavares, A., Salzberg, A., Bellen, H. and Glover, D.
M. (1998). pavarotti encodes a kinesin-like protein
required to organize the central spindle and contractile ring for cytokinesis.
Genes Dev. 12,1483
-1494.
Brand, A. H. and Perrimon, N. (1993). Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development 118,401 -415.[Abstract]
Cant, K., Knowles, B., Mooseker, M. and Cooley, L.
(1994). Drosophila singed, a fascin homolog, is required
for actin bundle formation during oogenesis and bristle extension.
J. Cell Biol. 125,369
-380.
Carmena, M., Riparbelli, M., Minestrini, G., Tavares, A., Adams,
R., Callaini, G. and Glover, D. M. (1998).
Drosophila Polo kinase is required for cytokinesis. J.
Cell Biol. 143,659
-671.
Carpenter, A. C. T. (1975). Electron microscopy of meiosis in Drosophila melanogaster females. Structure, arrangement, and temporal change of the synaptonemal complex in wild type. Chromosoma 51,157 -182.[Medline]
Chou, T. B., Noll, E. and Perrimon, N. (1993). Autosomal p[ovo(D1)] dominant female-sterile insertions in Drosophila and their use in generating germ-line chimeras. Development 119,1359 -1369.[Abstract]
Chui, K., Rogers, G., Kashina, A., Wedaman, K., Sharp, D.,
Nguyen, D., Wilt, F. and Scholey, J. (2000). Roles of two
homotetrameric kinesins in sea urchin embryonic cell division. J.
Biol. Chem. 275,38005
-38011.
Cooley, L., Verheyen, E. and Ayers, K. (1992). chickadee encodes a profilin required for intercellular cytoplasm transport during Drosophila oogenesis. Cell 69,173 -184.[Medline]
Cooley, L. and Theurkauf, W. (1994).
Cytoskeletal functions during Drosophila oogenesis.
Science 266,590
-595.
Cooley, L. (1998). Drosophila ring canal growth requires Src and Tec kinases. Cell 93,913 -915.[Medline]
Cullen, C., Deak, P., Glover, D. M. and Ohkura, H.
(1999). mini spindles: A gene encoding a conserved
microtubule-associated protein required for the integrity of the mitotic
spindle in Drosophila. J. Cell Biol.
146,1005
-1018.
Deavours, B. and Walker, R. (1999). Nuclear localization of C-terminal domains of the kinesin-like protein MKLP-1. Biochem. Biophys. Res. Commun. 260,605 -608.[Medline]
Edwards, K. and Kiehart, D. (1996). Drosophila nonmuscle myosin II has multiple essential roles in imaginal disc and egg chamber morphogenesis. Development 122,1499 -1511.[Abstract]
Gardner, K. and Bennett, V. (1987). Modulation of spectrin-actin assembly by erythrocyte adducin. Nature 328,359 -362.[Medline]
Giorgi, F. (1978). Intercellular bridges in ovarian follicles of Drosophila melanogaster. Cell Tissue Res. 186,413 -422.[Medline]
Gonzalez-Reyes, A., Elliott, H. and St Johnston, D. (1997). Oocyte determination and the origin of polarity in Drosophila: the role of the spindle genes. Development 124,4927 -4937.[Abstract]
Grieder, N., de Cuevas, M. and Spradling, A. C. (2000). The fusome organizes the microtubule network during oocyte differentiation in Drosophila. Development 127,4253 -4264.[Abstract]
Hawkins, N., Thorpe, J. and Schüpbach, T. (1996). encore, a gene required for the regulation of germ line mitosis and oocyte differntiation during Drosophila oogenesis. Development 122,281 -290.[Abstract]
Huynh, J. and St Johnston, D. (2000). The role of BicD, egl, orb and the microtubules in the restriction of meiosis to the Drosophila oocyte. Development 127,2785 -2794.[Abstract]
Inoue, Y., do Carmo Avides, M., Shiraki, M., Deak, P.,
Yamaguchi, M., Nishimoto, Y., Matsukage, A. and Glover, D. M.
(2000). Orbit, a novel microtubule-associated protein essential
for mitosis in Drosophila melanogaster. J. Cell
Biol. 149,153
-166.
Jantsch-Plunger, V., Gönczy, P.,
Romano, A., Schnabel, H., Hamill, D., Schnabel, R., Hyman, A. and Glotzer,
M. (2000). CYK-4: a Rho family GTPase activating protein
(GAP) required for central spindle formation and cytokinesis. J.
Cell Biol. 149,1391
-1404.
Jordan, P. and Karess, R. (1997). Myosin light
chain-activating phosphorylation sites are required for oogenesis in
Drosophila. J. Cell Biol.
139,1805
-1819.
Kiehart, D. and Feghali, R. (1986). Cytoplasmic
myosin from Drosophila melanogaster. J. Cell Biol.
103,1517
-1525.
