|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
Research Article |
Department of Pathology and Laboratory Medicine, Texas A&M University System Health Science Center, College Station, Texas, 77843-1114, USA
* Author for correspondence (e-mail: gedavis{at}tamu.edu )
Accepted 4 December 2001
| Summary |
|---|
|
|
|---|
Key words: Cdc42, Rac1, endothelial cell, capillary morphogenesis
| Introduction |
|---|
|
|
|---|
2ß1 and
1ß1, or
Vß3, and
5ß1 integrins respectively
(Brooks et al., 1994
Previous work from our laboratory indicated that EC lumen formation in
three-dimensional collagen and fibrin matrices is controlled by the formation
and coalescence of pinocytic intracellular vacuoles
(Davis and Camarillo, 1996
;
Salazar et al., 1999
;
Davis et al., 2000
;
Bayless et al., 2000
;
Bell et al., 2001
). These
structures have also been reported by others in vivo and in vitro
(Speidel, 1933
;
Clark and Clark, 1939
; Wolf
and Bar, 1972; Dyson et al.,
1976
; Wagner,
1980
; Folkman and
Haudenschild, 1980
; Montesano
and Orci, 1985
; Shimizu et
al., 1986
; Montesano and Orci,
1988
; Konerding et al.,
1992
; Yang et al.,
1999
). Interestingly, formation of vacuolar and lumenal structures
was completely blocked by the addition of cytochalasin B or nocodazole, actin
and microtubule deploymerizing agents, respectively
(Davis and Camarillo, 1996
)
(K.J.B. and G.E.D., unpublished). Thus, the formation of vacuoles that
coalesce into lumenal structures is dependent on the EC cytoskeletal
machinery.
The RhoA, Rac1 and Cdc42 GTPases regulate the activities of the actin
cytoskeleton, along with gene transcription, cell cycle progression and
adhesion (reviewed in Hall,
1998
; Kaibuchi et al.,
1999
). They also regulate actin stress fiber, lamellipodia and
filopodia formation (Nobes and Hall,
1995
). In addition, they recently have been observed to influence
both the microtubule and intermediate filament cytoskeletons
(Liu et al., 1998
;
Inada et al., 1999
;
Goode et al., 2000
;
Meriane et al., 2000
;
Tian et al., 2000
;
Daub et al., 2001
).
Interestingly, Rho GTPases also control the process of phagocytosis, where
phagocytic vesicles are formed (Ridley et
al., 1992
; Lamaze et al.,
1996
; Caron and Hall,
1998
; Albert et al.,
2000
; Chimini et al.,
2000
; Garrett et al.,
2000
; Hotchin et al.,
2000
). Rho GTPases are well known to be activated downstream of
integrin signaling pathways (Nobes and
Hall, 1995
; Clark et al.,
1998
; Albert et al.,
2000
; Chimini and Chavrier,
2000
; Sastry and Burridge,
2000
; Schwartz and Shattil,
2000
; Kiosses et al.,
2001
), and integrin-ECM interactions are required for EC
morphogenesis (Brooks et al.,
1994
; Senger,
1996
; Davis and Camarillo,
1996
; Senger et al.,
1997
; Salazar et al., 2000;
Davis et al., 2000
;
Bayless et al., 2000
;
Bell et al., 2001
). Rho GTPases
regulate processes required for EC morphogenesis, such as pinocytosis,
endocytosis, cell migration, cell survival and actin dynamics (reviewed in
Hall, 1998
;
Kaibuchi, 1999
;
Chimini and Chavrier, 2000
;
Ridley, 2001
). One report
indicates a role for Rho in EC morphogenesis on planar Matrigel substrates
(Somlyo et al., 2000
).
However, little information exists concerning a role for Rho GTPases during EC
morphogenesis in three dimensions.
Here, we address the hypothesis that Rho GTPases regulate EC morphogenic events, including vacuole and lumen formation in three-dimensional matrices. We utilize Rho-GTPase-specific toxins and modulate EC gene expression with recombinant adenoviruses expressing dominant-negative, constitutively active and green fluorescent protein chimeras to evaluate the role of RhoA, Rac1 and Cdc42 in EC vacuole and lumen formation in three dimensions. Our results demonstrate a requirement for Cdc42 and Rac1 in capillary lumen formation in three-dimensional collagen and fibrin matrices.
| Materials and Methods |
|---|
|
|
|---|
Preparation of recombinant adenoviruses
Using the system previously described by Vogelstein and colleagues
(He et al., 1998
), recombinant
adenoviruses were constructed to express both dominant-negative and
constitutively active forms of the RhoA, Rac1 and Cdc42 GTPases. Full-length
cDNA clones of dominant-negative N19RhoA, N17Rac1-myc and N17Cdc42-myc (G25K
isoform) were obtained from A. Hall
(Ridley et al., 1992
; Nobes
and Hall, 1998). Full-length constitutively active cDNA clones of V12Rac1 and
V12Cdc42 were obtained from K. Kaibuchi
(Kuroda et al., 1997
), and
V14RhoA clone was obtained from M. Negishi
(Katoh et al., 1998
).
Dominant-negative constructs (N17RhoA, N19Rac1 and N19Cdc42) when introduced
interfere and compete with endogenous GTPases for binding to guanosine
nucleotide exchange factors (GEFs) that exchange GTP for GDP. Constitutively
active mutants (V14RhoA, V12Rac1 and V12Cdc42) prevent intrinsic and
GTPase-activating protein (GAP)-induced GTP hydrolysis
(Feig, 1999
). The following
clones were amplified using the respective primer sets: N19RhoA and V14RhoA:
AGCTCGAGGCCACCATGGCTGCCATCCGGAAG and AGTCTAGATCACAAGACAAGGCAACCAGATTT;
N17Rac1-Myc: AGCTCGAGGCCACCATGGAACAAAAGCTGATCTCAG and
AGTCTAGATTACAACAGCAGGCATTTTCTCTTC; N17Cdc42-Myc:
AGGGTACCGCCACCATGGAACAAAAGCTGATCTC and AGTCTAGATTAGAATATACAGCACTTCCTTTT;
V12Rac1: AGCTCGAGGCCACCATGCAGGCCATCAAGTGTGTG and
AGTCTAGATTACAACAGCAGGCATTTTCTCTTC; V12Cdc42:
AGGGTACCGCCACCATGCAGACAATTAAGTGTGTTG and AGTCTAGATTAGAATATACAGCACTTCC
(Genosys, The Woodlands, TX). Restriction digests of PCR products and the
pAdTrack-CMV vector were carried out with XhoI and XbaI
enzymes (Rho and Rac) and KpnI and XbaI enzymes (Cdc42) for
3 hours. Digested vector and insert were purified, quantitated and ligated at
an insert to vector ratio of 4.5:1 overnight at 14°C (Invitrogen Life
Technologies). Positive clones were confirmed by restriction digest, sequence
analysis at Lone Star Labs and Western blot analyses using transfected 293
cells. Recombination and virus production were carried out as described by
He et al., 1998
.
