|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
Research Article |

1 Osteo-Angiogenesis Group, Gesellschaft für
Biotechnologische Forschung (GBF), Mascheroder Weg 1, 38124 Braunschweig,
Germany
2 Institute of Cellbiochemistry and Clinical Neurobiology, University Hospital
Eppendorf, 22529 Hamburg, Germany
3 Skeletal Biotech. Laboratory, Hebrew University, Jerusalem, Israel
Author for correspondence (e-mail:
ggr{at}gbf.de
)
Accepted 12 November 2001
| Summary |
|---|
|
|
|---|
Key words: Brachyury, BMP, Cartilage, Chondrocyte, FGFR, Signal transduction
| Introduction |
|---|
|
|
|---|
Different complex transcriptional control mechanisms regulate the initial
commitment stage of mesenchymal stem cell formation through to the final
manifestation of the mesenchymal tissue type. It has been demonstrated that
varying types of transcription factors govern such mechanisms. For example
basic helix-loop-helix factors (bHLH) (Myo-D, Myf-5, MRF4 and Myogenin)
regulate the differentiation of skeletal muscle cells
(Arnold and Winter, 1998
). A
member of the nuclear hormone receptor family (PPAR
2) determines
adipocyte differentiation (Tontonoz et
al., 1994
), and the runt-family member CBFA1 is required
for osteoblast determination and differentiation
(Komori and Kishimoto, 1998
).
The exact transcriptional mechanisms that determine development into the
chondrogenic lineage are unknown, although it has been documented that SOX9, a
member of the high-mobility-group (HMG) box protein superfamily, is required
(Lefebvre and De Crombrugghe,
1998
). Mutations in Sox9 cause abnormalities (Campomelic
Dysplasia) in cartilage-derived skeletal structures
(Wagner et al., 1994
;
Foster et al., 1994
). Several
investigations, also involving chimeric mice, demonstrate that SOX9 is a major
regulator of cartilage-specific genes (collagen II, XI)
(Bridgewater et al., 1998
;
Lefebvre et al., 1998
) and is
crucially involved in chondrocyte formation
(Bi et al., 1999
). Similarly,
it could be also demonstrated that HLH-transcription factor
Scleraxis-/- cells in chimeric mice are excluded from regions of
the embryo that are involved in the formation of skeletal structures
(Brown et al., 1999
).
Recently, we and others found that in MSCs, BMP-signaling regulates
differentiation to the osteogenic and the chondrogenic lineages in quite
different ways. BMP-mediated SMAD-signaling seems to be necessary during the
entire osteoblast-developmental sequence. In the case of chondrogenesis, BMPs
are necessary for induction; however, the BMP-mediated SMAD signaling is not
sufficient to significantly induce or promote chondrogenic differentiation in
either the mesenchymal stem cell line C3H10T1/2 or in the prechondrogenic cell
line ATDC5 (Fujii et al.,
1999
; Ju et al.,
2000
). We now show that BMP2-mediated upregulation of Fibroblast
Growth Factor (FGF) receptor 3 (FGFR3) seems to be involved in the induction
of chondrogenic differentiation of MSCs. This finding is with agreement with
evidence that FGF-signaling is intimately involved in skeletal development
(Wilkie et al., 1995
;
Colvin et al., 1996
;
Deng et al., 1996
). It is
shown here that forced expression of FGFR3 in MSCs (C3H10T1/2) leads to the
onset of the chondrogenic lineage. We have also found the T-box containing
transcription factor Brachyury, which is capable of mediating the
FGFR3-dependent onset of chondrogenesis in these MSCs, following screening for
transcription factors exhibiting a chondrogenic capacity in C3H10T1/2.
Brachyury, or T, is the founder member of a family of
transcription factors that share the T-box, a 200-amino-acid DNA-binding
domain (reviewed in Smith,
1997
; Papaioannou,
1997
). The mouse Brachyury gene is expressed at high
rates during gastrulation and is required for differentiation of the notochord
and the formation of mesoderm during posterior development
(Kispert et al., 1995
). Then
Brachyury expression is downregulated at mid to late gestation
periods. Here we show that FGFR3-mediated signaling induces expression of
Brachyury in mesenchymal stem cell line C3H10T1/2. Forced expression
of Brachyury in MSCs in vitro and ectopically, in vivo, is sufficient
to initiate chondrogenic development in these MSCs. Therefore, T-box family
members such as Brachyury may be factor(s) required not only for
patterning but also contributing to the determination of the chondrogenic
lineage.
| Materials and Methods |
|---|
|
|
|---|
Cell culture and stable transfections
Human embryonic kidney cells HEK293T and murine C3H10T1/2 progenitor cells
were routinely cultured in tissue culture flasks in Dulbecco's modified
Eagle's medium supplemented with 10% heat-inactivated fetal calf serum (FCS),
0.2 mM L-glutamine and antibiotics (50 i.u./ml penicillin, 50 mg/ml
streptomycin). Cells were transfected using DOSPER according to the
manufacturer's protocol (Roche Diagnostics, Mannheim, Germany). C3H10T1/2
cells that recombinantly express BMP2 (C3H10T1/2-BMP2) cells were obtained by
cotransfection with pSV2pac followed by selection with puromycin (2.5
µg/ml). FGFR3, Brachyury and the T-box domain were polymerase
chain reaction (PCR)-amplified and cloned into expression vectors pMT7T3 and
pMT7T3-pgk, which are under the control of the LTR of the myeloproliferative
virus or of the murine phosphoglycerate kinase promoter-1, respectively
(Ahrens et al., 1993
). The
integrity of the constructs was confirmed by sequencing. HA-tags were added to
the carboxy terminus of full-length Brachyury and its T-box domain by
PCR with primers encoding the respective peptide sequence. Stable expression
of the DNA binding T-box domain (amino acids (aa) 1-229) and of the
dominant-negative human FGFR3 without the cytoplasmatic tyrosine kinase
domains (aa 1-414) in the C3H10T1/2-BMP2 background was done by cotransfection
with pAG60, conferring resistance to G418 (750 µg/ml). Individual clones
were picked, propagated and tested for recombinant FGFR3, dnFGFR3,
Brachyury or T-box domain (dnBrachyury) expression by
reverse-transcription-coupled PCR (RT-PCR) (see below). Selected cell clones
were subcultivated in the presence of puromycin or puromycin/G418 and the
selective pressure was maintained during subsequent manipulations. C3H10T1/2
cells were cultured in DMEM containing 10% FCS. The features of C3H10T1/2-BMP2
cells have been described (Ahrens et al.,
1993
; Hollnagel et al.,
1997
;
Bächner et
al., 1998
). For assessment of in vitro osteo/chondrogenic
development, cells were plated at a density of 5-7.5x103
cells/cm2 and after reaching confluence (arbitrarily termed day 0),
ascorbic acid (50 µg/ml) and 10 mM ß-glycerophosphate were added as
specified by Owen et al. (Owen et al.,
1990
).
