spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Taylor, D. L.
Right arrow Articles by Watts, F. Z.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Taylor, D. L.
Right arrow Articles by Watts, F. Z.
Journal of Cell Science 115, 1113-1122 (2002)
© 2002 The Company of Biologists Limited


Research Article

Cell-cycle-dependent localisation of Ulp1, a Schizosaccharomyces pombe Pmt3 (SUMO)-specific protease

Deborah L. Taylor, Jenny C. Y. Ho, Alejandro Oliver and Felicity Z. Watts*

Genome Damage and Stability Centre, School of Biological Sciences, University of Sussex, Falmer, Brighton, BN1 9QG, UK

* Author for correspondence (e-mail: f.z.watts{at}sussex.ac.uk )

Accepted 6 January 2002


    Summary
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We report here on the characterisation of Ulp1, a component of the SUMO modification process in S. pombe. Recombinant S. pombe Ulp1 has de-sumoylating activity; it is involved in the processing of Pmt3 (S. pombe SUMO) and can, to a limited extent, remove Pmt3 from modified targets in S. pombe cell extracts. ulp1 is not essential for cell viability, but cells lacking the gene display severe cell and nuclear abnormalities. ulp1-null (ulp1.d) cells are sensitive to ultraviolet radiation in a manner similar to rad31.d and hus5.62, which have mutations in one subunit of the activator and the conjugator for the ubiquitin-like protein SUMO respectively. However ulp1.d cells are less sensitive to ionising radiation and hydroxyurea (HU) than are rad31.d and hus5.62. ulp1-null cells are defective in processing precursor Pmt3 and display reduced levels of Pmt3 conjugates compared with wild-type cells. The slow growth phenotype of ulp1 null cells is not substantially rescued by over-expression of the mature form of Pmt3 (Pmt3-GG), suggesting that the de-conjugating activity of Ulp1 is required for normal cell cycle progression. During the S and G2 phases of the cell cycle the Ulp1 protein is localised to the nuclear periphery. However, during mitosis the pattern of staining alters, and during anaphase, Ulp1 is observed within the nucleus. Ulp1 localisation at the nuclear periphery is generally re-established by the time of septation (S phase).

Key words: SUMO, Pmt3, Ulp1, Cell cycle


    Introduction
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In S. pombe, processes required for the maintenance of genetic integrity have been defined through the analysis of radiation-sensitive mutants and the subsequent identification of genes involved in a range of different DNA damage responses, for example, nucleotide excision repair, recombination repair and DNA integrity checkpoints (Carr et al., 1994Go; Caspari and Carr, 1999Go; Murray et al., 1992Go; Tavassoli et al., 1995Go). During our characterisation of these processes we identified the rad31.1 mutant (Shayeghi et al., 1997Go), which we demonstrated to be epistatic with hus5.62 (al-Khodairy et al., 1995Go). These two mutants exhibit a moderate sensitivity to DNA damaging agents such as UV and ionising radiation and to the DNA synthesis inhibitor, hydroxyurea (HU) (al-Khodairy et al., 1995Go; Shayeghi et al., 1997Go). The mutants also display similar defects in cell and nuclear morphology, displaying a frequent `cut' phenotype in the absence of DNA damage and the occurrence of chromosome fragmentation. Cells display a slow growth phenotype and increased mini-chromosome loss compared with wild-type cells. Null alleles of rad31 and hus5 have similar, but somewhat more severe, phenotypes.

The S. pombe rad31 and hus5 genes, which were initially proposed to be involved in SUMO modification as a result of their high level of sequence identity to the S. cerevisiae AOS1 and UBC9 genes (al-Khodairy et al., 1995Go; Johnson et al., 1997Go; Shayeghi et al., 1997Go; Tanaka et al., 1999Go), have recently been shown to be required for SUMO modification by their activity in an in vitro SUMO (Pmt3) modification system (Ho et al., 2001Go). Specifically, the rad31 and hus5 genes encode one subunit of the heterodimeric activator and the conjugator, respectively, for the S. pombe SUMO protein, Pmt3. Pmt3 is a member of a Ubl (ubiquitin-like) family, which has been identified independently in many organisms, and its members are known variously as SUMO, PIC1, sentrin and UBL1 in mammalian cells, as Smt3 in S. cerevisiae and as Pmt3 in S. pombe (Yeh et al., 2000Go).

The Ubls are expressed as precursor molecules that, like ubiquitin, require C-terminal processing to reveal the double glycine (GG) motif needed for conjugation to the target lysine residue (Johnson et al., 1997Go). The conjugation of SUMO and other Ubls such as Rub1/NEDD8 to substrate proteins is similar to that of ubiquitination and requires activation and conjugation of the Ubl by E1 and E2 enzymes (Desterro et al., 1997Go; Johnson and Blobel, 1997Go). Conjugation is initiated by an activation enzyme (E1), which, in an ATP-dependent reaction, forms a thiolester linkage with the Ubl. The Ubl is then transferred to a conjugating enzyme (E2), forming a similar thiolester linkage, before transfer to a target lysine residue of the substrate protein. Unlike the E1 required for ubiquitin activation, which is a monomer, the E1 (or SAE) required for SUMO activation is a heterodimer in which the two subunits are related to the N- and C-terminal domains of the ubiquitin E1 enzymes (Johnson et al., 1997Go). In S. pombe, the Rad31 protein acts in conjunction with Fub2 (Tanaka et al., 1999Go) to form the E1 heterodimer (Tanaka et al., 1999Go; Ho et al., 2001Go).

The mechanism of deconjugation of Ubls from targets is similar to deconjugation of ubiquitin from its targets, which occurs through the action of the Dub (de-ubiquitinating) enzymes. It appears that cells contain multiple SUMO proteases, suggesting that there may be some specificity in their location and/or action. Recently identified cysteine proteases with specificity for SUMO/Smt3 hydrolysis in vitro include mammalian SMT3IP1, SUSP1 and SENP1 (Gong et al., 2000Go; Kim et al., 2000Go; Nishida et al., 2000Go) and S. cerevisiae ScUlp1 and ScUlp2 (Li and Hochstrasser, 1999Go; Li and Hochstrasser, 2000Go).

Several targets of SUMO modification have been identified in mammalian systems including RanGAP1, PML, p53 and IkB{alpha} (e.g. Boddy et al., 1996Go; Desterro et al., 1998Go; Gostissa et al., 1999Go; Mahajan et al., 1997Go; Matunis et al., 1998Go; Rodriguez et al., 1999Go; Sternsdorf et al., 1997Go), and although a definitive role for modification has yet to be recognised, most modified targets are localised in the nucleus or at the nuclear envelope. Exceptions to this are the S. cerevisiae septins Cdc3, Cdc11 and Shs1, which are modified by the S. cerevisiae SUMO homologue Smt3 and are located at the mother/bud neck in a cell-cycle-dependent manner (Johnson and Blobel, 1999Go).