In addition to producing adenoviruses that co-express green fluorescent
protein (GFP), chimeric constructs were produced. Genes coding for both
wild-type and constitutively active forms of RhoA, Rac1 and Cdc42 were cloned
into the pEGFP-C2 vector (Clonteth) along with a C-terminal
verprolin-cofilin-acidic (VCA) domain of human N-WASP. Wild-type RhoA, Rac1,
Cdc42 and VCA domain of N-WASP were amplified from human umbilical vein
endothelial cell cDNA produced in our laboratory as previously described
(Bell et al., 2001
). Clones
were amplified using the following primer sets: GFP-RhoA wt and GFP-V14RhoA:
GAGATCTCTATGGCTGCCATCCGGAAG and AGAAGCTTTCACAAGACAAGGCAACCAG; GFP-Rac1wt and
GFP-V12Rac1: AGAGATCTCTATGCAGGCCATCAAGTGTGTGGTG and
AGAAGCTTTTACAACAGCAGGCATTTTCTCTTCC; GFP-Cdc42wt and GFP-V12Cdc42:
AGAGATCTCTATGCAGACAATTAAGTGTGTTG and AGAAGCTTTTAGAATATACAGCACTTCCTTTTGGG;
GFP-VCA: AGAGATCTCGGACCATCAGGTTCCAACTAC and AGAAGCTTTCAGTCTTCCCACTCATCATC.
Inserts and pEGFP-C2 vector were digested with BglII and
HindIII enzymes as described above, and positive clones were
confirmed with restriction digests, sequence analysis and western blot
analysis using transfected 293 cells. Plasmids containing the EGFP-RhoA, -Rac1
and -VCA chimeric genes were then cloned into pShuttle-CMV using the common
upstream primer for EGFP AGCTCGAGG-CCACCATGGTGAGCAAGGGC. The downstream
primers used were AGTCTAGATCACAAGACAAGGCAACCAGATTT,
AGTCTAGATTACAACAGCAGGCATTTTCTCTTC, and AGAAGCTTTCAGTCTTCCCACTCATCATC
respectively. The EGFP-Cdc42 primer set used was AGGGTACCGCCACCATGGTGAGCAAGGGC
and AGTCTAGATTAGAATATACAGCACTTCCTTTT. Successful cloning was confirmed by
sequence and restriction analyses.
Recombination of all clones with pAdEasy1 adenoviral backbone vector was
accomplished using a previously described method
(He et al., 1998
). Briefly, 5
µg of Track-CMV (or Shuttle-CMV) plasmid was digested with PmeI
(New England Biolabs, Beverly, MA) overnight at 37°C. Ethanol-precipitated
linearized DNA was resuspended in 20 µl TE, and 4 µl was added to 100 ng
pAdEasy1 before recombining into BJ5183 strain. Small colonies were screened
using alkaline lysis and visualized on 0.8% agarose gels. Positive
recombinants were transformed into DH5
cell line and the plasmids
prepared at a large scale (Qiagen). Overnight digests (37°C) using
PacI (New England Biolabs) of 5 µg of plasmid were heated to
70°C before transfecting directly into 293 cell virus packaging line. 2
µg DNA were combined with 20 µl lipofectamine (Invitrogen Life
Technologies) into 500 µl Optimem (Invitrogen Life Technologies) for 20
minutes. Mixture was added to 80% confluent 25 cm2 flask containing
2.5 ml Optimem (Invitrogen Life Technologies) for 6 hours. The media was
replaced every 3 days with 5 ml DMEM containing 10% FCS. Passage 1 viruses
were harvested from 7-14 days after initial transfection.
Propagation of adenoviruses and preparation of viral extracts
293 cells were removed from flasks by scraping, collected in 50 ml
polypropylene tubes, and spun at 350 g for 5 minutes. The
media was aspirated and replaced with 2 ml cold PBS. Cells were vortexed
before freezing in dry ice/methanol bath and thawed at 37°C. This cycle
was repeated a total of four times before spinning at 350 g
for 2 minutes. Supernatants were removed and aliquoted before storage at
-80°C. Viruses were propagated by adding extracts in the absence of serum
to freshly split confluent 75 cm2 flasks of 293 cells for 6 hours
before feeding. Cells were harvested when 30-50% of the monolayer illustrated
cytopathic effects (CPE). All viruses (passage 3 or higher) described were
screened to confirm the presence of nucleic acid inserts along with protein
production using western blot analyses.
Three-dimensional assays with human endothelial cells in collagen and
fibrin matrices
Human umbilical vein endothelial cells (HUVEC) were cultured (passage 2-6)
as previously described (Davis and
Camarillo, 1996
). Cells were placed into 25 cm2 tissue
culture flasks overnight prior to infection with adenoviruses (10 PFU/cell).
Monolayer cultures were rinsed twice with M199 (Invitrogen Life Technologies)
before addition of adenoviruses in 2.5 ml M199. Cultures were placed at
37°C (5% CO2) for 5-6 hours before media containing viral
extracts was removed and replaced with growth medium. Cells were harvested 24
hours later and placed in three-dimensional (25 µl) collagen (3.5 mg/ml) or
fibrin (10 mg/ml) matrices as described
(Davis and Camarillo, 1996
;
Bayless et al., 2000
). Cultures
were fixed for 30 minutes with 2% paraformaldehyde in PBS at the time points
indicated before being quantified and photographed using a Nikon Labophot
microscope equipped with a Nikon FX-35A camera. Other cultures were fixed with
glutaraldehyde and processed for electron microscopy as previously described
(Davis and Camarillo,
1996
).
Fluorescent labeling of intracellular vacuoles
Adenoviruses expressing GFP chimeric proteins coupled to Rho GTPases were
administered to EC monolayers for 5-6 hours before removal of extracts and
replacing with growth medium. After 36 hours, cells were trypsinized and
placed into three-dimensional collagen gels (3.75 mg/ml). In these
experiments, 1 µl gels were added to sterile coverslips and inverted onto
4- or 8-well (Nalgene, Rochester, NY) chambers containing culture media that
was CO2-equilibrated using methods previously described
(Davis and Camarillo, 1996
).
In some cases, 2 µg/ml of mixed isomers of carboxytetramethyl rhodamine
(Molecular Probes, Eugene, OR) was added to the culture media. Cultures were
allowed to proceed for either 8 or 24 hours before being fixed and
photographed. Those treated with carboxytetramethyl rhodamine were rinsed in
10 ml M199 for 1 hour at 37°C to remove free dye before being photographed
live using a Nikon Labophot microscope equipped with a Nikon FX-35A camera.
Cultures were fixed at 24 hour time points, mounted and sealed before image
analysis using confocal microscopy. Images were captured using Radiance 2000
MP imaging system and LaserSharp 2000 software (Bio-Red, Hercules, CA) at the
Texas A&M University College of Veterinary Medicine Image Analysis
Laboratory. Three-dimensional reconstruction was accomplished using Kitware
software) at the Texas A&M University College of Veterinary Medicine Image
Analysis Laboratory.
Digesting cells from collagen matrix
Cells undergoing morphogenesis were digested out of collagen matrices to
image vacuoles and lumens in two dimensions and also demonstrate that cells
digested from the matrix have the ability to attach in an integrin-dependent
manner. Duplicate collagen gels (25 µl volume) were placed into 200 µl
M199 (37°C) with 5 µg collagenase (Sigma-Aldrich Corp., St. Louis, MO)
for 10 minutes with gentle agitation. After digestion of gels, cells were
layered onto coverslips coated with 10 µg/ml pronectin F, a recombinant
Arg-Gly-Asp containing protein. Cells were allowed to attach for 15-20 minutes
before being gently aspirated and rinsed. Cells were photographed live or
fixed with 2% paraformaldehyde before being imaged using fluorescence and
phase microscopy.