BMP2 inductions
For BMP2-stimulation studies, C3H10T1/2 cells were plated at a density of
1x104/cm2 in a 9-cm culture dish. After 48 hours
cells were washed 3x with phosphate-buffered saline (PBS) and then cells
were starved for 24 hours in DMEM without serum. Before induction the medium
was replaced with fresh DMEM without serum. Cells were then treated for the
indicated times using recombinant BMP2 from E. coli (50 ng/ml).
Cycloheximide (50 µg/ml) treatment started 30 minutes prior to the addition
of BMP2.
RNA preparation and RT-PCR
Total cellular RNAs were prepared by TriReagentLS according to
the manufacturer's protocol (Molecular Research Center Inc.). 5 µg of total
RNA was reverse-transcribed and cDNA samples were subjected to PCR. RT-PCR was
normalized by the transcriptional levels of hypoxanthine guanine
phosphoribosyl transferase (HPRT). The HPRT-specific 5' and 3'
primers were GCTGGTGAAAAGGACCTCT and AAGTAGATGGCCACAGGACT, respectively. The
following 5' and 3' primers were used to evaluate
osteo/chondrogenic differentiation: collagen 1a1: GCCCTGCCTGCTTCGTG,
CGTAAGTTGGAATGGTTTTT; collagen 2a1: CCTGTCTGCTTCTTGTAAAAC,
AGCATCTGTAGGGGTCTTCT; osteocalcin: GCAGACCTAGCAGACACCAT,
GAGCTGCTGTGACATCCATAC; PTH/PTHrP-receptor: GTTGCCATCATATACTGTTTCTGC,
GGCTTCTTGGTCCATCTGTCC; FGFR3: CCTGCGCAGTCCCCCAAAGAAG; CTGCAGGCATCAAAGGAGTAGT;
FGFR2: TTGGAGGATGGGCCGGTGTGGTG, GCGCTTCATCTGCCTGGTCTTG. The primer pairs for
Brachyury and Sox9 have been described
(Johansson and Wiles, 1995
;
Zehentner et al., 1999
),
respectively. Vector-borne transcripts for Brachyury were evaluated
with nested primer sets using either vector-specific 5'- or
3'-primers: TTAGTCTTTTTGTCTTTTATTTCA; GATCGAAGCTCAATTAACCCTCAC.
Western blotting
Recombinant cells from Petri dishes (13.6 cm diameter) were harvested at
different time points before (day B2), at (day 0) and after (days 2, 4, 7)
confluence. Lysis was in RIPA buffer (1% (v/v) Nonidet P-40, 0.1% SDS (w/v),
0.5% sodium deoxycholate in PBS, containing 100 µg/ml phenyl methyl
sulfonyl fluoride (PMSF), 2 µg/ml aprotinin and 1 mM Na3
VO4). Lysates were centrifuged (30 minutes, 10,000
g, 4°C) and the supernatants were stored at -70°C
until analysis. Protein concentration of the lysates was determined using
Coomassie Brilliant Blue staining. Protein was precipitated with ethanol,
resuspended in reducing (containing dithiothreitol (DTT)) or non-reducing
sample buffer and subjected to SDS-gel electrophoresis in 12.5%T
polyacrylamide gels (20 µg/lane). Proteins were transferred to
nitrocellulose membranes by semidry-blotting. Protein transfer was checked by
staining the membranes with Ponceau S. After blocking, membranes were
incubated incubated overnight at 4°C with a polyclonal antibody to the
HA-tag (SC-805, Santa Cruz Biotechnology, Santa Cruz, CA, USA) diluted 1:200
(v/v) in blocking solution. FGFR3 and FGFR2 antibodies were from Santa Cruz
Biotechnology (#SC-123, #SC-122; Santa Cruz, CA, USA). The secondary antibody
(Dianova, Hamburg) was applied at 1:5000 (v/v) dilution in blocking solution
for 2 hours at room temperature. Color development was performed with
4-chloro-1-naphthol and H2O2.
Histological methods and verification of cellular phenotypes
Osteoblasts exhibit stellate morphology and display high levels of alkaline
phosphatase, which was visualized by cellular staining with Sigma Fast
BCIP/NBT (Sigma, St Louis, MO, USA). Proteoglycan-secreting chondrocytes were
identified by staining with Alcian Blue at pH 2.5 and staining with Safranin O
(Sigma, St. Louis, MO, USA). For collagen-immunohistochemistry cells were
washed with PBS and fixed with methanol for 15 minutes at -20°C. Primary
antibodies were diluted with 1% goat serum in PBS. Monoclonal anti-collagen II
antibodies (Quartett Immunodiagnostika, Berlin, Germany, # 031502101) were
diluted 1:50 (v/v) and monoclonal anti-collagen X antibodies (Quartett
Immunodiagnostika, Berlin, Germany, # 031501005) 1:10 (v/v), respectively.
Incubation was for 1 hour at room temperature followed by staining with Zymed
HistoStain SP kit (Zymed Laboratories Inc., San Francisco, CA, USA), applying
the manufacturer's protocol. A positive signal is indicated by a red
precipitate of aminoethylcarbazole (AEC).