To further our understanding of Pmt3 modification in fission yeast and to facilitate the identification of modified targets, we have initiated a characterisation of the Pmt3- specific proteases in S. pombe. We report here on S. pombe Ulp1 and show that it is a 65 kDa protein that is capable of processing the Pmt3 precursor to produce a protein corresponding in size to that expected of the mature form and is able to function to a limited extent in the removal of Pmt3 from target proteins in cell extracts. The ulp1 null allele is viable and its phenotype is described here. The Ulp1 protein is localised at the nuclear envelope throughout S phase and G2 but is observed within the nucleus during mitosis.


    Materials and Methods
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Strains, plasmids and growth media
The S. pombe strains used are listed in Table 1. E. coli strains used were NM522 and BL21. pRSETB (Clontech) and pET15b (Novagen) were used to produce in-frame 6xHis-tag fusion proteins in Escherichia coli. pREP41 (Basi et al., 1993Go) and pREP41HA (Craven et al., 1998Go), both containing a modified version of the thiamine repressible nmt1 promoter, were used for expression in S. pombe. pREP41HA allows the in-frame cloning of the Pmt3 or Pmt3-GG ORFs using NdeI and BamHI cloning sites to produce a haemagglutinin-tagged protein. Procedures and growth media used for the routine culture and maintenance of E. coli and S. pombe strains were as described previously (Murray et al., 1992Go).


View this table:
[in this window]
[in a new window]
 
Table 1. S. pombe strains used in this study

 

Construction of myc epitope tagged ulp1 strain
A C-terminal myc-epitope-tagged ulp1 strain was generated using the G418 selectable marker module and methodology described in Bahler et al. (Bahler et al., 1998Go). Oligonucleotides Ulp1-MH 5' TGTTC- CTGTTCAGTTTAGTCAAAATGATATGCCTGAACTACGAATCA- AAATGGCAGCTAGTATTATTGATGCACAAATCTATCGGATCC- CCGGGTTAATTAA 3' and ulp1-rev 5' ATGCGGGTATTTTTT- TTTTCAAAAGCTATATTTGCTGAGATTCCTGGATTCAGATTTA- TTAATTAGAGTATTCCCTGCTAGAATTCGAGCTCGTTTAAA 3' were generated with 80 bases of homology to the target sequence followed by 20 bases of 3' homology to the plasmid sequence. Integration was confirmed by PCR using the primers KanMXR 5' CGGATGTGATGTGAGAACTGTATCCTAGC 3' and Ulp1-6 5' TATACTTGTAAGCTTCTCACG 3'. The tagged strain did not display any obvious growth or morphological abnormalities and thus resembles wild-type strains.

Cloning and expression of full-length and C-terminally truncated pmt3
The S. pombe pmt3 sequence was amplified by PCR using the following primers SEN4: 5' CTGAGAACATATGTCTGAATC 3' and SUMO2: 5' TTGAGAGGATCCACGTATTGG 3' to produce a full-length clone. The C-terminally truncated Pmt3 ORF (Pmt3-GG) was amplified using primers SEN4 and pGG: 5' GGATCCTAACCACCTAACTGTTCT 3'. Both ORFs were subsequently cloned as NdeI-BamHI fragments in the E. coli expression vector pET15b (Novagen). Full-length and truncated versions of Pmt3 (Pmt3-GG) were expressed with N-terminal 6xHis tags and affinity purified using Ni2+ agarose according to the manufacturers instructions (Novagen).

Cloning and expression of Ulp1
The oligonucleotide primers Ulp1X 5' CTCGAGAATGATAGGAAAACGCAATGC 3' and Ulp1S 5' CCCGGGTTGCTGTTGTGCGCATCAGC 3' were used for PCR to amplify the S. pombe ulp1 coding sequence. A 1.9 kb fragment was generated and cloned into pGEM5Zf+ for sequencing. The ORF was then subcloned as an XhoI-SmaI fragment into pRSETB. 6xHis-tagged Ulp1 protein was expressed from the T7 promoter of pRSETB in E. coli BL21 cells. Cell lysis was performed by sonication, and Ulp1 was purified on Talon metal affinity resin according to the manufacturer's instructions (Clontech.) Protein-containing fractions were pooled and dialysed overnight into 50 mM sodium phosphate pH 7.5, 150 mM NaCl, 1 mM DTT before being snap frozen and stored at —80°C.

Creation of the ulp1 null allele
The ulp1 null allele was created by replacing a 1.1 kb BamHI-SalI fragment within the ulp1 coding sequence with the S. pombe ura4 gene. A 2.5 kb XhoI-SmaI fragment was excised and used to transform a diploid strain. Replacement of the wild-type allele was confirmed by Southern blot analysis.

Ulp1 protease assays
S. pombe native cell extracts were prepared in cleavage buffer (10 mM sodium phosphate pH 7.0, 150 mM NaCl, 1 mM DTT (Sigma)) from cells grown to a density of 106 cells/ml in rich medium. Precursor and truncated Pmt3 (Pmt3-GG, used as a control) were synthesised either in a coupled in vitro transcription and translation system using the TnT system according to the manufacturer's instructions (Promega) with [35S]methionine or purified as 6xHis tag fusion proteins from E. coli BL21 transformed with either pET15b-Pmt3 or pET15b-Pmt3-GG using Ni2+ agarose. Processing and deconjugation assays were carried out in cleavage buffer in a total volume of 20 µl at 30°C for 30 minutes unless otherwise stated. Samples were analysed by SDSPAGE. 35S-labelled proteins were detected using a phosphorimager. Recombinant Pmt3 produced in E. coli and Pmt3 species in S. pombe cell extracts were detected by immunoblotting using polyclonal anti-Pmt3 antisera.

Generation of antibodies and immunological methods
A fragment encoding an N-terminally truncated version of Pmt3 (N{triangleup}Pmt3) was amplified from a cDNA library (Fikes et al., 1990Go) using primers pmt3-1 5' CTGAGAACATATGTCTGAATCACC 3' and pmt3-4 5' TGGAGAGGATCCACGTATTGG 3' and cloned into the E. coli expression vector pET15b (Novagen) and expressed as a 6xHis fusion in E. coli BL21 cells. Pmt3 protein was purified using Ni2+ agarose affinity chromatography and used for polyclonal antisera production in rabbits (as described in (Ho et al., 2001Go). Anti-myc antibodies were purified from cell supernatant (cell line CRL1729, from ATCC) using protein G-sepharose. Anti-HA antisera were from Babco, anti-tubulin antisera were from Sigma and anti-His antisera were from Pharmacia.

Western blotting was carried out as described (Harlow and Lane, 1988Go) on whole cell yeast lysates prepared by lysis in 150 mM NaCl, 10 mM NaPO4 pH 7.0, 1 mM DTT or on TCA extracts of whole cells prepared as described in Caspari et al. (Caspari et al., 2000Go). Immunofluorescence was carried out as described in Moreno et al. (Moreno et al., 1991Go) using formaldehyde fixation.

Analysis of DNA damage responses
UV irradiation was carried out on freshly plated cells using a Stratagene `Stratalinker'. Gamma irradiation was carried out using a [137Cs] gamma source with a dose rate of 12 Gy/min. Sensitivity to hydroxyurea (HU) was tested in liquid cultures at HU concentrations of 20 mM.