Western blot analysis
Monoclonal antibodies specific for Rho (Cytoskeleton, Inc., Denver, CO) and
Cdc42 (BD Transduction Laboratories, Lexington, KY), along with a polyclonal
antibody specific for Rac (Cytoskeleton, Inc.), were tested using western blot
analysis to rule out crossreactivity using recombinantly produced His-tagged
Rho, Rac and Cdc42 proteins. Extracts from three-dimensional cultures were
made as described (Salazar et al.,
1999
) before performing western blot analyses with antibodies
diluted 1:1000. Secondary antibodies conjugated to horseradish peroxidase
(Dako, Carpinteria, CA) were added 1:2000 prior to development using
chemiluminescence (Amersham Biosciences, Piscataway, NJ). To detect GFP,
rabbit antiserum was produced by Bethyl Laboratories (Montgomery, TX) using
recombinant His-tagged GFP as an antigen.
| Results |
|---|
|
|
|---|
|
Toxin B is known to inhibit Rho, Rac and Cdc42 GTPases
(Sehr et al., 1998
). Toxin B
completely blocked EC morphogenesis by interfering with vacuole and lumen
formation (Fig. 2). Photographs
of treated versus untreated cultures in three-dimensional collagen and fibrin
matrices are shown in Fig. 2A.
In these experiments, we observe that pretreatment of ECs with toxin B results
in failure of the lumenal compartment and interconnecting structures to form
at both 24 and 48 hour time points. Similarly, toxin B blocks vacuole (8
hours) and lumen formation (48 hours) in fibrin matrices. Quantitation of
these results in both three-dimensional collagen
(Fig. 2B) and fibrin
(Fig. 2C) matrices reveals a
dose-dependent increase in the formation of vacuoles and lumens over time in
control cultures, whereas complete blockade of these responses is observed
with toxin B treated EC cultures. The effects of toxin B could not be
explained by the induction of cell death. EC monolayers treated for 24 hours
with toxin B retained the ability to exclude trypan blue (96.4%±0.6)
compared with the control (97.4%±0.9) and were capable of attaching to
ECM substrates (Fig. 3C) and
collagen matrices (data not shown). Further experiments revealed that
pretreatment with the exoenzyme C3 transferase, which selectively inhibits Rho
GTPases, had no effect on vacuole and lumen formation
(Fig. 2B), but did ribosylate
Rho in vitro (not shown) and inhibited Rho function, as we have reported
previously (Verma et al.,
2000
). These results indicate that the Rho GTPase alone was not
involved in formation of EC vacuoles and lumenal structures. In contrast,
toxin B treatment completely inhibited EC morphogenesis at all stages,
indicating that Rac and Cdc42 were the likely candidates for regulating these
processes. These data strongly support the hypothesis that Rho GTPases are
required for EC vacuole and lumen formation during morphogenesis in
three-dimensional matrices.
|
|
Endothelial cell lumen formation occurs through pinocytic
intracellular vacuoles
The process of endothelial cell vacuole formation has previously been shown
to be an integrin-dependent pinocytic event
(Davis and Camarillo, 1996
).
Mixed isomers of carboxytetramethyl rhodamine were incubated with endothelial
cell cultures during vacuole formation. This dye is taken up into vacuoles by
control ECs. After 4 hours in culture, ECs were digested out of a collagen
matrix and plated onto coverslips before being rinsed to remove free dye and
photographed (Fig. 3A,B).
Pretreatment of endothelial cells with toxin B, which completely blocked the
ability of vacuoles and subsequent lumens to form, inhibited the uptake of
rhodamine dye into vacuolar structures
(Fig. 3C,D). Toxin-B-treated
ECs were able to attach to coverslips despite the complete blockade of vacuole
formation. Identical uptake of rhodamine dye occurs in ECs infected with
control adenoviruses expressing green fluorescent protein (GFP) (see later),
indicating transfection with control adenoviruses does not affect the
pinocytic process or the ability of ECs to form vacuoles.
Expression of Cdc42 and Rac1 mutants in ECs inhibits vacuole and
lumen formation in three dimensions.
We analyzed the ability of the RhoA, Rac1 and Cdc42 GTPases to regulate EC
vacuole formation using recombinant adenoviruses to deliver dominant-negative
(DN) and constitutively active (CA) forms of each GTPase. The adenoviral
delivery system utilized here is designed to coexpress GFP as an indicator of
viral transfection (He et al.,
1998
). Preliminary results indicated that treatment with control
GFP adenovirus had no effect on the ability of ECs to form vacuoles as
compared to previous studies. Also, EC monolayers infected identically to
cells resuspended in three-dimensional matrices were monitored over the same
period of time (3-4 days) to rule out toxicity (not shown). The CA Rho virus
induced EC death (not shown), whereas the other viruses had no toxic effects
on EC monolayers during the 3-4 day period following expression of Rho GTPase
mutants. Adenovirally transfected ECs were allowed 24 hours to express mutant
forms of Rho GTPases prior to being placed in collagen matrices. After 24
hours, cultures were analyzed for selective expression of the RhoA, Rac1 and
Cdc42 proteins using western blot analysis
(Fig. 4). Our results indicate
that both the dominant-negative and constitutively active viruses elicited
select induction of RhoA, Rac1 or Cdc42 compared with GFP-infected cultures.
Although DN Rac1 and Cdc42 proteins migrate slightly higher due to the
presence of a c-myc epitope tag, the CA RhoA signal is weak because ECs
expressing CA RhoA undergo cell death. The expression of CA RhoA was confirmed
using a control 293 cell line (not shown). The ability of cells expressing
mutant forms of Rho GTPases to maintain interactions with the extracellular
matrix was tested using adhesion assays
(Bayless and Davis, 2001
). ECs
were allowed to express proteins 24 hours prior to testing in adhesion assays.
Our results indicate that adhesion of ECs expressing GFP, CA Cdc42, CA Rac1,
DN RhoA, DN Rac1 and DN Cdc42 proteins were similar to both collagen type I
and osteopontin substrates, which are ß1- and ß3-integrin-dependent
interactions (not shown). Further experiments were conducted with ECs
transfected with DN and CA RhoA, Rac1 and Cdc42 adenoviruses undergoing
morphogenesis at the 24 or 48 hour time points. These experiments were
conducted in the presence and absence of phorbol ester (a powerful stimulator
of vacuole formation) to determine whether expression of mutant forms of Rho
GTPases have the ability to stimulate or inhibit vacuole formation.
Quantitation of EC vacuole formation was conducted under fluorescence so that
only transfected cells (
90-95%) were included. Experiments were performed
under normal culture conditions (Fig.
5A,C) (in the presence of TPA, a phorbol ester) and in the absence
of TPA (Fig. 5B,D). Marked
inhibition of EC vacuole formation was observed following expression of CA or
DN Cdc42. Also, DN Rac1 expression markedly blocked these events as well,
whereas DN RhoA virus had minimal to no effect. CA Rac1 had inhibitory effects
with TPA, but not in its absence. The CA RhoA virus blocked EC morphogenesis
by inducing EC death (probably through an apoptotic mechanism). A more
detailed analysis of a time course showing EC vacuole formation revealed
similar conclusions. Experiments were conducted in both collagen and fibrin
three-dimensional matrices in the presence and absence of phorbol ester
(Fig. 6A,B, respectively).