In vivo transplantation
Before in vivo transplantation, samples (2-3x106 cells)
were mounted on individual type I collagen sponges (Colastat7
#CP-3n, Vitaphore Corp., 2x2x4 mm) and transplanted into the
abdominal muscle of female nude mice (4-8 weeks old). Before transplantation
animals were anaesthetized intraperitoneally (i.p.) with ketamine-xylazine
mixture (30 µl/per mouse) and injected i.p. with 5 mg/mouse of Cefamzolin
(Cefamezin7, TEVA). Skin was swabbed with chlorhexidine gluconate
0.5% and cut in the middle abdominal area; an intramuscular pocket was formed
in a rectal abdominal muscle and filled with the collagen sponge containing
cells. Skin was sutured with surgical clips. For the detection of engrafted
C3H10T1/2 cells the mice were killed at 10 days and 20 days after
transplantation. Operated transplants were fixed in 4% paraformaldehyde
cryoprotected with 5% sucrose overnight, embedded and frozen. Sections were
prepared with a cryostat (Bright, model OTF) and stained with Haematoxylin and
Eosin (HE), Alcian Blue and Safranin O.
RNA in situ hybridization
Embryos were isolated from pregnant NMRI mice at day 18.5 post conception
(d.p.c.). The embryos were fixed overnight with 4% paraformaldehyde in PBS at
4°C. 10 µm cryosections were mounted on
aminopropyltriethoxysilane-coated slides and non-radioactive RNA in situ
hybridizations were done as described
(Bächner et
al., 1998
) and by following the instructions of the manufacturer
(Roche, Mannheim). Briefly for hybridization, sense- and antisense RNA probes
from a 1.8 kb murine Brachyury cDNA were used. For the generation of
collagen 1a1 or collagen 2a1 the vector pMT7T3 was used, harbouring specific
probes
(Metsäranta
et al., 1991
). Hybridization was performed with 0.5-2 µg
denatured riboprobe/ml) overnight at 65°C in a humid chamber. For
digoxygenin (DIG)-detection, slides were blocked in 5x SSC, 0.1% Triton,
20% FCS for 30 minutes following two washes with DIG-buffer 1 (100 mM Tris,
150 mM NaCl, pH 7.6) for 10 minutes. Slides were incubated in
anti-DIG-alkaline-phosphatase-coupled antibodies diluted 1:500 (v/v) in
DIG-buffer 1 overnight in a humid chamber. Slides were washed with 0.1% Triton
in DIG-buffer 1 for 2 hours with several changes of the washing solution and
equilibrated in DIG-buffer 2 (100 mM Tris, 100 mM NaCl, 50 mM
MgCl2). Detection was performed using BM-purple substrate (Roche,
Mannheim) in DIG-buffer 2 with 1 mM levamisole for 1-6 hours, depending on the
probe. The reaction was stopped in TE-buffer and slides were incubated in 3%
paraformaldehyde in PBS for 3 minutes, followed by 0.1 M glycine in PBS for 3
minutes, and washed three times in PBS for 3 minutes. Slides were
counterstained with 0.5% Methylene Green in PBS for 1 minute, dehydrated in a
graded alcohol series, air dried and mounted with Eukitt.
| Results |
|---|
|
|
|---|
|
The immediate BMP2-dependent upregulation of FGFR3 in MSCs (C3H10T1/2) and the inherent capacity of this receptor to initiate chondrogenic development in these cells, prompted the development of a screen for FGFR3-regulated transcription factors. Among the transcription factors tested we observed that the T-box transcription factor Brachyury was upregulated in FGFR3-expressing C3H10T1/2 cells (see also Fig. 5A). Furthermore, we noticed that Brachyury possesses a chondrogenic potential after recombinant expression in wild-type C3H10T1/2 cells (see below).
|
Forced expression of the T-box Factor Brachyury leads to
chondrogenic development in C3H10T1/2 mesenchymal stem cells
Brachyury was originally described as the first member of a family
of transcription factors that harbors a T-box as the DNA-binding domain. In
addition, it has been reported that FGF and/or TGF-ß ligand-induced
expression levels of T-box genes appear to be critical for their biological
effects (O'Reilly et al.,
1995
; Tada et al.,
1997
). To investigate whether the FGFR3-dependent upregulation of
the T-box factor Brachyury in C3H10T1/2 might play a role in
chondrogenesis, we expressed Brachyury cDNA under the control of the
murine phosphoglycerate kinase-1 (PGK-1) in the mesenchymal stem cell line
C3H10T1/2 to allow moderate expression levels of Brachyury
(C3H10T1/2-Brachyury). The recombinant expression of
Brachyury cDNA under the control of the murine phosphoglycerate
kinase-1 (PGK-1) in MSCs (Fig.
2A) gave rise to efficient chondrogenic differentiation, resulting
in alkaline phosphatase-positive cells (beginning at day 4) and Alcian
Blue-positive chondrocyte-like cells (at day 10 post-confluence;
Fig. 2B). Three individual
C3H10T1/2 clones were investigated for their chondrogenic potential and gave
similar results. Immunohistochemistry confirmed the presence of the
chondrocyte-specific collagen 2 but not of collagen X, which is typical of
late stages of chondrocytic differentiation (hypertophic chondrocytes)
(Fig. 2B, left). Major marker
genes of chondrogenic and osteogenic development show a transient (collagen
2a1, PTH/PTHrP-receptor) or permanent (osteocalcin gene and the chondrogenic
transcription factor Sox9) upregulation in
C3H10T1/2-Brachyury, in comparison with C3H10T1/2 cells, that were
stably transfected with an empty expression vector
(Fig. 2C). Although induction
of the osteocalcin gene indicates an osteogenic potential for
C3H10T1/2-Brachyury, ectopic transplantation of these cells in murine
intramuscular sites results exclusively in the massive formation of
proliferating chondrocytes and cartilage
(Fig. 2D). These ectopic
transplantations were performed three times and in all cases the transplants
developed chondrocytes and cartilage. After both 10 and 20 days, transplants
exhibit the histological presence of proteoglycans (Alcian Blue, Safranin O)
while bony elements or mineralized particles are not observed
(Fig. 2D). After 20 days the
ectopic implants show areas of extensive extracellular matrix production as
visualized by histological analyses (Fig.