    Results
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cloning the Ulp1 ORF from genomic DNA and expression of the recombinant protein
The predicted S. pombe ulp1 gene (accession number AL021839, protein ID CAA17063.1) encodes a protein of 64.9 kDa with significant homology to other recently identified Ubl proteases (Li and Hochstrasser, 1999Go). The full-length Ulp1 open reading frame was amplified by PCR from S. pombe genomic DNA using primers Ulp1X and Ulp1S as described in the Materials and Methods. The generated fragment was subcloned into the E. coli expression vector pRSETB and expressed as an N-terminal 6xHis-tagged fusion protein in E. coli BL21 cells. Recombinant Ulp1, purified by immobilisation on Talon affinity resin, was observed to migrate close to the predicted size of 64.9 kDa (Fig. 1A, lane 2).



View larger version (25K):
[in this window]
[in a new window]
 
Fig. 1. Ulp1 processes the Pmt3 precursor. (A) Recombinant 6xHis-tagged Ulp1 expressed in E. coli. Extracts were made from cells transformed with empty pRSETB (lane 1) or pRSETB-Ulp1 (lane 2), separated by SDS PAGE (10% polyacrylamide) and western blotted using anti-His antisera. (B) Recombinant Ulp1 was tested for Pmt3-processing activity as described in Materials and Methods. Lanes 1-10, 35S-labelled Pmt3 or Pmt3-GG produced in the TnT system. Lane 1, full-length Pmt3 with no additions; lane 2, Pmt3-GG with no additions. Lanes 3-9 full-length Pmt3 incubated with 0.72 µg of recombinant Ulp1. Lane 3, no inhibitors; lane 4, 1:1000 mammalian protease inhibitor cocktail; lane 5, 1:1000 yeast protease inhibitor cocktail; lane 6, 5 mM benzamidine; lane 7, 10 mM iodoacetamide; lane 8, 10 mM NEM; lane 9, 1 mM PMSF; lane 10, 2 µl elution fraction from E. coli BL21 + pRSETB. Lanes 11-13, full-length Pmt3 (600 ng) or Pmt3-GG (600 ng) purified from E. coli BL21 + pET15b-Pmt3 or E. coli BL21 + pET15b-Pmt3-GG respectively. Lane 11, full-length Pmt3, no additions; lane 12, Pmt3-GG no additions; lane 13 full-length Pmt3 incubated with 0.72 µg Ulp1. All samples were incubated at 30°C for 30 minutes.

 

Ulp1 processes the C terminus of Pmt3 precursor
Like ubiquitin and other Ubls, SUMO is produced as a precursor molecule, which requires C-terminal processing involving the removal of a few amino acids at the C terminus to reveal the double glycine (GG) motif required for conjugation to an internal lysine residue of the substrate. In the case of Pmt3, the equivalent processing reaction would be expected to remove six amino acids (CTHLCL) to produce the mature form. To determine whether Ulp1 functions in the processing of Pmt3 in S. pombe, we analysed the ability of Ulp1 to process the Pmt3 precursor protein to its mature form. We expressed the full-length [35S]methionine-labelled precursor form of Pmt3 in vitro and incubated it with recombinant Ulp1 produced in E. coli or with an equal volume of an equivalent fraction of an extract of E. coli BL21 cells transformed with empty vector. Products were analysed by SDS PAGE and compared with a truncated version of Pmt3 (Pmt3-GG) synthesised in vitro, which lacks the last six amino acids. The results of the cleavage assay verify that Ulp1 is proficient in the hydrolysis of Pmt3 in vitro (Fig. 1B, lanes 1-3). The processed product produced by Ulp1 (lane 3) migrates with a mobility identical to that of the synthetic, truncated Pmt3-GG (lane 2). No processing is observed in the negative control (lane 10). To ensure that the processing observed in lane 3 was not due to an activity in the reticulocyte lysate used to prepare the Pmt3 substrate, we assayed Ulp1 on full-length Pmt3 purified from E. coli (lane 13). Comparison with the full-length Pmt3 and Pmt3-GG controls (lanes 11 and 12 respectively) indicates that Pmt3 purified from E. coli is also processed. The processed product is identical in size to that observed following processing of Pmt3 produced in reticulocyte lysate (lane 3). These data implicate Ulp1 as a Pmt3 protease in fission yeast.

Sequence analysis indicates that S. pombe Ulp1 is a member of a family of cysteine proteases. Other members of this family, for example, S. cerevisiae Ulp1 (Li and Hochstrasser, 1999Go; Li and Hochstrasser, 2000Go), have been shown to be inhibited by N-ethyl maleimide (NEM) and iodoacetamide. We wished to determine whether the Pmt3-processing activity of Ulp1 was also affected by these inhibitors or by any other protease inhibitors used in the preparation of S. pombe cell extracts. Of the inhibitors we tested, only iodoacetamide (10 mM) and NEM (10 mM) inhibited Ulp1 activity (Fig. 1B, lanes 7 and 8 respectively). The mammalian and yeast protease inhibitor cocktails, benzamidine and PMSF, had no effect on processing (Fig. 1B, lanes 4-6 and 9). Similar results were obtained using Pmt3 purified following over-expression in E. coli (data not shown).

Ulp1 can release Pmt3 from conjugates in S. pombe extracts
We next asked if Ulp1 is also involved in deconjugation of Pmt3 from modified substrates. In freshly prepared S. pombe cell extracts of cells grown in rich medium to around 106 cells/ml (early-mid exponential phase), the majority of Pmt3 cross-reacting material is of Mr greater than 100 kDa, and unconjugated Pmt3 monomer is not detected (Fig. 2A, lane 1). We therefore used such extracts to assay Ulp1 protein for its ability to cleave Pmt3 conjugates as this would allow us to observe the release of Pmt3 from high molecular weight species. Incubation of cell extracts with Ulp1 results in the appearance of free, unconjugated Pmt3 (Fig. 2A, lanes 3-6), and this is dependent on the presence of added Ulp1 as incubation of the extracts in the absence of Ulp1 does not release the Pmt3 monomer (Fig. 2A, lane 2). Deconjugation of Pmt3 from high Mr species was not observed following incubation of extracts with 2 µl of the Talon column fraction equivalent to that containing the Ulp1 protein but prepared from E. coli cells transformed with empty vector (data not shown). These data indicate that Ulp1 is capable of releasing Pmt3 from high Mr conjugates. Interestingly, some high molecular weight species that cross-react with anti-Pmt3 antisera remain even when the period of incubation is increased to 40 minutes (Fig. 2A lanes 4-6). The nature of these high Mr species is unknown, but may represent Pmt3-modified targets that are not affected by Ulp1 protease activity. If this is the case, Ulp1 may not be the only protease involved in the Pmt3 decongugation pathway in fission yeast.