Expression of mutated forms of Cdc42 markedly inhibited vacuole formation
throughout the time course, whereas expression of DN Rac1 mutant particularly
blocked at later stages of morphogenesis and appeared to induce regression of
formed vacuoles in the presence of TPA. In the absence of TPA, expression of
DN Rac1 completely inhibited vacuole formation, whereas CA Rac1 has no effect.
DN RhoA expression had a slight inhibitory effect with TPA stimulation, while
without TPA, effects were similar to expression of GFP control. Photographs of
the blocking effects of Cdc42 mutants are shown in
Fig. 7. In panels A-D, after 4
hours of morphogenesis, ECs expressing GFP or CA Cdc42 were digested out of
collagen gels and plated to allow imaging in two dimensions. As shown in
Fig. 7A,B, GFP control cells
form intracellular vacuoles whereas ECs expressing CA Cdc42 do not
(Fig. 7C,D). Interestingly,
although morphogenesis is blocked, cells expressing CA Cdc42 were able to
attach to coverslips coated with Pronectin F
(Fig. 7C,D). Later cultures (24
hours) of ECs showed a marked inhibitory effect of CA Cdc42 on EC vacuole
formation in three-dimensional collagen matrices
(Fig. 7F) versus GFP control
(Fig. 7E). Thus, Cdc42 appears
to play a critical role in the EC vacuole formation process. Additional
photographs of cultures expressing GFP, CA Rac1 and CA Cdc42 are shown in
Fig. 7G-I. Together, these data
indicate that Cdc42 appears to play a dominant role in these events, whereas
Rac1 plays a distinct but also necessary role in EC vacuole and eventual lumen
formation. In contrast, the toxin data, combined with the adenoviral
expression data, do not support a major role for Rho in EC vacuole and lumen
formation in three-dimensional matrices.
|
|
|
|
Induction of Cdc42 protein during EC morphogenesis
Because of the dominant role of Cdc42 in EC vacuole and lumen formation,
western blots were performed to examine the expression levels of this protein
during EC morphogenesis in collagen matrices. As shown in
Fig. 8, Cdc42 protein is
markedly induced between 12 and 48 hours of morphogenesis. In contrast, the
control protein, G3PDH, shows stable expression. These data correspond to
previously unreported findings using DNA microarray analysis
(Bell et al., 2001
), comparing
mRNA levels at 0, 8, 24 and 48 hours of morphogenesis. Our data indicate that
compared with reference mRNA (0 hour time point), both Cdc42 and Cdc42
effector protein-2 (Hirsch et al.,
2001
) (CEP 2) mRNA levels are upregulated over the time course.
Cdc42 levels were increased 1.2, 1.6 and 1.5 fold, whereas CEP 2 increased
1.6, 1.4 and 1.6 fold at 8, 24 and 48 hour time points, respectively. The
timing of Cdc42 induction coincides with a marked expansion of the EC lumenal
compartment during morphogenesis (Fig.
1A). As we show later, expression of Cdc42 wild type in ECs
resulted in an increased number of small EC vacuoles. We observe that fusion
of vacuoles appears to increase lumenal diameter
(Davis and Camarillo, 1996
;
Bayless et al., 2000
), so
increases in Cdc42 levels during 12-48 hours of morphogenesis may directly
stimulate the lumen expansion process through increased vacuole formation and
fusion.
|
Cdc42 and Rac1 target to pinocytic vacuolar membranes in ECs during
morphogenesis
The ability of DN and CA Rac1 and Cdc42 constructs to interfere with
vacuole and lumen formation raised the question of whether or not these
molecules may be targeted to vacuolar membranes. To address this question,
adenoviruses were constructed to express chimeric GFP-Rac1 that was
constitutively active (CA), GFP-Cdc42 wild type (wt) and GFP-Rac1wt. Previous
studies have indicated an ability of Rac1 to localize to pinocytic vesicles
(Ridley et al., 1992
) and
interact with endocytic vacuoles of epithelial cells, which had been either
stimulated with the VacA toxin of Helicobacter pylori or had its
cadherin-based intercellular junctions disrupted
(Hotchin et al., 2000
;
Akhtar and Hotchin 2001
).
Western blots were performed using antisera raised against recombinant GFP to
confirm that these viruses express each respective fusion protein
(Fig. 9A). Also, GFP-RacV12,
GFP-Cdc42wt and GFP-Rac1wt showed specific reactivity with Rac1 and Cdc42
antibodies (not shown). We observed that EC vacuoles are derived from
pinocytic events as carboxyrhodamine added to the culture medium strongly
labels the vacuole compartment in cells expressing GFP alone
(Fig. 9B), GFP-Rac1V12,
GFP-Rac1wt or GFP-Cdc42wt (Fig.
9C). GFP-Rac1V12, GFP-Rac1wt and GFP-Cdc42wt localized to the
vacuolar membranes surrounding carboxyrhodamine dye (arrowheads). Photographs
of other experiments (without carboxyrhodamine addition) revealed labeling of
vacuolar membranes with GFP-Rac1V12 (Fig.
9D), GFP-Cdc42wt (Fig.
9E) and GFP-Rac1wt proteins (not shown). Arrowheads indicate
labeling of vacuolar membranes with GFP-chimeric Rac1 and Cdc42 proteins
(Fig. 9C-E). Interestingly, we
observed that expression of GFP-Cdc42wt resulted in an obvious increase in the
number of EC vacuoles compared with the GFP control
(Fig. 9E). We have been unable
to show that GFP-Cdc42V12 targets to vacuoles because this chimeric protein
blocked morphogenesis (not shown).
|
Further analysis of this localization using confocal microscopy is shown in Fig. 10. Cultures (1 µl) were analyzed at 24 hour time points. Data shown are from ECs expressing GFP-Rac1V12 and GFP-Rac1wt proteins. Arrows indicate vacuolar membranes. Serial sections (1 µm) through EC structures revealed targeting of GFP-Rac1wt (Fig. 10A) and GFP-Rac1V12 constructs (Fig. 10B) to intracellular vacuoles. It is observed that many intracellular vacuoles (arrowheads) are directly adjacent to or appear to be fusing with the developing lumenal membrane (open arrows). It is evident that the lumenal membrane appears irregular in areas where vacuoles may have recently fused (arrows). The increased sensitivity and resolving power of confocal fluorescence microscopy further confirm the targeting of Rac1 to vacuole membranes to regulate lumen formation. Identical confocal imaging experiments with GFP-Cdc42wt constructs revealed similar data (Fig. 11A). Four separate sections of a multicellular complex are shown. An increased number of intracellular vacuoles was observed with expression of the GFP-Cdc42wt construct (arrowheads). Interestingly, we observed that this structure contained two nuclei, indicating that these cells are capable of forming multicellular structures. Three-dimensional reconstruction of a GFP-Cdc42wt-labeled capillary structure is shown in Fig. 11B. After fixation (24 hours), cultures expressing the GFP-Cdc42wt construct were labeled with propidium iodide (PI) to label nuclei. Interestingly, the collagen matrix showed some affinity for the propidium iodide dye, whereas the central lumenal compartment did not. As shown in the Fig. 11B (left panel), four nuclei (arrowheads) could be observed in this multicellular structure along with a negatively stained lumenal compartment (L). Analysis of GFP-Cdc42wt signal (converted to red here) revealed a multicellular structure of ECs surrounding a central lumenal compartment (outlined by arrows). Overall, these data show that GFP-Cdc42wt, GFP-Rac1V12 and GFP-Rac1wt constructs target to EC vacuole membranes, which regulate the lumen formation process. In this system, individual cells form multicellular capillary structures, which arise through intracellular vacuole formation, coalescence and fusion within individual ECs. These events are followed by branching and sprouting events to form interconnecting multicellular lumenal structures.