2D). The use of stronger viral promoters such as the LTR of the
myeloproliferative virus (see Materials and Methods) resulted in increased
cellular proliferation without the apparent formation of histologically
distinct mesenchymal cell types (not shown).
|
Dominant-negative Brachyury interferes with BMP2-dependent
chondrogenic development in MSCs
We expected that Brachyury's DNA-binding domain (T-box, aa 1-229)
without the associated regulatory domains (aa 230-436) should
dominant-negatively (dn) interfere with endogenous Brachyury-mediated
events in C3H10T1/2-BMP2 cells. A partial nuclear localization signal (NLS),
which has been attributed to the T-box domain, should allow a substantial
nuclear accumulation (Kispert et al.,
1995
). We confirmed the dominant-negative nature of the T-box
domain in DNA cotransfection assays performed in HEK293 T cells. We used this
particular cell line because expression levels are, in general, considerably
higher in these cells than in C3H10T1/2. This cell line does not express
Brachyury (data not shown). Exogenous Brachyury
transactivated a construct containing two copies of the consensus
Brachyury binding element (BBE) oligonucleotide fused to a minimal
HSV thymidine kinase (TK)-minimal promoter-CAT chimeric gene,
pBBE(2x)-CAT5 (Fig. 3A).
Indeed, contransfection of pBBE(2x)-CAT5 with a recombinant
Brachyury-expressing vector resulted in a 25-fold activation, whereas
an empty expression vector had no effect
(Fig. 3A). Cotransfection of
full-length Brachyury (Brachyury wt) with increasing amounts
of an expression vector expressing the T-box domain (dnBrachyury)
(1:1, 1:2, 1:3) led to a clear decrease in CAT (sevenfold). Exogenous
dnBrachyury alone transactivated pBBE(2x)-CAT5 (BBE) only threefold.
|
The forced expression of the HA-tagged T-box domain (dnBrachyury) is observed throughout in vitro cultivation (Fig. 3B) and strongly interfered with the BMP2-mediated formation of alkaline phosphatase-positive osteoblast-like and Alcian Blue-stained chondrocyte-like cells in vitro (Fig. 3E). In vivo, in ectopic transplantations of C3H10T1/2-BMP2 in intramuscular sites, dnBrachyury allowed the development of connective tissue only (Fig. 3E). In addition, the chondrocyte-specific collagen 2al mRNA levels are more sensitive to the presence of dnBrachyury than mRNA levels of the distinct osteogenic marker osteocalcin. The latter is hardly affected, consistent with the idea that Brachyury possesses a predominantly chondrogenic capacity in this particular cell type. Interestingly, the BMP2-mediated transcriptional upregulation of FGFR3 in C3H10T1/2 is not obstructed by dnBrachyury, indicating that the immediate BMP2-mediated FGFR3 induction is independent of Brachyury or other T-Box factors (Fig. 3C,D). However, FGFR2-expression, which exhibits a delayed response in C3H10T1/2-BMP2 cells (Figs 1, 3), displays a high sensitivity to dnBrachyury. BMP-mediated FGFR2 expression is almost completely suppressed by the dominant-negative acting T-box domain (Fig. 3C,D). This may indicate that that the presence of FGFR2 seems necessary for the osteo/chondrogenic differentiation in this mesenchymal progenitor line (Fig. 3C,D).
Furthermore, this suggests a hierarchy of FGFR-mediated signaling for chondrogenic development. FGFR3-dependent signaling is induced at first by BMP2 and, as a consequence, FGFR2-mediated signaling becomes active. Such a model is proposed in Fig. 7. This model predicts that a forced expression of dominant-negative FGFR3 would interfere with BMP2-mediated chondrogenesis and with FGFR2 and Brachyury expression. Indeed, an FGFR3-variant without the cytoplasmatic tyrosine-kinase domains downregulates BMP2-dependent mRNA expression levels of FGFR2 and Brachyury (Fig. 4B) and interferes with the histological manifestation of alkaline phosphatase- or Alcian Blue-positive chondrocyte-like cells (Fig. 4A).
|
|
FGFR3 and the T-box factor Brachyury are involved in an
autoregulatory loop for chondrogenic development in C3H10T1/2 progenitors
During amphibian gastrulation, mesodermal Brachyury is involved in
an autoregulatory loop with FGF that is present in the embryo
(Kim et al., 1998
). In
C3H10T1/2 cells several FGF genes tested (FGF2, 4 and 9) were not
Brachyury- or FGFR3- regulated (data not shown) and, therefore, are
unlikely to be members of such a loop. However, a loop does seem to exist
between FGFR3 and Brachyury, since forced expression of either one
leads to the induction of the other in C3H10T1/2
(Fig. 5A). These experiments
indicate that after BMP2-mediated initiation of the chondrogenic lineage, the
chondrogenic differentiation may advance for some time in a BMP2-independent
fashion, maintained by the autoregulatory loop between FGFRs and FGF-regulated
transcription factors such as the T-box factor Brachyury.
In an earlier study (Ju et al.,
2000
) we showed that BMP-mediated R-Smad signaling alone is not
sufficient for cartilage development in C3H10T1/2 cells. Forced expression of
Smad1 or the biologically active Smad1-MH2 domain is thereby able to mimic
BMP2-mediated onset of osteogenic differentiation
(Takeuchi et al., 2000
).
However, in contrast to osteogenic marker genes such as the osteocalcin gene,
Smad1-MH2 domain-signaling is not sufficient to mimic BMP2-dependent FGFR3-
and the concomitant Brachyury-gene induction
(Fig. 5B). Other BMP-activated
R-Smads such as Smad5 and Smad8 are also unable to mediate or to mimic
BMP2-dependent FGFR3-induction in C3H10T1/2 cells (data not shown), indicating
the existence of R-Smad-MH2-independent pathways for FGFR3 induction or,
alternatively, cooperative activities of R-Smads with other transcription
factors (Mazars et al.,
2000
).
The T-box factor Brachyury is expressed in maturing
cartilage during murine embryonic development
From the results in mesenchymal stem cell line C3H10T1/2 we concluded that
Brachyury might also play a role in skeletogenesis in vivo.
Brachyury is expressed at high levels early in vertebrate embryonic
development and is involved in gastrulation and in the dose-dependent
determination of mesodermal cell fates (see Introduction and Discussion).
After gastrulation, Brachyury expression is downregulated and
persists in the notochord to the end of embryogenesis
(Kispert and Herrmann, 1994
).