View larger version (30K):
[in this window]
[in a new window]
 
Fig. 2. Ulp1 can remove Pmt3 from conjugates in S. pombe cell extracts. Recombinant Ulp1 was tested for deconjugating activity using wild-type (sp.011) S. pombe cell extract corresponding to 0.3 OD600 units of cells per assay. Assays were analysed by SDS PAGE (12.5% polyacrylamide in (A) and 10% polyacrylamide in (B)) and western blotted with anti-Pmt3 antisera. (A) Lanes 1 and 2, no additions; lanes 3-6, 3.7 µg Ulp1. Lane 1, 0 minutes; lanes 2,6, 40 minutes at 30°C; lane 3, 5 minutes at 30°C; lane 4, 10 minutes at 30°C, lane 5, 20 minutes at 30°C. (B) Lanes 1,2, no additions; lanes 3-6, 3.7 µg Ulp1; lane 4, 10 mM iodoacetamide; lane 5, 10 mM NEM; lane 6, 0.5 mM PMSF. Lanes 7-9, 3.7 µg Ulp1 preincubated for 10 minutes on ice in the presence of 100 mM iodoacetamide (lane 7), 100 mM NEM (lane 8) or 5 mM PMSF (lane 9) before addition of cell extract. Lanes 2-9, incubated at 30°C for 30 minutes.

 

The two cysteine protease inhibitors, iodoacetamide and NEM, which inhibit the Pmt3-processing activity of Ulp1, and the serine protease inhibitor PMSF, have no effect on Pmt3 deconjugating activity (Fig. 2B, lanes 4-6) even using concentrations of NEM as high as 100 mM or a combination of 10 mM or 20 mM each of NEM and iodoacetamide (data not shown). To ensure that the lack of inhibition was not due to quenching of the inhibitors in the yeast cell extract, Ulp1 protein was pre-incubated in the presence of 100 mM iodoacetamide, 100 mM NEM or 5 mM PMSF before being added to the cell extract. Pre-incubation of Ulp1 had no effect on the deconjugating activity of Ulp1 (Fig. 2B, lanes 7-9).

Ulp1-null cells display aberrant cell and nuclear morphologies
We next disrupted the genomic copy of ulp1 to determine whether the ulp1 gene is essential for cell viability (Fig. 3A). Tetrad analysis of the heterozygous ulp1+/ulp1-diploid initially suggested that ulp1 was essential as no ura+ colonies were obtained from 20 dissected tetrads. In parallel we also undertook random spore analysis in case germination of ulp1- spores was a rare event. Ten days after plating spores from the ulp1+/ulp1- heterozygote, very small colonies were obtained on YES medium that were subsequently shown to be ura+, whereas the more abundant, larger colonies, which appeared three days after plating on YES, were all found to be ura- when tested on selective medium. Microscopic analysis of the ura+ colonies indicates a range of cell and nuclear abnormalities (Fig. 3B). ulp1.d (ulp1-null) cells are generally elongated compared with wild-type cells, and, in some cases the nucleus is displaced from the expected position within the cell. Many ulp1-null cells have irregular shapes, whereas others are multiply septated. The doubling time of ulp1.d cells is around 5 hours compared with 2.5 hours for wild-type cells. The ulp1.d phenotype is thus similar to the phenotypes of rad31.d and hus5.62, which are defective in one subunit of the Pmt3 activator and the Pmt3 conjugator, respectively (al-Khodairy et al., 1995Go; Shayeghi et al., 1997Go).



View larger version (24K):
[in this window]
[in a new window]
 
Fig. 3. Disruption of the ulp1 gene. (A) ulp1 disruption strategy. A 1.1 kb BamHI-SalI fragment within the ulp1 coding sequence was replaced with the ura4 gene. (B) Microscopic analysis of ulp1-null cells. Wild-type, sp.011, (a) and ulp1.d, sp.651, (b) cells were fixed in 70% ethanol, stained with DAPI and analysed using a Zeiss Axioskop 2 microscope. (C-E) Response of ulp1-null cells to UV and ionising radiation and the DNA synthesis inhibitor HU. Wildtype (sp.011) and ulp1.d (sp.651) were exposed to a range of doses of UV (C), ionising radiation (D) or 20 mM HU and samples taken over 10 hours (E). (F) Epistasis analysis. Wild-type (sp.011), ulpl.d (sp.651), rad17.d (sp.310) and ulp1.d,rad17.d (sp.666) cells were subject to UV radiation.

 

The rad31 and hus5 genes are required for the DNA damage response, as the rad31.d and hus5.62 strains are sensitive to UV and ionising radiation and the DNA synthesis inhibitor HU (al-Khodairy et al., 1995Go; Shayeghi et al., 1997Go). Fig. 3C-E show that ulp1-null cells are also sensitive to DNA damage and HU. The level of sensitivity to UV radiation is similar to that of rad31.d and hus5.62 cells, but ulp1.d cells are less sensitive than rad31.d and hus5.62 to ionising radiation and HU (for example, rad31.d has an approximately 0.1% survival rate at 1000 Gy compared with 3% for ulp1.d and a 10% survival rate in response to 8 hours incubation in the presence of HU as compared to 40% for ulp1.d) (al-Khodairy et al., 1995Go; Shayeghi et al., 1997Go). The ulp1-null cells similar to rad31-null cells showed hypersensitivity to 10 mM caffeine (data not shown), and the slow growth of ulp1.d cells is partially rescued by growth on plates containing 1 M sorbitol (data not shown).

The rad31.d and hus5.62 mutants are defective in a pathway that also involves the DNA integrity checkpoint genes (al-Khodairy et al., 1995Go; Shayeghi et al., 1997Go), and more specifically, hus5.62 is defective in the recovery from checkpoint arrest. To determine whether ulp1 also functions in a checkpoint-dependent process, a range of double mutants was made and analysed for sensitivity to UV radiation. As shown in Fig. 3F, the ulp1.d,rad17.d double mutant displays no increase in sensitivity over the rad17.d single mutant, indicating that ulp1 and rad17 function in a common pathway. Similar results were obtained with other checkpoint rad mutants (data not shown).

ulp1-null cells have reduced levels of Pmt3 conjugates that are restored by over-expression of mature Pmt3
As we have shown that Ulp1 can remove Pmt3 from high molecular weight conjugates in cell extracts (Fig. 2A), we wished to determine whether the ulp1-null allele showed any difference in the pattern of Pmt3 conjugates when compared with wild-type cells and if so, whether expression of mature Pmt3 had any effect on the pattern of conjugates. Wild-type and ulp1-null cells were transformed with pREP41HA-Pmt3, pREP41HA-Pmt3GG and the empty vector pREP41HA. Transformed cells were grown in selective medium to mid-late exponential phase, conditions where some unconjugated Pmt3 is observed in cells (unlike the situation in cells grown to early exponential phase in rich medium when free Pmt3 is not detected, (Fig. 2A, lane 1)). Western analysis using anti-Pmt3 antisera on extracts from cells transformed with empty vector (Fig. 4A) shows that the ulp1-null strain has a reduced level of Pmt3 conjugates (lane 4) compared with the level of conjugates observed in wild-type cells (lane 1). (Similar results are obtained with untransformed cells, data not shown.) These data suggest that the loss of Pmt3 processing activity in ulp1 null cells is limiting the extent of Pmt3 conjugation to substrate proteins.