Koch, E., Smith, P. and King, R. (1976). The division and differentiation of Drosophila cystocytes. J. Morphology 121,55 -70.
Lee, K., Yuan, Y., Kuriyama, R. and Erikson, R. (1995). Plk is an M-phase specific protein kinase and interacts with a kinesin-like protein, CHO1/MKLP-1. Mol. Cell. Biol. 15,7143 -7151.[Abstract]
Li, M., Serr, M., Edwards, K., Ludmann, S., Yamamoto, D.,
Tilney, L., Field, C. and Hays, T. (1999). Filamin is
required for ring canal assembly and actin organization during
Drosophila oogenesis. J. Cell Biol.
146,1061
-1073.
Mahajan-Miklos, S. and Cooley, L. (1994). The villin-like protein encoded by the Drosophila quail gene is required for actin bundle assembly during oogenesis. Cell 78,291 -301.[Medline]
Matuliene, J. and Kuriyama, R. (1998). The stalk domain is essential for targeting of kinesin-like protein CHO1/MKLP1 to the midzone of mammalian mitotic spindles. Mol. Biol. Cell 9,243 .
Meluh, P. and Rose, M. (1990). kar3, a kinesin-related gene required for yeast nuclear fusion. Cell 60,1029 -1041.[Medline]
Nislow, C., Lombillo, V., Kuriyama, R. and McIntosh, J. R. (1992). A plus end directed motor enzyme that moves antiparallel microtubules in vitro and localizes to the interzone of mitotic spindles. Nature 359,543 -547.[Medline]
Powers, J., Bossinger, O., Rose, D., Strome, S. and Saxton, W. (1998) A nematode kinesin required for cleavage furrow advancement. Curr. Biol. 8,1133 -1136.[Medline]
Raich, W., Moran, A., Rothman, J. and Hardin, J.
(1998). Cytokinesis and midzone microtubule organization in
Caenorhabditis elegans require the kinesin-like protein ZEN-4.
Mol. Biol. Cell 9,2037
-2049.
Riparbelli, M. and Callaini, C. (1995). Cytoskeleton of the Drosophila egg chamber: new observations on microfilament distribution during oocyte growth. Cell Motil. Cytoskeleton 31,298 -306.[Medline]
Riparbelli, M., Callaini, C. and Glover, D. M. (2000). Failure of pronuclear migration and repeated divisions of polar body nuclei associated with MTOC defects in polo eggs of Drosophila.J. Cell Sci. 113,3341 -3350.[Abstract]
Robinson, D., Cant, K. and Cooley, L. (1994). Morphogenesis of Drosophila ovarian ring canals. Development 120,2015 -2025.[Abstract]
Robinson, D., Smith-Leiker, T., Sokol, N., Hudson, A. and Cooley, L. (1997). Formation of the Drosophila ovarian ring canal inner rim depends on cheerio.Genetics 145,1063 -1072.[Abstract]
Rorth, P. (1998). Gal4 in the Drosophila female germline. Mechanisms of Development 78,113 -118.[Medline]
Sadowski, I., Ma, J., Triezenberg, S. and Ptashne, M. (1988). GAL4-VP16 is an unusually potent transcriptional activator. Nature 335,563 -564.[Medline]
Sellitto, C. and Kuriyama, R. (1988).
Distribution of a matrix component of the midbody during the cell cycle in
Chinese Hamster Ovary cells. J. Cell Biol.
106,431
-439.
Severson, A., Hamill, D., Carter, J., Schumacher, J. and Bowerman, B. (2000). The Aurora-related kinase AIR-2 recruits ZEN-4/CeMKLP1 to the mitotic spindle at metaphase and is required for cytokinesis. Curr. Biol. 10,1162 -1171.[Medline]
St Johnston, D., Beuchle, D. and Nüsslein-Volhard, C. (1991). staufen, a gene required to localize maternal RNAs in the Drosophila egg. Cell 66, 51-63.[Medline]
St Johnston, D. (1995). The intracellular localization of messenger RNAs. Cell 81,161 -170.[Medline]
Theurkauf, W., Smiley, S., Wong, M. and Alberts, B. (1992). Reorganization of the cytoskeleton during Drosophila oogenesis: Implications for axis specification and intercellular transport. Development 115,923 -936.[Abstract]
Theurkauf, W., Alberts, B., Jan, Y. and Jongens, T. (1993). A central role for microtubules in the differentiation of Drosophila oocytes. Development 118,1169 -1180.[Abstract]
Theurkauf, W. (1994). Microtubules and cytoplasm organization during Drosophila oogenesis. Dev. Biol. 165,352 -360.[Medline]
Tilney, L., Tilney, M. and Guild, G. (1996).
Formation of actin filament bundles in the ring canals of developing
Drosophila follicles. J. Cell Biol.
133, 61-74.