Comparative mRNA expression analysis of murine Brachyury (Bra),
collagen 1a1 (col 1a1) and collagen 2a1 (col 2a1) in skeletal development
(18.5 d.p.c.) indicates that Brachyury is expressed at significant
levels in cartilage-forming cells of the intervertebral disks and in limb bud
development (Fig. 6).
Expression of Brachyury is enhanced in intervertebral disc
development in the nucleus pulposus in 18.5 d.p.c. mouse embryos
(Fig. 6Aa,d) confirming earlier
reports (Wilkinson et al.,
1990
). Collagen 1a1 is expressed in the outer annulus (arrowheads
in Fig. 6Ab,e), and collagen
2a1 in the cartilage primordium of the vertebrae
(Fig. 6Ac,f). In transverse
sections made at the level of the upper lumbar vertebra, expression of
Brachyury is also detectable in distinct chondrogenic cells of the
neural arch (Fig. 6Ah) whereas
collagen 1a1 expression is maintained in the outer annulus
(Fig. 6Ai), as is collagen 2a1
in the cartilage primordium (Fig.
6Aj). In murine limb bud development (18.5 d.p.c.; hind limb)
expression of Brachyury is evident in distinct chondrogenic cells of
the forming metatarsal bones (Fig.
6Ba-c). In contrast, collagen 1a1 is expressed in the outer
periosteal layer (Fig. 6Bd-f)
and collagen 2a1 expression is enhanced in differentiating chondrocytes
(Fig. 6Bg-i). Interestingly,
like in intervertebral disc formation, the expression of Brachyury is
only evident in chondrocyte-like cells that do not express Col 2a1 indicating
that Brachyury expression is upregulated in chondrogenic cells before or after
collagen 2 expression.
|
| Discussion |
|---|
|
|
|---|
Brachyury's role during chondrogenic differentiation of
MSCs
FGFR3-mediated signaling initiated chondrogenic differentiation in
mesenchymal stem cell line C3H10T1/2, and the T-box containing transcription
factor Brachyury fulfilled the requirements as a target for
FGF-mediated chondrogenesis (Figs
1,
2,
3,
4,
5). Although expression of
Brachyury in C3H10T1/2 upregulates mRNA levels of osteocalcin, which
is a specific marker for late osteogenesis, bony centers or mineralized
particles have never been observed in ectopic implantations. This might
indicate that Brachyury expression is sufficient for chondrogenesis
rather than for osteogenesis. However, Brachyury could mediate
differentiation of bipotential osteo/chondrogenic progenitors where the
chondrogenic lineage prevails, eventually. In addition we noted the absence of
enchondral bone formation in ectopic transplants, which is in contrast to
transplanted C3H10T1/2 cells expressing BMPs. It is known that BMPs may
contribute to enchondral bone formation by their ability to induce VEGF. This
may stimulate angiogenesis and vasculogenesis, which are prerequisites for the
presence of phagocytic and osteogenic cells to replace hypertrophic cartilage
by bone (Yeh and Lee, 1999
;
Kozawa et al., 2001
). It seems
that Brachyury is not involved in these events.
The model of BMP2-dependent osteo/chondrogenic development in mesenchymal
stem cells C3H10T1/2 suggests that BMP2 predominantly initiates and determines
osteo/chondrogenic development via BMPR-IA
(Fig. 7). In C3H10T1/2 cells
BMPR-IB only exerts minor functions (our unpublished observations). Then, the
BMP2-mediated R-Smad signaling regulates predominantly osteogenesis and not
chondrogenesis (Ju et al.,
2000
). R-Smad-signaling seems to be required during the entire
osteoblast developmental sequence, possibly also by recruiting Cbfa1 into a
heteromeric complex with activated Smad proteins
(Hanai et al., 1999
). In
contrast, BMP2-dependent determination of chondrogenesis in the mesenchymal
stem cell line C3H10T1/2 seems to involve the immediate upregulation of FGFR3
by an R-Smad-independent mechanism.
The signaling pathway for this BMP2-dependent immediate induction of FGFR3
is not clear; however, recently it has been demonstrated that TGF-ß
signaling activates MAPK-pathways through the small GTP binding proteins Cdc42
and Rac1, which leads to a cooperative effect between Smad2/3 and AP1 for gene
activation. Similar mechanisms may play a role for BMP2-mediated activation of
FGFR3 (Mazars et al., 2000
;
Dennler et al., 2000
).
As discussed above, after this triggering event, chondrogenesis seems to be
predominantly controlled by BMP-independent mechanisms. The interference of
dominant-negative Brachyury (i.e. the T-box domain) with
BMP2-mediated FGFR2- but not with FGFR3- expression indicates that FGFR2
expression is dependent on Brachyury, and that an autoregulatory loop
may be initiated by FGFR3, and seems to be maintained between FGFR3/FGFR2 and
Brachyury (Fig. 3A).
In contrast, mRNA-levels for the transcription factor Sox9 are not
significantly altered by dnBrachyury expression. Since both factors,
Sox9 and Brachyury, are regulated by FGF signaling
(Fig. 1, Fig. 2C) it is conceivable that
different FGF-mediated signalling pathways activate Brachyury or
Sox9, since FGFR-mediated MAPK-signaling also upregulates mRNA levels
of the chondrogenic transcription factor Sox9
(Murakami et al., 2000
). This
suggests that FGFs and FGF-receptors, the MAPK pathway, Sox9 and T-box
factor(s) are essential components for the BMP-dependent onset of
chondrogenesis (Fig. 7).
Consequently, a block of the FGFR3-mediated signaling cascade should interfere
with BMP2-mediated FGFR2 and Brachyury induction as well as with
cartilage formation. Forced expression of dominant-negative FGFR3 (dnFGFR3) in
C3H10T1/2-BMP2 cells fulfils these criteria, indeed. Osteo/chondrogenic
differentiation is severely reduced on a histological basis
(Fig. 4A) as well as on
expression levels of FGFR2 and Brachyury
(Fig. 4B). Interestingly, a
role for another T-box factor (Tbx2) in skeletal cell development was
postulated recently (Chen et al.,
2001
).
FGF-mediated Brachyury induction
Brachyury expression in vivo is induced and carefully controlled
during gastrulation. Thereafter Brachyury expression is downregulated
but persists in the tailbud and the notochord. Brachyury expression
in vivo is controlled by FGF, Wnt- and activin signaling pathways. Here in
C3H10T1/2 an FGFR3-dependent induction of Brachyury transcription is
monitored. What could be the mechanism for FGF-dependent activation of the
Brachyury gene in the C3H10T1/2 cellular system?