|
|
Expression of the verprolin-cofilin-acidic (VCA) domain of human
N-WASP, a downstream effector of Cdc42, in ECs blocks lumen formation
Our results reveal a role for Cdc42 in EC lumen formation, on the basis of
the ability of both DN and CA constructs to markedly interfere with this
process. N-WASP is a known downstream effector specific for Cdc42
(Symons et al., 1996
). Recent
studies have indicated that a C-terminal VCA domain in N-WASP is responsible
for actin polymerization, and recombinant production of this domain stimulates
actin polymerization through the Arp2/3 complex
(Rohatgi et al., 1999
;
Higgs and Pollard, 2000
;
Prehoda et al., 2000
). On the
basis of these studies, we constructed an adenovirus to express GFP-VCA in ECs
to determine the effect of this construct on lumen formation. This experiment
was designed to mimic the influence of CA Cdc42 expression in ECs since it
possesses the greatest inhibitory effect
(Fig. 6). The western blot
analysis shown in Fig. 12A
shows the production of the chimeric protein. Expression of GFP-VCA in ECs
placed in three dimensional collagen matrices resulted in nearly complete
blockade of vacuole and lumen formation over 24 hours
(Fig. 12B). Photographs
illustrating the morphological effects of this construct on ECs in three
dimensions are shown in Fig.
12C. Interestingly, although blocking lumen formation, GFP-VCA
induced numerous filopodia-like extensions from ECs. The VCA domain of N-WASP
was previously linked downstream of Cdc42 and shown to stimulate
Arp2/3-dependent actin polymerization
(Rohatgi et al., 1999
;
Higgs and Pollard, 2000
;
Prehoda et al., 2000
).
|
| Discussion |
|---|
|
|
|---|
R-mediated phagocytosis, whereas Rho regulates C3-complementmediated
phagocytosis (Caron and Hall,
1998
GFP-Cdc42 and GFP-Rac1 constructs target to vacuolar and lumenal
membranes and regulate EC morphogenesis
Expression of wild-type Cdc42 and CA Rac1 GFP-chimeric proteins in ECs
revealed that these constructs target to vacuolar membranes during the
morphogenic process. These findings are similar to a previous report where a
GFP-Rac construct targeted to vacuoles in epithelial cells
(Hotchin et al., 2000
). Our
observation that expression of GFP-Cdc42 wt led to an increase in vacuolar
numbers suggests that Cdc42 may be rate limiting, which has been previously
reported for Cdc42-mediated endocytosis in dendritic cells
(Garrett et al., 2000
).
Further support for this idea is provided by the upregulation of Cdc42 protein
during EC morphogenesis (Fig.
8). The GFP chimeric protein targeting data correlate with vacuole
formation data, with ECs expressing DN and CA Rac1 and Cdc42 constructs. The
ability of Rac1 and Cdc42 mutants to interfere with vacuole formation and
block morphogenesis supports their direct involvement in the lumen formation
process. Additionally, both Rac and Cdc42 chimeras target to vacuolar
membranes (Figs
9,10,11).
Intracellular vacuole structures enlarge and coalesce to eventually form a
lumenal compartment. These preliminary lumens appear to open up or
interconnect, allowing for EC junction formation and interconnection through
branching events with neighboring ECs. Eventually, the lumenal structure is
lined by multiple ECs to form tubes (Figs
1,
11). How these ECs are
physically arranged during these events to form tubes in three dimensions
remains unclear. Further studies are necessary to address this question,
although the technologies utilized in this study (i.e. image analysis and
fluorescent EC labeling) should allow detailed investigation of this
question.
Here we present data that clearly indicate a role for Cdc42 in regulating
the pinocytic and integrin-dependent process of vacuole and lumen formation
(Davis and Camarillo, 1996
;
Bayless et al., 2000
). A
previous study reported that actin polymerization occurred at the leading edge
of pinosomes in mast cells (Merrifield et
al., 1999
), suggesting the same may be true for EC vacuoles. The
Arp2/3 complex has also been linked to downstream Rho GTPase regulation of
phagocytosis (May et al.,
2000
). In addition, actin polymerization through the Arp2/3
complex was mediated through the C-terminal VCA domain of N-WASP
(Rohatgi et al., 1999
;
Higgs and Pollard, 2000
;
Prehoda et al., 2000
), a
downstream effector of Cdc42. Our results indicate that expression of the
N-WASP VCA domain in ECs markedly blocked vacuole and lumen formation but not
branching events. Interestingly, analysis of EC morphology revealed the
presence of numerous EC processes, some of which resemble filopodia
(Fig. 12). These data are
consistent with results from the expression of CA Cdc42 in ECs, which strongly
implicate the Cdc42-N-WASP pathway in EC morphogenesis during lumen formation
events.
This pathway appears to act downstream of the
2ß1 or
vß3
and
5ß1 integrins, which regulate EC
morphogenesis in collagen and fibrin three-dimensional extracellular matrices,
respectively (Davis and Camarillo,
1996
; Bayless et al.,
2000
). In addition, previous studies indicated a critical role for
the extracellular matrix, integrin,
cytoskeletal (MIC) signaling axis during EC morphogenesis in three
dimensions (Salazar et al.,
1999
; Bell et al.,
2001
) and angiogenesis in vivo
(Brooks et al., 1994
;
Bloch et al., 1997
;
Senger et al., 1997
). Rho
GTPases have emerged as crucial regulators of intracellular signaling
pathways, and in response to extracellular stimuli, Rho proteins regulate both
vesicular and membrane trafficking events
(Ridley, 2001
). The work
reported here supports these concepts and begins to identify critical
downstream regulators of the MIC signaling axis pathway in EC
morphogenesis.
Overall, the data presented here investigate the molecular pathways required for EC vacuoles and lumen formation in three-dimensional collagen or fibrin matrices. It is clear from our studies that both Cdc42 and Rac1 play a critical role in these events. Future studies will aim to identify the signaling pathways and EC molecules relevant to this Cdc42- and Rac1-dependent process.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Akhtar, N. and Hotchin, N. A. (2001). Rac1
regulates adherens junctions through endocytosis of E-cadherin.
Mol. Biol. Cell 12,847
-862.
Albert, M. L., Kim, J. I. and Birge, R. B. (2000). Alphav beta5 integrin recruits the CrkII-Dock180-rac1 complex for phagocytosis of apoptotic cells. Nat. Cell Biol. 2,899 -905.[Medline]
Bayless, K. J., Salazar, R. and Davis, G. E.
(2000). RGD-dependent vacuolation and lumen formation observed
during endothelial morphogenesis in three-dimensional fibrin matrices involves
the
vß3 and
5ß1 integrins. Am. J.
Path. 156,1673
-1683.
Bayless, K. J. and Davis, G. E. (2001).
Identification of dual
4ß1 integrin binding
sites with a 38 amino acid domain in the N-terminal thrombin fragment of human
osteopontin. J. Biol. Chem.
276,13483
-13489.