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 4. Effect of over-expressing Pmt3 and Pmt3-GG in wild-type and ulp1.d cells. (A,B) Total cell extracts from wild-type (sp.011) (lanes 1-3) and ulp1.d (sp.651) cells (lanes 4-6) transformed with pREP41HA (lanes 1,4), pREP41HA-Pmt3 (lanes 2,5) or pREP41HA-Pmt3-GG (lanes 3,6) and grown for 18 hours in selective medium lacking thiamine were analysed by western blotting with anti-Pmt3 antisera (A) or anti-HA antisera (B). Equal amounts of protein were loaded in each lane as determined by staining with Coomassie Brilliant Blue (data not shown). (a) Pmt3-GG, (b) full-length Pmt3, (c) HA-Pmt3-GG, (d) HA-Pmt3.

(C,D) Wild-type (sp.011) and ulp1.d (sp.651) cells transformed with pREP41HA, pREP41HA-Pmt3 or pREP41HA-Pmt3-GG were grown for 12 hours to midlog phase in selective medium lacking thiamine. Cells were then diluted (t=0) to 106 cells/ml in fresh thiamine-free medium and counted every 2 hours.

(E) Transformed cells were grown for 18 hours to 4x106 cells/ml in selective media lacking thiamine and then subjected to UV radiation as indicated.

 

We next investigated whether it was possible to bypass the loss of Pmt3-processing activity in the ulp1-null cells by over-expressing mature Pmt3 (Pmt3-GG). Wild-type cells expressing either HA-Pmt3 or HA-Pmt3-GG show no major changes in the pattern of Pmt3 conjugates detected using anti-Pmt3 antisera when compared with extracts from cells transformed with the empty vector (Fig. 4A, lanes 1-3). Probing with anti-HA antisera indicates that HA-tagged species are equally abundant in wild-type cells transformed with either HA-Pmt3 or HA-Pmt3-GG, implying that both the precursor and mature forms of Pmt3 can be used for incorporation into high molecular weight conjugates (Fig. 4B, lanes 2 and 3). In contrast ulp1-null cells are less able than wild-type cells to incorporate HA-Pmt3 species when provided with HA-tagged precursor Pmt3 (Fig. 4A and B, lane 5). However ulp1-null cells use HA-Pmt3-GG efficiently, with the result that HA-tagged species are as abundant in ulp1.d + HA-Pmt3-GG (Fig. 4B, lane 6) as they are in the equivalent wild-type transformant (lane 3).

Fig. 4 confirms that ulp1-null cells are defective in the processing of precursor Pmt3 to the mature form. In this experiment, wild-type cells (Fig. 4A, lanes 1-3) accumulate an anti-Pmt3 cross-reacting species of approximately 22 kDa, representing Pmt3-GG (the mature form of Pmt3). Wild-type cells transformed with either HA-Pmt3 or HA-Pmt3-GG also accumulate another species of around 26 kDa, representing HA-Pmt3-GG (Fig. 4A and B, lanes 2 and 3). In contrast, the smallest anti-Pmt3 cross-reacting species observed in ulp1-null cells (lanes 4-6) is around 23 kDa, that is, about 1 kDa larger than the smallest species observed in wild-type cells (lanes 1-3) and consistent with the size expected for full-length Pmt3. Additionally, ulp1-null cells transformed with HA-Pmt3 (Fig. 4A and B, lane5) accumulate an anti-HA cross-reacting species slightly larger than the 26 kDa species observed in HA-Pmt3 transformed wild-type cells (Fig. 4A and B, lane 2), consistent with it being the HA-tagged form of full-length Pmt3. Fig. 4B, lane 6 indicates that very little HA-tagged Pmt3-GG monomer is present in ulp1.d cells transformed with HA-Pmt3GG, this is likely to be due to the fact that much of it is conjugated to targets in ulp1-null cells.

We were interested in determining whether expression of Pmt3-GG could rescue the slow growth phenotype or the UV radiation sensitivity of ulp1.d cells. Cells transformed with the appropriate plasmids were grown for 12 hours in selective liquid medium in the absence of thiamine to mid-log phase and then diluted to 106 cells/ml in fresh thiamine-free medium (time=0). The cell number was monitored every 2 hours for up to 12 hours. Over-expression of full-length or mature Pmt3 in wild-type cells has a deleterious effect on cell growth rate after 18-20 hours under de-repressing conditions (Fig. 4C). In contrast, over-expression of full-length or mature Pmt3 in ulp1.d cells is not deleterious and may provide a very slight increase in the rate of growth 18-20 hours after release into thiamine-free medium (Fig. 4D). However, any increase in the rate of cell division is short lived, and after 20-22 hours the rate resembles that of cells transformed with empty vector. Over-expression of full-length or mature Pmt3 has no effect on UV radiation survival rates for either wild-type (sp.01) or ulp1.d cells (Fig. 4E).

The level of Ulp1 protein is affected by increased temperatures but not by exposure to HU or ionising radiation
To investigate Ulp1 protein expression in cells, we used a strain (sp.611) containing a myc-epitope-tagged genomic copy of ulp1. Fig. 5A (lane 1) shows that the myc-tagged Ulp1 protein migrates as a doublet of Mr between 90-100 kDa. The increased size observed here compared with the size of Ulp1 purified from E. coli (Fig. 1A) is accounted for by the presence of 13 myc tags (approximately 17.2 kDa). The nature of the doublet is unknown but may reflect proteolysis of Ulp1, an internal translation initiation site, post-translational processing or alternative splicing.



View larger version (21K):
[in this window]
[in a new window]
 
Fig. 5. Ulp1 protein levels vary in response to increased temperature. Strain sp.611 (ulp1-13myc) was grown overnight to mid-log phase at 30°C (A) or at 25°C (B). TCA extracts were analysed by SDS PAGE and western blotting using anti-myc antisera (upper panels) or anti-tubulin antisera (lower panels). (A) Effect of ionising radiation and HU. Lane 1, no treatment; lane 2, 20 mM HU for 3 hours; lane 3 cells exposed to 500 Gy ionising radiation and incubated for a further 1.5 hours at 30°C. (B) Effect of temperature. Lane 1, no treatment; lane 2, 3 hours at 30°C; lane 3, 3 hours at 35.5°C.

 

The level of the Ulp1 protein does not change in cells exposed to 20 mM HU for 3 hours (Fig. 5A, lane 2) or in cells 1.5 hours after exposure to 500 Gy ionising radiation (lane 3). In contrast, the level of Ulp1 and the proportion of the upper and lower bands change in response to different temperatures. In cells grown at 25°C and then shifted to 30°C Fig. 5B (lane 2), the level of Ulp1 protein is similar to the level observed in cells maintained at 25°C (lane 1). However, when cells are incubated at 35.5°C for 3 hours (lane 3) the amount of the upper species decreases with a concomitant increase in the lower species and an overall reduction in the total amount of the protein.