One way of Brachyury induction that has been discussed is a
synergism between FGF-signaling cascades and SRF (Serum Response Factor),
because SRF is downstream of the MAPK signaling cascade and mouse embryos
lacking functional SRF protein do not form mesoderm and do not express
Brachyury (Arsenian et al.,
1998
). However, a constitutively active form of SRF does not
induce expression of Xbra (Panitz
et al., 1998
) and therefore SRF activity in expression of
Brachyury seems to be indirect. Also, based on in vitro and in vivo
studies it has been suggested that Brachyury induction may be
mediated by Wnt-signaling (Arnold et al.,
2000
; Smith et al.,
2000
). However, it has recently been documented that Wnt-signaling
is involved in the maintenance but not in the induction of Brachyury
and mesoderm synthesis (Galceran et al.,
2001
).
So we think that among the likely mechanisms leading to the early
upregulation of Brachyury in mesenchymal progenitors, C3H10T1/2 may
be the derepression of members of the
EF1 family of
transcriptional repressors. It has been demonstrated that point mutations
disrupting
EF1 binding-sites in the Xbra promoter
(Remacle et al., 1999
) change
the mesodermal expression of reporter constructs and result in widespread
ectodermal and endodermal misexpression
(Lerchner et al., 2000
). Of
the
EF1 family members, SIP1 is able to interact with activated Smad
proteins and to interfere with transcription of endogenous Xbra
(Verschueren et al.,
1999
).
It seems highly conceivable that SIP1 is bound to its binding sites in the Brachyury promoter in C3H10T1/2 since SIP1 has high basal levels of expression (data not shown). Although not yet entirely clear, SIP-1 could dissociate from DNA when associated with an activated Smad molecule. This would call for two signaling cascades involved in the early induction of Brachyury, one of which is involved in BMP/Smad-mediated derepression of the Brachyury promoter and the other for the onset of Brachyury transcription. Since FGF-signaling alone seems to be sufficient for Brachyury induction in C3H10T1/2, one might envisage that endogenously expressed TGF-ß family members might be sufficient to enable a significant derepression of the Brachyury promoter but that additional (i.e. FGF-)signaling cascades are needed to elicit a significant Brachyury synthesis.
Also not seen during the cultivation of recombinant C3H10T1/2-FGFR3 cells,
a downregulation of Brachyury transcription in vivo could be mediated
by an FGFR3-dependent upregulation of sprouty gene expression. The
latter inhibits FGFR-mediated signalling
(Minowada et al., 1999
;
Wakioka et al., 2001
) and
would interfere with FGFR3-mediated Brachyury gene expression,
eventually.
Brachyury's function in skeletal development
Does Brachyury, which has been extensively characterized in early
embryonic development, also play a role later in the
determination/differentiation of chondrogenic tissue in vivo? It has been
shown that Brachyury is highly expressed during gastrulation, where
it plays a decisive role in the generation of undifferentiated mesoderm, and,
thereafter, Brachyury expression is downregulated (reviewed in
Papaioannou and Silver, 1998
;
Smith, 1999
). Here, we show
that in situ hybridizations detect substantial levels of Brachyury
mRNA in maturing chondrogenic tissue at late stages of embryonic development
(18.5 d.p.c.) during spine formation and especially in the intervertebral
discs (Fig. 6). The part of the
disc structure that appears to play an important role in its function is the
nucleus pulposus, which is an avascular gelatinous tissue located between the
endplates of the vertebral bodies and the inner lamellae of the annulus
fibrosus. The integrity of the gelatinous matrix of the nucleus pulposus seems
to be essential for the load bearing of the discs. The nucleus pulposus cells
generate only poorly developed cartilage, with low amounts of collagens 2a1
and 1a1 but a high concentration of aggrecan. In situ analyses showed that
collagen 2a1 is expressed in chondrocytes surrounding the nucleus pulposus
while collagen 1a1 is expressed in the flanking outer annulus
(Fig. 6). Brachyury is
highly expressed in the nucleus pulposus cells that are of notochordal origin,
consistent with it being a marker gene for axial (notochordal) mesoderm.
Notochordal expression of Brachyury is regulated by an enhancer that
is not yet mapped (Lerchner et al.,
2000
). In the notochord-derived nucleus pulposus cells it cannot
be excluded that a similar element is used for driving T-gene expression. The
high level of Brachyury expression and its potential chondrogenic
capacity might indicate that this ensures the cartilaginous character of the
nucleus pulposus. In contrast to the fibrous nature of the inner annulus,
Brachyury is also significantly upregulated in distinct chondrocytes,
forming hyaline cartilage of the vertebral body
(Fig. 6A). An upregulation of
Brachyury expression in chondrocytes of the hind limb metatarsals is
also observed. There, Brachyury seems to be upregulated in a set of
chondrogenic cells at an early state of maturation, i.e. in cells where
collagen 2a1 is not yet expressed (Fig.
6B). Alternatively, these cells could be pre-hypertrophic
chondrocytes. Expression of Brachyury in pre-hypertrophic
chondrocytes would be consistent with the suggestion that this gene is
upregulated in response to FGFR3, whose gene is expressed at high levels
before chondrocytes undergo hypertrophy. It would also be consistent with the
observations that ectopic expression of Brachyury in C3H10T1/2 cells
resulted in production of alkaline phosphatase, and activation of the genes
for PTH/PTHrP-receptor and osteocalcin.
Are there then genetic indications that Brachyury is involved in
the differentiation/patterning of skeletal elements? Interestingly, Bennett
(Bennett, 1958
) demonstrated
that cartilage formation is not induced in somites from T/T embryos. In
addition, Brachyury mutant alleles have been described that
counteract the activity of the wild-type protein
(Kispert, 1995
). These
mutations carry truncations in the C terminus and appear to act as
dominant-negatives. Consistent with the in situ expression analyses here
(Fig. 6A), heterozygous
dominant-negative Brachyury-mutant mice exhibit skeletal phenotypes
such as complete or near-complete absence of the tail, absence of the odontoid
process of the axis, absence of the nuclei pulposi of the intervertebral
discs, a tendency for rib and vertebral fusions, and an occasional absence of
presacral vertebrae and ribs, suggesting a later role for the
Brachyury gene in morphogenesis and function of notochord-derived
tissue (Wilkinson et al.,
1990
; Kispert and Herrmann,
1994
).