Bell, S. E., Mavila, A., Salazar, R., Bayless, K. J., Kanagala,
S., Maxwell, S. A. and Davis, G. E. (2001). Differential gene
expression during capillary morphogenesis in three-dimensional collagen
matrices: Regulated expression of novel and known genes involved in basement
membrane matrix assembly, cell cycle regulation, cellular differentiation and
G-protein signaling. J. Cell Sci.
114,2755
-2733.
Bloch, W., Forsberg, E., Lentini, S., Brakebusch, C., Martin,
K., Krell, H. W., Weidle, U. H., Addicks, K. and Fassler, R.
(1997). Beta 1 integrin is essential for teratoma growth and
angiogenesis. J. Cell Biol.
139,265
-278.
Brooks, P. C., Clark, R. A. and Cheresh, D. A.
(1994). Requirement of vascular integrin
vß3 for angiogenesis.
Science 264,569
-571.
Burridge, K. (1999). Crosstalk between Rac and
Rho. Science 283,2028
-2029.
Carmeliet, P. and Jain, R. K. (2000). Angiogenesis in cancer and other diseases. Nature. 407,249 -257.[Medline]
Caron, E. and Hall, A. (1998). Identification
of two distinct mechanisms of phagocytosis controlled by different Rho
GTPases. Science 282,1717
-1721.
Chimini, G. and Chavrier, P. (2000). Function of Rho family of proteins in actin dynamics during phagocytosis and engulfment. Nat. Cell Biol. 2,E191 -E196.[Medline]
Clark, E., King, W., Brugge, J., Symons, M. and Hynes, R. O.
(1998). Integrin-mediated signals regulated by members of the Rho
family of GTPases. J. Cell Biol.
142,573
-586.
Clark, E. R. and Clark, E. L. (1939). Microscopic observations on the growth of blood capillaries in the living mammal. Am. J. Anat. 64,251 -301.
Daub, H., Gavaert, K., Vandekerchkhove, J., Sobel, A. and Hall,
A. (2001). Rac/Cdc42 and p65PAK regulate the
microtubule-destabilizing protein stathmin through phosphorylation and serine
16. J. Biol. Chem. 276,1677
-1680.
Davis, G. E. and Camarillo, C. (1996). An
2ß1 integrin-dependent pinocytic mechanism involving intracellular
vacuole formation and coalescence regulates capillary lumen and tube formation
in three-dimensional collagen matrix. Exp. Cell Res.
224, 39-51.[Medline]
Davis, G. E., Black, S. M. and Bayless, K. J. (2000). Capillary morphogenesis during human endothelial cell invasion of three-dimensional collagen matrices. In Vitro Cell Dev. Biol. 36,513 -519.[Medline]
Dyson, S. E., Jones, D. G. and Kendrick, W. L. (1976). Some observations on the ultrastructure of developing rat cerebral capillaries. Cell Tissue Res. 173,529 -542.[Medline]
Feig, L. A. (1999). Tools of the trade: use of dominant-inhibitory mutants of Ras-family GTPases. Nat. Cell Biol. 1,E25 -E27.[Medline]
Folkman, J. and Haudenschild, C. (1980). Angiogenesis in vitro. Nature 288,551 -556.[Medline]
Folkman, J. and D'Amore, P. A. (1996). Blood vessel formation: what is its molecular basis? Cell 87,1153 -1155.[Medline]
Garrett, W. S., Chen, L. M., Kroschewski, R., Ebersold, M., Turley, S., Trombetta, S., Galan, J. E. and Mellman, I. (2000). Developmental control of endocytosis in dendritic cells by Cdc42. Cell 102,325 -334.[Medline]
Goode, B. L., Drubin, D. G. and Barnes, F. (2000). Functional cooperation between the microtubule and actin cytoskeletons. Curr. Opin. Cell Biol. 12, 63-71.[Medline]
Hall A. (1998). Rho GTPases and the actin
cytoskeleton. Science
279,509
-514.
He, T. C., Kinzler, K. W. and Vogelstein, B.
(1998). A simplified system for rapid generation of recombinant
adenoviruses. Proc. Natl. Acad. Sci. USA
95,2509
-2514.
Higgs, H. N. and Pollard, T. D. (2000).
Activation by Cdc42 and PIP2 of Wiskott-Aldrich Syndrome protein stimulates
actin nucleation by Arp2/3 complex. J. Cell Biol.
150,1311
-1320.
Hirsch, D. S., Pirone, D. M. and Burbelo, P. D.
(2001). A new family of Cdc42 effector proteins, CEPs, function
in fibroblast and epithelial cell shape changes. J. Biol.
Chem. 276,875
-883.
Hotchin, N. A., Cover, T. L. and Akhtar, N.
(2000). Cell vacuolation induced by the VacA cytotoxin of
Helicobacter pylori is regulated by the Rac1 GTPase. J.
Biol. Chem. 275,14009
-14012.
Inada, H., Togashi, H., Nakamura, Y., Kaibuchi, K., Nagata, K.
and Inagaki, M. (1999). Balance between activities of Rho
kinase and type 1 protein phosphatase modulates turnover of phosphorylation
and dynamics of desmin/vimentin filaments. J. Biol.
Chem. 274,34932
-34939.
Kaibuchi, K., Kuroda, S. and Amano, M. (1999). Regulation of the cytoskeleton and cell adhesion by the Rho family GTPases in mammalian cells. Annu. Rev. Biochem. 68,459 -468.[Medline]
Katoh, H., Aoki, J., Ichikawa, A. and Negishi, M.
(1998). p160 RhoA-binding kinase ROKa induces neurite retraction.
J. Biol. Chem. 273,2489
-2492.
Kiosses, W. B., Shattil, S. J., Pampori, N. and Schwartz, M. A. (2001). Rac recruits high-affinity integrin alpha v beta 3 to lamellipodia endothelial cell migration. Nat. Cell Biol. 3,316 -320.[Medline]
Konerding, M. A., van Ackern, C., Steinberg, F. and Streffer, C. (1992). Combined morphological approaches in the study of network formation in tumor angiogenesis. In Angiogenesis. R. Steiner, P.B. Weisz, and R. Langer, editors. Basel: Birkhauser Verlag/Switzerland.40 -58.
Kuroda, S., Fukata, M., Fujii, K., Nakamura, T., Izawa, I. and Kaibuchi, K. (1997). Regulation of cell-cell adhesion of MDCK cells by Cdc42 and Rac1 small GTPases. Biochem. Biophys. Res. Commun. 240,430 -435.[Medline]
Lamaze, C., Chuang, T. H., Terlecky, L. J., Bokoch, G. M. and Schmid, S. L. (1996). Regulation of receptor-mediated endocytosis by Rho and Rac. Nature 382,177 -179.[Medline]
Liu, B. P., Chrzanowska-Wodnicka, M. and Burridge, K. (1998). Microtubule depolymerization induces stress fibers, focal adhesions, and DNA synthesis via the GTP-binding protein Rho. Cell Adhes. Commun. 5,249 -255.[Medline]
May, R. C., Caron, E., Hall, A. and Machesky, L. M.
(2000). Involvement of the Arp2/3 complex in phagocytosis
mediated by Fc
R or CR3. Nat. Cell Biol.
2, 246-248.[Medline]
Meriane, M., Mary, S., Comunale, F., Vifnal, E., Fort, P. and
Gauthier-Rouviere, C. (2000). Cdc42Hs and Rac1 GTPases induce
collapse of the vimentin intermediate filament network. J. Biol.