Localisation of Ulp1 changes through the cell cycle
The two S. cerevisiae Smt3 proteases are differentially localised within the cell (Li and Hochstrasser, 2000Go; Schwienhorst et al., 2000Go). To identify the intracellular localisation of the S. pombe Ulp1 protein, immunofluorescence analysis with anti-myc antisera was undertaken using strain sp.611, which contains a myc-epitope-tagged genomic copy of ulp1. Many cells in an exponentially growing culture display strong staining at the nuclear periphery (Fig. 6A) in a pattern similar to that observed with S. cerevisiae Ulp1. However, we noticed that in a significant proportion of cells this peripheral nuclear staining was not evident. We therefore investigated whether the localisation of Ulp1 was cell cycle dependent. The majority of cells (approximately 80%) in an exponentially growing culture of wild-type S. pombe are in G2. In these cells, Ulp1 localises predominantly to the nuclear periphery (Fig. 6Ba,b). As cells enter mitosis (c,d), the staining remains strong, but becomes more diffuse in the region of the nucleus. During anaphase (e-h) the intensity of the Ulp1 staining decreases as Ulp1 staining appears within the nucleus. The staining within the nucleus persists as the spindle elongates (i-1) and is weak during G1 (m-o). The Ulp1 staining at the nuclear periphery reappears at around the time of septation (p,q), which is equivalent to S phase in S. pombe. Throughout most stages of the cell cycle, weak punctate staining of Ulp1 is also observed in the cytoplasm, for example, Fig. 6A.



View larger version (66K):
[in this window]
[in a new window]
 
Fig. 6. Ulp1 protein is located at the nuclear periphery in a cell-cycle-dependent manner. S. pombe strain sp.611 containing an integrated myc epitope-tagged version of ulp1 was used for DAPI staining and immunofluorescence with anti-myc antisera (TRITC) (A,B) and anti-tubulin antisera (FITC) (B). (A) Field of cells from an asynchronously growing culture. Cells, from the top to the bottom of the field, are in late M/G1, S, early anaphase and G2. (B) Composite of cells taken from an asynchronous culture, arranged in sequence according to cell cycle stage as determined by anti-tubulin staining. Merge is an overlay of DAPI and anti-myc antisera images. A number of examples of each stage are shown to give the range of intensity of Ulp1 staining.

 


    Discussion
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In order to further our studies of proteins required for SUMO modification in S. pombe, we have begun a characterisation of S. pombe Ulp1. Recombinant Ulp1 protein purified from E. coli is capable of processing precursor Pmt3 to the size expected of mature Pmt3 and can, to a limited extent, remove Pmt3 from high molecular weight conjugates in S. pombe cell extracts. ulp1-null cells accumulate unprocessed Pmt3 and have a reduced level of Pmt3 conjugates. These data suggest that deconjugation of Pmt3 from conjugates by Ulp1 may be a minor role compared to its processing activity. The main Pmt3 deconjugating activity may, as is the case in S. cerevisiae, be due to the action of a second Pmt3 protease. A second potential Pmt3-specific protease, identified in S. pombe through its homology with the S. cerevisiae Ulp2 enzyme (Li and Hochstrasser, 1999Go), is a candidate for the main deconjugating activity.

In S. pombe, the Ulp1 protein migrates as a doublet. The doublet is observed in TCA extracts of cells and in native cell extracts in the presence of protease inhibitors, suggesting that it is not due to proteolysis. It is also unlikely to be due to phosphorylation, as incubation with {lambda} protein phosphatase has no effect on the doublet (data not shown). We are currently investigating whether the ulp1 mRNA is differentially spliced and, if so, whether the different protein products have different activities.

Deletion analysis indicates that ulp1 is not essential for viability, in contrast to the situation in S. cerevisiae (Li and Hochstrasser, 1999Go). The reason for this difference between the two yeasts is not known, but SMT3, the S. cerevisiae SUMO gene, is essential for cell viability whereas S. pombe pmt3 is not (Tanaka et al., 1999Go). The low frequency of recovery of ulp1-null cells (approximately 1-2% of the number of wild type cells obtained) might be due to poor spore germination in ulp1-null cells. S. pombe ulp1-null cells isolated here display severe cell and nuclear abnormalities. This is reminiscent of the defects observed in rad31.d and hus5.62 cells, which have mutations in other components of the sumoylation pathway. Crosses of ulp1.d with rad31.d produced very few asci, with the result that we have so far been unable to obtain a ulp1.d,rad31.d double mutant to confirm genetically that the two genes function in the same process(es). The range of phenotypes such as the sensitivity to UV radiation and caffeine (a molecule likely to have a number of effects on the cell including the ability to over-ride the S-M checkpoint (Moser et al., 2000Go)) and the rescue by the osmotic stabiliser, sorbitol, displayed by ulp1.d, rad31.d and hus5.62 implies that Pmt3 modification is likely to have a number of functions within cells.

Over-expression of full-length or mature Pmt3 was unable to rescue the slow growth phenotype of ulp1.d cells. The reason for this is unknown, but since over-expression of Pmt3 or Pmt3-GG in wild-type cells is deleterious, the amount of Pmt3/Pmt3-GG in cells appears to be critical. The inability of increased levels of Pmt3-GG to rescue substantially the slow growth or UV-sensitive phenotypes of ulp1.d cells could be due to the requirement for the deconjugating activity of Ulp1, which is presumed to be still defective in these transformed cells. This would imply that there is/are Pmt3-modified target(s) with key roles in cell cycle progression and/or the DNA damage response that require Ulp1 for deconjugation.

In S. pombe, GFP-Pmt3 has been shown to be localised predominantly within the nucleus and, more specifically, to associate with the SPB during interphase (Tanaka et al., 1999Go). During prometaphase and metaphase, the Pmt3 staining at the SPB disappears and cells in anaphase display weak Pmt3 staining between the SPBs. After anaphase Pmt3 reappears at the SPBs. During S and G2, we detect myc-tagged Ulp1 at the nuclear periphery consistent with data from S. cerevisiae (Schwienhorst et al., 2000Go) where Ulp1 colocalises with the nuclear pore complex. Unlike the case in S. cerevisiae, we observe the pattern of Ulp1 staining to change as cells enter mitosis. The changes that we observe at the early stages of mitosis coincide with the changes observed in Pmt3 localisation (Tanaka et al., 1999Go). The pattern of Ulp1 staining in Fig. 6B(d) suggests that Ulp1 might be transiently located at the ends of the spindle. As is observed with GFP-Pmt3 (Tanaka et al., 1999Go), myc-tagged Ulp1 appears to be localised in the DAPI-negative parts of the nucleus during anaphase. (Fig. 6Be-l).

Data from work in Drosophila and mammalian cells have implicated SUMO modification as having a role in the nuclear import of proteins (e.g. Mahajan et al., 1998Go; Saitoh et al., 1998Go). Thus the function of Ulp1 at the nuclear periphery during S and G2 may be to provide mature Pmt3, either as a result of processing or deconjugating Pmt3 from target proteins and recycling it for subsequent conjugation to target proteins destined for nuclear import. The relocation of Ulp1 during mitosis may be responsible for the alteration of the Pmt3 modification state of proteins required specifically for mitosis, the identity of which remain to be determined. A critical role for Ulp1 at G2/M has been shown in S. cerevisiae, where a temperature-sensitive mutant of ulp1 arrests at G2/M at the restrictive temperature (Li and Hochstrasser, 1999Go).