A key step to understanding Brachyury function is the
identification of target genes. Two major cloning strategies have led to the
isolation of Brachyury-regulated downstream targets in
Xenopus and ascidians involved in gastrulation and switching on the
notochord (Tada et al., 1998
;
Takahashi et al., 1999
;
Saka et al., 2000
).
Interestingly, mRNAs have been identified that seem to be upregulated by
ectopic Brachyury expression such as cartilage-specific collagen 2a1
and collagen 11a1 (Takahashi et al.,
1999
).
It has been suggested that a hypothetical competence factor (CF) acts to
promote the chondrogenic response to BMP signaling during the generation of
axial and appendicular cartilage (Murtaugh
et al., 1999
). In the absence of such a signal, presomitic
mesoderm assumes a lateral plate fate as its response to BMPs. Sonic hedgehog
(Shh) can provide the competence to respond to BMP by differentiating into
chondrocytes. Also limb bud mesenchymal cells assume the competence to convert
to chondrocytes upon BMP treatment, otherwise exogenous BMPs induce apoptosis.
As in the somite, it is suggested that a hypothetical factor (CF) acts to
promote chondrogenic response to BMP signalling. The nature of signal which
induces competence in the limb bud is unclear.
Although the nature of the CF is unknown it might be temptative to
speculate that transcription factors of the T-box family could exert a CF-like
role on transcriptional level. Brachyury is expressed in
axial/paraxial mesodermal structures during early embryonic development while
others that could exert such a role are expressed later in the limb bud. The
finding mentioned above, that in somite/notochord cocultivation experiments
cartilage formation may be induced in normal but not in somites from T/T
embryos (Bennett, 1958
), could
indicate a CF-like role for Brachyury. It would also be consistent
with the skeletal phenotypes in Brachyury mutant mice described
above.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Ahrens, M., Ankenbauer, T., Schröder, D., Hollnagel, A., Mayer, H. and Gross, G. (1993). Expression of Human Bone Morphogenetic Proteins -2 or -4 in Murine Mesenchymal Progenitor C3H10T1/2 Cells Induces Differentiation into Distinct Mesenchymal Cell Lineages. DNA Cell Biol. 12,871 -880.[Medline]
Arnold, H. H. and Winter, B. (1998). Muscle differentiation: more complexity to the network of myogenic regulators. Curr. Opin. Genet. Dev. 8, 539-544.[Medline]
Arnold, S. J., Stappert, J., Bauer, A., Kispert, A., Herrmann, B. G. and Kemler, R. (2000). Brachyury is a target gene of the Wnt/beta-catenin signaling pathway. Mech. Dev. 91,249 -258.[Medline]
Arsenian, S., Weinhold, B., Oelgeschlager, M., Ruther, U. and Nordheim, A. (1998). Serum response factor is essential for mesoderm formation during mouse embryogenesis. EMBO J. 17,6289 -6299.[Medline]
Bächner, D., Ahrens, M., Schroder, D., Hoffmann, A., Lauber, J., Betat, N., Steinert, P., Flohe, L. and Gross, G. (1998). Bmp-2 downstream targets in mesenchymal development identified by subtractive cloning from recombinant mesenchymal progenitors (C3H10T1/2). Dev. Dyn. 213,398 -411.[Medline]
Bennett, D. (1958). In vitro Study of Cartilage Induction in T/T mice. Nature 181, 1286[Medline]
Bi, W., Deng, J. M., Zhang, Z., Behringer, R. R. and De Crombrugghe, B. (1999). Sox9 is required for cartilage formation. Nat. Genet. 22, 85-89.[Medline]
Boshart, M., Kluppel, M., Schmidt, A., Schütz, G. and Luckow, B. (1992). Reporter constructs with low background activity utilizing the cat gene. Gene 110,129 -130.[Medline]
Bridgewater, L. C., Lefebvre, V. and De Crombrugghe, B.
(1998). Chondrocyte-specific enhancer elements in the Col1
1a2 gene resemble the Col2a1 tissue-specific enhancer.
J. Biol. Chem. 273,14998
-15006.
Brown, D., Wagner, D., Li, X., Richardson, J. A. and Olson, E. N. (1999). Dual role of the basic helix-loop-helix transcription factor scleraxis in mesoderm formation and chondrogenesis during mouse embryogenesis. Development 126,4317 -4329.[Abstract]
Chen, J., Zhong, Q., Wang, J., Cameron, R. S., Borke, J. L., Isales, C. M. and Bollag, R. J. (2001). Microarray analysis of Tbx2-directed gene expression: a possible role in osteogenesis. Mol. Cell Endocrinol. 177, 43-54.[Medline]
Colvin, J. S., Bohne, B. A., Harding, G. W., McEwen, D. G. and Ornitz, D. M. (1996). Skeletal overgrowth and deafness in mice lacking fibroblast growth factor receptor 3. Nat. Genet. 12,390 -397.[Medline]
Deng, C., Wynshaw-Boris, A., Zhou, F., Kuo, A. and Leder, P. (1996). Fibroblast growth factor receptor 3 is a negative regulator of bone growth. Cell 84,911 -921.[Medline]
Dennler, S., Prunier, C., Ferrand, N., Gauthier, J. M. and Atfi, A. (2000). C Jun inhibits TGFbeta-mediated transcription by repressing smad3 transcriptional activity. J. Biol. Chem. (in press).
Foster, J. W., Dominguez-Steglich, M. A., Guioli, S., Kowk, G., Weller, P. A., Stevanovic, M., Weissenbach, J., Mansour, S., Young, I. D. and Goodfellow, P. N. (1994). Campomelic dysplasia and autosomal sex reversal caused by mutations in an SRY-related gene. Nature 372,525 -530.[Medline]
Fujii, M., Takeda, K., Imamura, T., Aoki, H., Sampath, T. K.,
Enomoto, S., Kawabata, M., Kato, M., Ichijo, H. and Miyazono, K.