Chem. 275,33046
-33052.
Merrifield, C. J., Moss, S. E., Ballestrem, C., Imhof, B. A., Giese, G., Wunderlich, I. and Almers, W. (1999). Endocytic vesicles move at the tips of actin tails in cultured mast cells. Nat. Cell Biol. 1,72 -74.[Medline]
Montesano, R. and Orci, L. (1985). Tumor-promoting phorbol esters induce angiogenesis in vitro. Cell 42,469 -477.[Medline]
Montesano, R. and Orci, L. (1988).
Intracellular diaphragmed fenestrae in cultured capillary endothelial cells.
J. Cell Sci. 89,441
-447.
Nobes, C. D. and Hall, A. (1995). Rho, Rac and Cdc42 GTPases regulate the assembly of multimolecular focal complexes associated with actin stress fibers, lamellipodia, and filopodia. Cell 81,53 -62.[Medline]
Prehoda, K. E., Scott, J. A., Mullins, R. D. and Lim, W. A.
(2000). Integration of multiple signals through cooperative
regulation of the N-WASP-Arp2/3 complex. Science
290,801
-806.
Ridley, A. J., Paterson, H. F., Johnston, C. L., Diekmann, D. and Hall, A. (1992). The small GTP-binding protein rac regulates growth factor-induced membrane ruffling Cell 70,401 -410.[Medline]
Ridley, A. J. (2001). Rho proteins: linking signaling with membrane trafficking. Traffic 2, 303-310.[Medline]
Rohatgi, R., Ma, L., Miki, H., Lopez, M., Kirchhausen, T., Takenawa, T. and Kirschner, M. W. (1999). The interaction between N-WASP and the Arp2/3 complex links Cdc42-dependent signals to actin assembly. Cell 97,221 -231.[Medline]
Roof, W. D., Horne, S. M., Young, K. D. and Young, R.
(1994). SlyD, a host gene required for phi X174 lysis, is related
to the FK506- binding protein family of peptidyl-prolyl cis-trans-isomerases.
J. Biol. Chem. 269,2902
-2910.
Salazar, R. M., Bell, S. E. and Davis, G. E. (1999). Coordinate induction of the actin cytoskeletal regulatory proteins gelsolin, vasodilator-stimulated phosphoprotein, and profilin during capillary morphogenesis in vitro. Exp. Cell Res. 249, 22-32.[Medline]
Sastry, S. K. and Burridge, K. (2000). Focal adhesions: a nexus for intracellular signaling and cytoskeletal dynamics. Exp. Cell Res. 261,25 -36.[Medline]
Schwartz, M. and Shattil, S. (2000). Signaling networks linking integrins and Rho family GTPases. Trends Biochem. Sci. 25,388 -391.[Medline]
Sehr, P., Joseph, G., Genth, H., Just, I., Pick, E. and Aktories, K. (1998). Glucosylation and ADP ribosylation of rho proteins: effects on nucleotide binding, GTPase activity, and effector coupling. Biochemistry 37,5296 -5304.[Medline]
Senger, D. R. (1996). Molecular framework for angiogenesis: a complex web of interactions between extravasated plasma proteins and endothelial cell proteins induced by angiogenic cytokines. Am. J. Path. 149,1 -7.[Medline]
Senger, D. R., Claffey, K. P., Benes, J. E., Perruzzi, C. A.,
Sergiou, A. P. and Detmar, M. (1997). Angiogenesis promoted
by vascular endothelial growth factor: regulation through
1ß1 and
2ß1 integrins. Proc. Natl. Acad. Sci. USA
94,13612
-13617.
Shattil, S. J. and Ginsberg, M. H. (1997). Integrin signaling in vascular biology. J. Clin. Invest. 100,S91 -S95.
Shimizu, K., Kishikawa, M. and Nishimori, I. (1986). Endothelial intracellular vacuoles in angiosarcoma of the scalp. Virchows Archiv. B, Cell Pathol. Mol. Pathol. 52,291 -298.
Somlyo, A. V., Bradshaw, D., Ramos, S., Murphy, C., Myers, C. E. and Somlyo, A. P. (2000). Rho-kinase inhibitor retards migration and in vivo dissemination of human prostate cancer cells. Biochem. Biophys. Res. Commun. 269,652 -659.[Medline]
Speidel, C. C. (1933). Studies of living nerves: Activities of ameboid growth cones, sheath cells and myelin segments, as revealed by prolonged observation of individual nerve fibers in frog tadpoles. Am. J. Anat. 52, 1-75.
Symons, M., Derry, J. M., Karlak, B., Jiang, S., Lemahieu, V., Mccormick, F., Francke, U. and Abo, A. (1996). Wiskott-Aldrich syndrome protein, a novel effector for the GTPase CDC42Hs, is implicated in actin polymerization. Cell 84,723 -734.[Medline]
Swanson, J. A. and Watts, C. (1995). Macropinocytosis. Trends Cell Biol. 5, 424-428.[Medline]
Tian, L., Nelson, D. L. and Stewart, D. M.
(2000). Cdc42-interacting protein 4 mediates binding of the
Wiskott-Aldrich syndrome protein to microtubules. J. Biol.
Chem. 275,7854
-7861.
Verma, A., Davis, G. E., Ihler, G. M. (2000).
Infection of human endothelial cells with Bartonella bacilliformis is
dependent on Rho and results in activation of Rho. Infect.
Immunity 68,5960
-5969.
Wagner, R. C. (1980). Endothelial cell embryology and growth. Adv. Microcirc. 9, 45-75.
Wojciak-Stothard, B., Potempa, S., Eichholtz, T. and Ridley, A. J. (2001). Rho and Rac but not Cdc42 regulate endothelial cell permeability. J. Cell Sci. 114,1343 -1355.[Abstract]
Wolff, J. R. and Bar, T. (1972). `Seamless' endothelia in brain capillaries during development of the rat's cerebral cortex. Brain Res. 41,17 -24.[Medline]
Yang, S., Graham, J., Kahn, J. W., Schwartz, E. A. and
Gerritsen, M. E. (1999). Functional roles for PECAM-1 (CD31)
and VE-cadherin (CD144) in tube assembly and lumen formation in
three-dimensional collagen gels. Am. J. Path.