An important group of proteins that undergo cell-cycle-dependent sumoylation are the S. cerevisiae septins (Johnson and Blobel, 1999Go). The septins, which are located at the mother/bud neck (where they are required for cytokinesis) are maximally sumoylated during mitosis. At this time of the cell cycle, SUMO (Smt3) is clearly visible in rings at the mother/bud neck. These proteins might thus be candidate proteins affected by the activity of Ulp1. However, a similar staining pattern for Pmt3 during cytokinesis in S. pombe has not been reported (e.g. Tanaka et al., 1999Go), suggesting that the septins may not be major SUMO-modified targets in S. pombe.

Another possible target is the centromere protein CENP-C, as temperature-sensitive mutations in CENP-C have been shown to be suppressed by over-expression of SUMO (Fukagawa et al., 2001Go; Meluh and Koshland, 1995Go). The S. cerevisiae CENP-C homologue MIF2 has been shown to be required for maintaining the integrity of the mitotic spindle during anaphase (Brown et al., 1993Go), and recently, a temperature-sensitive CENP-C mutant in vertebrate cells has been shown to display metaphase delay and chromosome missegregation (Fukagawa et al., 2001Go).

One of our aims is to identify S. pombe proteins modified by Pmt3. As SUMO conjugates are unstable and/or present at low levels in cells (e.g. Gostissa et al., 1999Go) we wished to determine whether it was possible to stabilise them by inhibiting the deconjugating activity of Pmt3-specific proteases, such as Ulp1. However, despite using high concentrations of known cysteine protease inhibitors we were unable to inhibit deconjugation of Pmt3 from high molecular weight species using either NEM or iodoacetamide. Another possible method for stabilising Pmt3-modified species in order to facilitate their identification might be to deplete the deconjugating enzymes. We are currently analysing Pmt3-modified species present in ulp1.d cells where the processing defect is rescued by the over-expression of HA-Pmt3-GG.


    Acknowledgments
 
D.L.T. was funded by a BBSRC Special Research Studentship (G/03524), A.O. was funded by a Wellcome Trust Scholarship and CONACYT, Mexico, and F.Z.W. thanks the Wellcome Trust for a Travel Grant. Part of this work was funded by a BBSRC project grant (85/G13290)


    References
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

al-Khodairy, F., Enoch, T., Hagan, I. M. and Carr, A. M. (1995). The Schizosaccharomyces pombe hus5 gene encodes a ubiquitin conjugating enzyme required for normal mitosis. J. Cell Sci. 108,475 -486.[Abstract]

Bahler, J., Wu, J. Q., Longtine, M. S., Shah, N. G., McKenzie, A., 3rd, Steever, A. B., Wach, A., Philippsen, P. and Pringle, J. R. (1998). Heterologous modules for efficient and versatile PCR-based gene targeting in Schizosaccharomyces pombe.Yeast 14,943 -951.[Medline]

Basi, G., Schmid, E. and Maundrell, K. (1993). TATA box mutations in the Schizosaccharomyces pombe nmt1 promoter affect transcription efficiency but not the transcription start point or thiamine repressibility. Gene 123,131 -136.[Medline]

Boddy, M. N., Howe, K., Etkin, L. D., Solomon, E. and Freemont, P. S. (1996). PIC 1, a novel ubiquitin-like protein which interacts with the PML component of a multiprotein complex that is disrupted in acute promyelocytic leukaemia. Oncogene 13,971 -982.[Medline]

Brown, M. T., Goetsch, L. and Hartwell, L. H. (1993). MIF2 is required for mitotic spindle integrity during anaphase spindle elongation in Saccharomyces cerevisiae. J. Cell Biol. 123,387 -403.[Abstract/Free Full Text]

Carr, A. M., Schmidt, H., Kirchhoff, S., Muriel, W. J., Sheldrick, K. S., Griffiths, D. J., Basmacioglu, C. N., Subramani, S., Clegg, M., Nasim, A. et al. (1994). The rad16 gene of Schizosaccharomyces pombe: a homolog of the RAD1 gene of Saccharomyces cerevisiae. Mol. Cell Biol. 14,2029 -2040.[Abstract/Free Full Text]

Caspari, T. and Carr, A. M. (1999). DNA structure checkpoint pathways in Schizosaccharomyces pombe.Biochimie 81,173 -181.[Medline]

Caspari, T., Dahlen, M., Kanter-Smoler, G., Lindsay, H. D., Hofmann, K., Papadimitriou, K., Sunnerhagen, P. and Carr, A. M. (2000). Characterization of Schizosaccharomyces pombe Hus1: a PCNA-related protein that associates with Rad1 and Rad9. Mol. Cell. Biol. 20,1254 -1262.[Abstract/Free Full Text]

Craven, R. A., Griffiths, D. J., Sheldrick, K. S., Randall, R. E., Hagan, I. M. and Carr, A. M. (1998). Vectors for the expression of tagged proteins in Schizosaccharomyces pombe.Gene 221,59 -68.[Medline]

Desterro, J. M., Thomson, J. and Hay, R. T. (1997). Ubch9 conjugates SUMO but not ubiquitin. FEBS Lett. 417,297 -300.[Medline]

Desterro, J. M., Rodriguez, M. S. and Hay, R. T. (1998). SUMO modification of IkappaBalpha inhibits NF-kappaB activation. Mol. Cell 2,233 -239.[Medline]

Fikes, J. D., Becker, D. M., Winston, F. and Guarente, L. (1990). Striking conservation of TFIID in Schizosaccharomyces pombe and Saccharomyces cerevisiae. Nature 346,291 -294.[Medline]

Fukagawa, T., Regnier, V. and Ikemura, T. (2001). Creation and characterization of temperature-sensitive CENP-C mutants in vertebrate cells. Nucleic Acids Res. 29,3796 -3803.[Abstract/Free Full Text]

Gong, L., Millas, S., Maul, G. G. and Yeh, E. T. (2000). Differential regulation of sentrinized proteins by a novel sentrin-specific protease. J. Biol. Chem. 275,3355 -3359.[Abstract/Free Full Text]

Gostissa, M., Hengstermann, A., Fogal, V., Sandy, P., Schwarz, S. E., Scheffner, M. and Del Sal, G. (1999). Activation of p53 by conjugation to the ubiquitin-like protein SUMO. EMBO J 18,6462 -6471.[Medline]

Harlow, E. and Lane, D. (1988). Antibodies: a Laboratory Manual. New York: Cold Spring Harbor Laboratory Press.