(1999). Roles of bone morphogenetic protein type I receptors and
smad proteins in osteoblast and chondroblast differentiation. Mol.
Biol. Cell 10,3801
-3813.
Galceran, J., Hsu, S. C. and Grosschedl, R.
(2001). Rescue of a Wnt mutation by an activated form of LEF-1:
regulation of maintenance but not initiation of Brachyury expression.
Proc. Natl. Acad. Sci. USA
98,8668
-8673.
Gazit, D., Ebner, R., Kahn, A. J. and Derynck, R. (1993). Modulation of expression and cell surface binding of members of the transforming growth factor-ß superfamily during retinoic acid-induced osteoblastic differentiation of multipotential mesenchymal cells. Mol. Endocrinol. 7,189 -198.[Abstract]
Hanai, J., Chen, L. F., Kanno, T., Ohtani-Fujita, N., Kim, W.
Y., Guo, W. H., Imamura, T., Ishidou, Y., Fukuchi, M., Shi, M. J., Stavnezer,
J., Kawabata, M., Miyazono, K. and Ito, Y. (1999).
Interaction and functional cooperation of PEBP2/CBF with Smads. Synergistic
induction of the immunoglobulin germline Calpha promoter. J. Biol.
Chem. 274,31577
-31582.
Henderson, J. E., Naski, M. C., Aarts, M. M., Wang, D. S., Cheng, L., Goltzman, D. and Ornitz, D. M. (2000). Expression of FGFR3 with the G380R achondroplasia mutation inhibits proliferation and maturation of CFK2 chondrocytic cells. J. Bone Miner. Res. 15,155 -165.[Medline]
Hill, D. J., Logan, A. and De Sousa, D. (1991). Stimulation of DNA and protein synthesis in epiphyseal growth plate chondrocytes by fibroblast growth factors. Interactions with other peptide growth factors. Ann. NY Acad. Sci. 638,449 -452.[Medline]
Hollnagel, A., Ahrens, M. and Gross, G. (1997). Parathyroid hormone enhances early and suppresses late stages of osteogenic and chondrogenic development in a BMP-dependent mesenchymal differentiation system (C3H10T1/2). J. Bone Miner. Res. 12,1993 -2004.[Medline]
Johansson, B. M. and Wiles, M. V. (1995). Evidence for involvement of activin A and bone morphogenetic protein 4 in mammalian mesoderm and hematopoietic development. Mol. Cell. Biol. 15,141 -151.[Abstract]
Ju, W., Hoffmann, A., Verschueren, K., Tylzanowski, P., Kaps, C., Gross, G. and Huylebroeck, D. (2000). The bone morphogenetic protein 2 signaling mediator Smad1 participates predominantly in osteogenic and not in chondrogenic differentiation in mesenchymal progenitors C3H10T1/2. J. Bone Miner. Res. 15,1889 -1899.[Medline]
Kato, Y. and Iwamoto, M. (1990). Fibroblast
growth factor is an inhibitor of chondrocyte terminal differentiation.
J. Biol. Chem. 265,5903
-5909.
Kim, J., Lin, J. J., Xu, R. H. and Kung, H. F.
(1998). Mesoderm induction by heterodimeric AP-1 (c-Jun and
c-Fos) and its involvement in mesoderm formation through the embryonic
fibroblast growth factor Xbra autocatalytic loop during the early development
of Xenopus embryos. J. Biol. Chem.
273,1542
-1550.
Kispert, A. (1995). The Brachyury protein: a T-domain transcription factor. Semin. Dev. Biol. 6,395 -403.
Kispert, A. and Herrmann, B. G. (1994). Immunohistochemical analysis of the Brachyury protein in wild-type and mutant mouse embryos. Dev. Biol. 161,179 -193.[Medline]
Kispert, A., Koschorz, B. and Herrmann, B. G. (1995). The T protein encoded by Brachyury is a tissue-specific transcription factor. EMBO J. 14,4763 -4772.[Medline]
Komori, T. and Kishimoto, T. (1998). Cbfa1 in bone development. Curr. Opin. Genet. Dev. 8, 494-499.[Medline]
Kozawa, O., Matsuno, H. and Uematsu, T. (2001). Involvement of p70 S6 kinase in bone morphogenetic protein signaling: Vascular endothelial growth factor synthesis by bone morphogenetic protein-4 in osteoblasts. J. Cell Biochem. 81,430 -436.[Medline]
Lefebvre, V. and De Crombrugghe, B. (1998). Toward understanding SOX9 function in chondrocyte differentiation. Matrix Biol. 16,529 -540.[Medline]
Lefebvre, V., Li, P. and De Crombrugghe, B. (1998). A new long form of Sox5 (L-Sox5), Sox6 and Sox9 are coexpressed in chondrogenesis and cooperatively activate the type II collagen gene. EMBO J. 17,5718 -5733.[Medline]
Legeai-Mallet, L., Benoist-Lasselin, C., Delezoide, A. L.,
Munnich, A. and Bonaventure, J. (1998). Fibroblast growth
factor receptor 3 mutations promote apoptosis but do not alter chondrocyte
proliferation in thanatophoric dysplasia. J. Biol.
Chem. 273,13007
-13014.
Lerchner, W., Latinkic, B. V., Remacle, J. E., Huylebroeck, D. and Smith, J. C. (2000). Region-specific activation of the Xenopus brachyury promoter involves active repression in ectoderm and endoderm: a study using transgenic frog embryos. Development 127,2729 -2739.[Abstract]
Lou, J., Tu, Y., Li, S. and Manske, P. R. (2000). Involvement of ERK in BMP-2 induced osteoblastic differentiation of mesenchymal progenitor cell line C3H10T1/2. Biochem. Biophys. Res. Commun. 268,757 -762.[Medline]
Mazars, A., Tournigand, C., Mollat, P., Prunier, C., Ferrand, N., Bourgeade, M. F., Gespach, C. and Atfi, A. (2000). Differential roles of JNK and Smad2 signaling pathways in the inhibition of c-Myc-induced cell death by TGF-beta. Oncogene 19,1277 -1287.[Medline]
Metsäranta, M., Toman, D., De Crombrugghe, B. and Vuorio, E. (1991). Specific hybridization probes f