155,887
-895.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
I. K. Klein, D. N. Predescu, T. Sharma, I. Knezevic, A. B. Malik, and S. Predescu Intersectin-2L Regulates Caveola Endocytosis Secondary to Cdc42-mediated Actin Polymerization J. Biol. Chem., September 18, 2009; 284(38): 25953 - 25961. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N. Stratman, W. B. Saunders, A. Sacharidou, W. Koh, K. E. Fisher, D. C. Zawieja, M. J. Davis, and G. E. Davis Endothelial cell lumen and vascular guidance tunnel formation requires MT1-MMP-dependent proteolysis in 3-dimensional collagen matrices Blood, July 9, 2009; 114(2): 237 - 247. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Koh, K. Sachidanandam, A. N. Stratman, A. Sacharidou, A. M. Mayo, E. A. Murphy, D. A. Cheresh, and G. E. Davis Formation of endothelial lumens requires a coordinated PKC{epsilon}-, Src-, Pak- and Raf-kinase-dependent signaling cascade downstream of Cdc42 activation J. Cell Sci., June 1, 2009; 122(11): 1812 - 1822. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Mythreye and G. C. Blobe The type III TGF-{beta} receptor regulates epithelial and cancer cell migration through {beta}-arrestin2-mediated activation of Cdc42 PNAS, May 19, 2009; 106(20): 8221 - 8226. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Horikoshi, A. Suzuki, T. Yamanaka, K. Sasaki, K. Mizuno, H. Sawada, S. Yonemura, and S. Ohno Interaction between PAR-3 and the aPKC-PAR-6 complex is indispensable for apical domain development of epithelial cells J. Cell Sci., May 15, 2009; 122(10): 1595 - 1606. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Brantley-Sieders, G. Zhuang, D. Vaught, T. Freeman, Y. Hwang, D. Hicks, and J. Chen Host Deficiency in Vav2/3 Guanine Nucleotide Exchange Factors Impairs Tumor Growth, Survival, and Angiogenesis In vivo Mol. Cancer Res., May 1, 2009; 7(5): 615 - 623. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Ulmasov, J. Bruno, N. Gordon, M. E. Hartnett, and J. C. Edwards Chloride Intracellular Channel Protein-4 Functions in Angiogenesis by Supporting Acidification of Vacuoles Along the Intracellular Tubulogenic Pathway Am. J. Pathol., March 1, 2009; 174(3): 1084 - 1096. [Abstract] [Full Text] [PDF] |
||||
![]() |
V. L. Watts and E. D. Motley Role of Protease-Activated Receptor-1 in Endothelial Nitric Oxide Synthase-Thr495 Phosphorylation Experimental Biology and Medicine, February 1, 2009; 234(2): 132 - 139. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Navarro, R. E. Perez, M. Rezaiekhaligh, S. M. Mabry, and I. I. Ekekezie T1{alpha}/podoplanin is essential for capillary morphogenesis in lymphatic endothelial cells Am J Physiol Lung Cell Mol Physiol, October 1, 2008; 295(4): L543 - L551. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. R. Fiedler, E. Schonherr, R. Waddington, S. Niland, D. G. Seidler, D. Aeschlimann, and J. A. Eble Decorin Regulates Endothelial Cell Motility on Collagen I through Activation of Insulin-like Growth Factor I Receptor and Modulation of {alpha}2{beta}1 Integrin Activity J. Biol. Chem., June 20, 2008; 283(25): 17406 - 17415. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. A. Townsend, J. L. Wrana, G. E. Davis, and J. V. Barnett Transforming Growth Factor-{beta}-stimulated Endocardial Cell Transformation Is Dependent on Par6c Regulation of RhoA J. Biol. Chem., May 16, 2008; 283(20): 13834 - 13841. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. Koh, R. D. Mahan, and G. E. Davis Cdc42- and Rac1-mediated endothelial lumen formation requires Pak2, Pak4 and Par3, and PKC-dependent signaling J. Cell Sci., April 1, 2008; 121(7): 989 - 1001. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. T. Holderfield and C. C.W. Hughes Crosstalk Between Vascular Endothelial Growth Factor, Notch, and Transforming Growth Factor-{beta} in Vascular Morphogenesis Circ. Res., March 28, 2008; 102(6): 637 - 652. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Liu, S. D. Fraser, P. W. Faloon, E. L. Rollins, J. Vom Berg, O. Starovic-Subota, A. L. Laliberte, J.-N. Chen, F. C. Serluca, and S. J. Childs A betaPix Pak2a signaling pathway regulates cerebral vascular stability in zebrafish PNAS, August 28, 2007; 104(35): 13990 - 13995. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Takeda, A. R. Kazarov, C. E. Butterfield, B. D. Hopkins, L. E. Benjamin, A. Kaipainen, and M. E. Hemler Deletion of tetraspanin Cd151 results in decreased pathologic angiogenesis in vivo and in vitro Blood, February 15, 2007; 109(4): 1524 - 1532. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. J. Byfield, S. Tikku, G. H. Rothblat, K. J. Gooch, and I. Levitan OxLDL increases endothelial stiffness, force generation, and network formation J. Lipid Res., April 1, 2006; 47(4): 715 - 723. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. E. Davis and D. R. Senger Endothelial Extracellular Matrix: Biosynthesis, Remodeling, and Functions During Vascular Morphogenesis and Neovessel Stabilization Circ. Res., November 25, 2005; 97(11): 1093 - 1107. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. D. Covington, K. J. Bayless, R. C. Burghardt, G. E. Davis, and A. R. Parrish Ischemia-induced cleavage of cadherins in NRK cells: evidence for a role of metalloproteinases Am J Physiol Renal Physiol, August 1, 2005; 289(2): F280 - F288. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Lamagna, K. M. Hodivala-Dilke, B. A. Imhof, and M. Aurrand-Lions Antibody against Junctional Adhesion Molecule-C Inhibits Angiogenesis and Tumor Growth Cancer Res., July 1, 2005; 65(13): 5703 - 5710. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. B. Saunders, K. J. Bayless, and G. E. Davis MMP-1 activation by serine proteases and MMP-10 induces human capillary tubular network collapse and regression in 3D collagen matrices J. Cell Sci., May 15, 2005; 118(10): 2325 - 2340. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z.-J. Su, C. N. Hahn, G. J. Goodall, N. M. Reck, A. F. Leske, A. Davy, G. Kremmidiotis, M. A. Vadas, and J. R. Gamble A vascular cell-restricted RhoGAP, p73RhoGAP, is a key regulator of angiogenesis PNAS, August 17, 2004; 101(33): 12212 - 12217. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. J. Bayless and G. E. Davis Microtubule Depolymerization Rapidly Collapses Capillary Tube Networks in Vitro and Angiogenic Vessels in Vivo through the Small GTPase Rho J. Biol. Chem., March 19, 2004; 279(12): 11686 - 11695. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. V. Hoang, M. C. Whelan, and D. R. Senger Rho activity critically and selectively regulates endothelial cell organization during angiogenesis PNAS, February 17, 2004; 101(7): 1874 - 1879. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Cascone, E. Giraudo, F. Caccavari, L. Napione, E. Bertotti, J. G. Collard, G. Serini, and F. Bussolino Temporal and Spatial Modulation of Rho GTPases during in Vitro Formation of Capillary Vascular Network: ADHERENS JUNCTIONS AND MYOSIN LIGHT CHAIN AS TARGETS OF Rac1 AND RhoA J. Biol. Chem., December 12, 2003; 278(50): 50702 - 50713. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. P. SOMLYO and A. V. SOMLYO Ca2+ Sensitivity of Smooth Muscle and Nonmuscle Myosin II: Modulated by G Proteins, Kinases, and Myosin Phosphatase Physiol Rev, October 1, 2003; 83(4): 1325 - 1358. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Cascone, E. Audero, E. Giraudo, L. Napione, F. Maniero, M. R. Philips, J. G. Collard, G. Serini, and F. Bussolino Tie-2-dependent activation of RhoA and Rac1 participates in endothelial cell motility triggered by angiopoietin-1 Blood, October 1, 2003; 102(7): 2482 - 2490. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. V. SOMLYO, C. PHELPS, C. DIPIERRO, M. ETO, P. READ, M. BARRETT, J. J. GIBSON, M. C. BURNITZ, C. MYERS, and A. P. SOMLYO Rho kinase and matrix metalloproteinase inhibitors cooperate to inhibit angiogenesis and growth of human prostate cancer xenotransplants FASEB J, February 1, 2003; 17(2): 223 - 234. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||