Ho, J. C., Warr, N. J., Shimizu, H. and Watts, F. Z. (2001). SUMO modification of Rad22, the Schizosaccharomyces pombe homologue of the recombination protein Rad52. Nucleic Acids Res. 29,4179 -4186.[Abstract/Free Full Text]

Johnson, E. S. and Blobel, G. (1997). Ubc9p is the conjugating enzyme for the ubiquitin-like protein Smt3p. J. Biol. Chem. 272,26799 -26802.[Abstract/Free Full Text]

Johnson, E. S. and Blobel, G. (1999). Cell cycle-regulated attachment of the ubiquitin-related protein SUMO to the yeast septins. J. Cell Biol. 147,981 -994.[Abstract/Free Full Text]

Johnson, E. S., Schwienhorst, I., Dohmen, R. J. and Blobel, G. (1997). The ubiquitin-like protein Smt3p is activated for conjugation to other proteins by an Aos1p/Uba2p heterodimer. EMBO J. 16,5509 -5519.[Medline]

Kim, K. I., Baek, S. H., Jeon, Y. J., Nishimori, S., Suzuki, T., Uchida, S., Shimbara, N., Saitoh, H., Tanaka, K. and Chung, C. H. (2000). A new SUMO-specific protease, SUSP1, that is highly expressed in reproductive organs. J. Biol. Chem. 275,14102 -14106.[Abstract/Free Full Text]

Li, S. J. and Hochstrasser, M. (1999). A new protease required for cell-cycle progression in yeast. Nature 398,246 -251.[Medline]

Li, S. J. and Hochstrasser, M. (2000). The yeast ULP2 (SMT4) gene encodes a novel protease specific for the ubiquitin-like Smt3 protein. Mol. Cell. Biol. 20,2367 -2377.[Abstract/Free Full Text]

Mahajan, R., Delphin, C., Guan, T., Gerace, L. and Melchior, F. (1997). A small ubiquitin-related polypeptide involved in targeting RanGAP1 to nuclear pore complex protein RanBP2. Cell 88,97 -107.[Medline]

Mahajan, R., Gerace, L. and Melchior, F. (1998). Molecular characterization of the SUMO modification of RanGAP1 and its role in nuclear envelope association. J. Cell Biol. 140,259 -270.[Abstract/Free Full Text]

Matunis, M. J., Wu, J. and Blobel, G. (1998). SUMO modification and its role in targeting the Ran GTPase-activating protein, RanGAP1, to the nuclear pore complex. J. Cell Biol. 140,499 -509.[Abstract/Free Full Text]

Meluh, P. B. and Koshland, D. (1995). Evidence that the MIF2 gene of Saccharomyces cerevisiae encodes a centromere protein with homology to the mammalian centromere protein CENP-C. Mol. Biol. Cell 6,793 -807.[Abstract]

Moreno, S., Klar, A. and Nurse, P. (1991). Molecular genetic analysis of fission yeast Schizosaccharomyces pombe.Methods Enzymol. 194,795 -823.[Medline]

Moser, B. A., Brondello, J. M., Baber-Furnari, B. and Russell, P. (2000). Mechanism of caffeine-induced checkpoint override in fission yeast. Mol. Cell. Biol. 20,4288 -4294.[Abstract/Free Full Text]

Murray, J. M., Doe, C. L., Schenk, P., Carr, A. M., Lehmann, A. R. and Watts, F. Z. (1992). Cloning and characterisation of the S. pombe rad15 gene, a homologue to the S. cerevisiae RAD3 and human ERCC2 genes. Nucleic Acids Res. 20,2673 -2678.[Abstract/Free Full Text]

Nishida, T., Tanaka, H. and Yasuda, H. (2000). A novel mammalian Smt3-specific isopeptidase 1 (SMT3IP1) localized in the nucleolus at interphase. Eur. J. Biochem. 267,6423 -6427.[Medline]

Rodriguez, M. S., Desterro, J. M., Lain, S., Midgley, C. A., Lane, D. P. and Hay, R. T. (1999). SUMO modification activates the transcriptional response of p53. EMBO J. 18,6455 -6461.[Medline]

Saitoh, H., Sparrow, D. B., Shiomi, T., Pu, R. T., Nishimoto, T., Mohun, T. J. and Dasso, M. (1998). Ubc9p and the conjugation of SUMO to RanGAP1 and RanBP2. Curr. Biol. 8, 121-124.[Medline]

Schwienhorst, I., Johnson, E. S. and Dohmen, R. J. (2000). SUMO conjugation and deconjugation. Mol. Gen. Genet. 263,771 -786.[Medline]

Shayeghi, M., Doe, C. L., Tavassoli, M. and Watts, F. Z. (1997). Characterisation of Schizosaccharomyces pombe rad31, a UBA-related gene required for DNA damage tolerance. Nucleic Acids Res. 25,1162 -1169.[Abstract/Free Full Text]

Sternsdorf, T., Jensen, K. and Will, H. (1997). Evidence for covalent modification of the nuclear dot-associated proteins PML and Sp100 by PIC1/SUMO. J. Cell Biol. 139,1621 -1634.[Abstract/Free Full Text]

Tanaka, K., Nishide, J., Okazaki, K., Kato, H., Niwa, O., Nakagawa, T., Matsuda, H., Kawamukai, M. and Murakami, Y. (1999). Characterization of a fission yeast SUMO homologue, pmt3p, required for multiple nuclear events, including the control of telomere length and chromosome segregation. Mol. Cell. Biol. 19,8660 -8672.[Abstract/Free Full Text]

Tavassoli, M., Shayeghi, M., Nasim, A. and Watts, F. Z. (1995). Cloning and characterisation of the Schizosaccharomyces pombe rad32 gene: a gene required for repair of double strand breaks and recombination. Nucleic Acids Res. 23,383 -388.[Abstract/Free Full Text]

Yeh, E. T., Gong, L. and Kamitani, T. (2000). Ubiquitin-like proteins: new wines in new bottles. Gene 248,1 -14.[Medline]




This article has been cited by other articles:


Home page
Genes Dev.Home page
C.-H. Cheng, Y.-H. Lo, S.-S. Liang, S.-C. Ti, F.-M. Lin, C.-H. Yeh, H.-Y. Huang, and T.-F. Wang
SUMO modifications control assembly of synaptonemal complex and polycomplex in meiosis of Saccharomyces cerevisiae
Genes & Dev., August 1, 2006; 20(15): 2067 - 2081.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. Di Bacco, J. Ouyang, H.-Y. Lee, A. Catic, H. Ploegh, and G. Gill
The SUMO-Specific Protease SENP5 Is Required for Cell Division
Mol. Cell. Biol., June 15, 2006; 26(12): 4489 - 4498.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
P. R. Potts and H. Yu
Human MMS21/NSE2 Is a SUMO Ligase Required for DNA Repair
Mol. Cell. Biol., August 15, 2005; 25(16): 7021 - 7032.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
G. Gill
SUMO and ubiquitin in the nucleus: different functions, similar mechanisms?
Genes & Dev., September 1, 2004; 18(17): 2046 - 2059.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. Soustelle, L. Vernis, K. Freon, A. Reynaud-Angelin, R. Chanet, F. Fabre, and M. Heude
A New Saccharomyces cerevisiae Strain with a Mutant Smt3-Deconjugating Ulp1 Protein Is Affected in DNA Replication and Requires Srs2 and Homologous Recombination for Its Viability
Mol. Cell. Biol., June 15, 2004; 24(12): 5130 - 5143.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Bailey and P. O'Hare
Characterization of the Localization and Proteolytic Activity of the SUMO-specific Protease, SENP1
J. Biol. Chem., January 2, 2004; 279(1): 692 - 703.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Taylor, D. L.
Right arrow Articles by Watts, F. Z.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Taylor, D. L.
Right arrow