Verheyen, E. and Cooley, L. (1994). Looking at oogenesis. Methods Cell Biology 44,545 -561.[Medline]
Warn, R., Gutzeit, H., Smith, L. and Warn, A. (1985). F-actin rings are associated with the ring canals of the Drosophila egg chambers. Exp. Cell Res. 157,355 -363.[Medline]
Wheatley, S., Kulkarni, R. and Karess, R. (1995). Drosophila nonmuscle myosin II is required for rapid cytoplasmic transport during oogenesis and for axial nuclear migration in early embryos. Development 121,1937 -1946.[Abstract]
Wordeman, L., Wagenbach, M. and Maney, T. (1999). Mutations in the ATP-binding domain affect the subcellular distribution of mitotic centromere-associated kinesin (MCAK). Cell Biol. Int. 23,275 -286.[Medline]
Yue, L. and Spradling, A. C. (1992). hu-li
tai shao, a gene required for ring canal formation during
Drosophila oogenesis, encodes a homolog of adducin. Genes
Dev. 6,2443
-2454.
Zaccai, M. and Lipshitz, H. (1996a). Differential distributions of two adducin-like protein isoforms in the Drosophila ovary and early embryo. Zygote 4, 159-166.[Medline]
Zaccai, M. and Lipshitz, H. (1996b). Role of Adducin-like (hu-li tai shao) mRNA and protein localization in regulating cytoskeletal structure and function during Drosophila oogenesis and early embryogenesis. Dev. Genet. 19,249 -257.[Medline]
Zernicka-Goetz, M., Pines, J., Ryan, K., Siemering, K., Haseloff, J., Evans, M. and Gurdon, J. (1996). An indelible lineage marker for Xenopus using a mutated green fluorescent protein. Development 122,3719 -3724.[Abstract]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
M. P. Greenbaum, N. Iwamori, J. E. Agno, and M. M. Matzuk Mouse TEX14 Is Required for Embryonic Germ Cell Intercellular Bridges but Not Female Fertility Biol Reprod, March 1, 2009; 80(3): 449 - 457. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Jang, T. Rahman, V. S. Kober, J. Cesario, and K. S. McKim Misregulation of the Kinesin-like Protein Subito Induces Meiotic Spindle Formation in the Absence of Chromosomes and Centrosomes Genetics, September 1, 2007; 177(1): 267 - 280. [Abstract] [Full Text] [PDF] |
||||
![]() |
J.-G. Delcros, C. Prigent, and R. Giet Dynactin targets Pavarotti-KLP to the central spindle during anaphase and facilitates cytokinesis in Drosophila S2 cells J. Cell Sci., November 1, 2006; 119(21): 4431 - 4441. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. K. Jang, T. Rahman, and K. S. McKim The Kinesinlike Protein Subito Contributes to Central Spindle Assembly and Organization of the Meiotic Spindle in Drosophila Oocytes Mol. Biol. Cell, October 1, 2005; 16(10): 4684 - 4694. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Goshima and R. D. Vale Cell Cycle-dependent Dynamics and Regulation of Mitotic Kinesins in Drosophila S2 Cells Mol. Biol. Cell, August 1, 2005; 16(8): 3896 - 3907. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Y. N. Goldstein, Y.-N. Jan, and L. Luo Function and regulation of Tumbleweed (RacGAP50C) in neuroblast proliferation and neuronal morphogenesis PNAS, March 8, 2005; 102(10): 3834 - 3839. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. H. Inoue, M. S. Savoian, T. Suzuki, E. Mathe, M.-T. Yamamoto, and D. M. Glover Mutations in orbit/mast reveal that the central spindle is comprised of two microtubule populations, those that initiate cleavage and those that propagate furrow ingression J. Cell Biol., July 5, 2004; 166(1): 49 - 60. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. P. D'Avino, M. S. Savoian, and D. M. Glover Mutations in sticky lead to defective organization of the contractile ring during cytokinesis and are enhanced by Rho and suppressed by Rac J. Cell Biol., July 5, 2004; 166(1): 61 - 71. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Liu, T. Zhou, R. Kuriyama, and R. L. Erikson Molecular interactions of Polo-like-kinase 1 with the mitotic kinesin-like protein CHO1/MKLP-1 J. Cell Sci., July 1, 2004; 117(15): 3233 - 3246. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Glotzer Cleavage furrow positioning J. Cell Biol., February 2, 2004; 164(3): 347 - 351. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. Minestrini, A. S. Harley, and D. M. Glover Localization of Pavarotti-KLP in Living Drosophila Embryos Suggests Roles in Reorganizing the Cortical Cytoskeleton during the Mitotic Cycle Mol. Biol. Cell, October 1, 2003; 14(10): 4028 - 4038. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Mathe, Y. H. Inoue, W. Palframan, G. Brown, and D. M. Glover Orbit/Mast, the CLASP orthologue of Drosophila, is required for asymmetric stem cell and cystocyte divisions and development of the polarised microtubule network that interconnects oocyte and nurse cells during oogenesis Development, March 1, 2003; 130(5): 901 - 915. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||