|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
Research Article |
1 Institute of Cancer Research, University of Vienna, Borschke-Gasse 8a, A-1090
Vienna, Austria
2 Department of Clinical Pharmacology, Section of Experimental Oncology, Vienna
General Hospital, Währinger Gürtel 18-20, A-1090 Vienna,
Austria
3 Research Institute of Molecular Pathology, Dr Bohr-Gasse 7, A-1030 Vienna,
Austria
* Author for correspondence (e-mail: wolfgang.mikulits{at}univie.ac.at )
Accepted 6 December 2001
| Summary |
|---|
|
|
|---|
Key words: Hepatocytes, Ha-Ras, TGF-ß1, Epithelial polarity, Invasive growth
| Introduction |
|---|
|
|
|---|
The constitutive activation of receptor tyrosine kinases and their
intracellular signaling components is a frequent event contributing to
initiation and maintenance of malignant transformation
(Hanahan and Weinberg, 2000
).
Among these, Ras represents a key signal transducer that integrates signals
from many receptors (Rommel and Hafen,
1998
; Shields et al.,
2000
). Depending on the activation of effectors downstream of Ras,
specific pathways are able to promote various cellular phenotypes
(Downward, 1998
;
McCormick, 1999
). The multiple
downstream effectors of Ras include (i) Raf, which activates the Erk/MAP
kinase pathway (considered to have implications in proliferation,
differentiation and apoptosis), (ii) the lipid kinase phosphoinositide 3-OH
(PI3)3 kinase, which stimulates PKB/Akt kinase to provide signals for cell
survival, and (iii) the small GTPases Rac and Rho, which are both able to
affect cell motility through modulation of the cytoskeleton
(Schmitz et al., 2000
).
Murine liver carcinomas express activated Ha-Ras in 70% of cases,
supporting the idea that Ha-Ras plays a key role in the induction of
hepatocellular carcinogenesis (Reynolds et
al., 1986
; Reynolds et al.,
1987
; Saitoh et al.,
1990
; Strom and Faust,
1990
; Fausto and Webber,
1993
). Indeed, studies of liver growth regulation and
carcinogenesis employing transgenic mice showed that the overexpression and
mutation of Ha-Ras results in rapid formation of adenomas and carcinomas
(Sandgren et al., 1989
).
Although mutational activation of Ras proteins occurs in human liver tumors
with an incidence of only about 5% (Bos,
1989
), receptor-mediated hyperactivation of Ras-dependent signal
transduction pathways is a frequent event in human carcinogenesis
(Clark and Der, 1995
;
Graziani et al., 1993
;
Jo et al., 2000
;
Thiery and Chopin, 1999
).
External stimuli provided by specific growth factors regulate epithelial
cell differentiation and plasticity through binding to their cognate
receptors. Among these, the transforming growth factor (TGF)-ß family of
cytokines is particularly important in controlling proliferation, apoptosis
and morphogenesis of epithelial cells. Particularly, it has been found that
TGF-ß acts as a potent growth inhibitor of epithelial cell proliferation
through its ability to dysregulate inhibitors of cyclin dependent kinases,
which cause arrest in the G1 phase of the cell cycle
(Reynisdottir et al., 1995
).
To accomplish its regulatory role, TGF-ß transduces signals across the
plasma membrane through heteromeric complexes of type I and II of TGF-ß
receptors (TßR-I and II; Massague,
1990
). Ligand-activated TßR-II phosphorylates TßR-I,
which induces intracellular signaling through the modulation and
transactivation of Smads (Massague and
Chen, 2000
; Ten-Dijke et al.,
2000
). Complexes of regulatory Smad2 or Smad3 with the shared
adapter molecule Smad4 translocate into the nucleus and associate with
sequence-specific DNA-binding proteins to modulate transcription of specific
target genes such as, for example, the extracellular matrix molecules
fibronectin and plasminogen activator inhibitor type 1 (PAI-1). During the
past years, however, evidence also accumulated that the loss of sensitivity to
the growth inhibitory effect of TGF-ß1 might play an important role in
the progression of a variety of tumors
(Cui et al., 1996
;
Markowitz et al., 1995
;
Portella et al., 1998
).
Studies on keratinocyte, mammary and prostate epithelial carcinogenesis models
showed a synergistic cooperation of TGF-ß and Ras to induce progression
to undifferentiated, invasive tumors
(Iglesias et al., 2000
;
Oft et al., 1996
;
Oft et al., 1998
;
Park et al., 2000
).
Hepatocytes of the normal adult liver express undetectable levels of
TGF-ß1 but they respond to TGF-ß1 produced by non-parenchymal liver
cells through inhibition of DNA synthesis and induction of apoptosis
(Oberhammer et al., 1991
;
Oberhammer et al., 1992
;
Rossmanith and Schulte-Hermann,
2001
). Accordingly, TGF-ß1 has been suggested to control
homeostasis of liver mass in vivo through its contribution to the termination
of hepatic proliferation upon liver regeneration and elimination of surplus
hepatic cells during adaptive liver growth
(Rossmanith and Schulte-Hermann,
2001
; Fausto,
2000
). Owing to the ability of hepatocytes to inhibit
proliferation and to stimulate cell death, a tumor-suppressive activity has
been assigned to TGF-ß1
(Michalopoulos and DeFrances,
1997
). In contrast, the overexpression of TGF-ß1 and the
concomitant resistance of hepatocytes to growth inhibition was frequently
observed in hepatocellular carcinomas (HCC)
(Bedossa et al., 1995
;
Factor et al., 1997
;
Grasl-Kraupp et al., 1998
;
Huggett et al., 1991
;
Ito et al., 1991
;
Zhao and Zimmermann, 1998
).
These findings supported the idea that TGF-ß1 correlates with a
tumor-promoting role and thus opened a controversial discussion on the
functional implications of TGF-ß1 upon liver tumorigenesis.
In the current study, we focused on the putative dual function of TGF-ß1 in hepatocytes by analyzing the potential of TGF-ß1 to induce growth inhibition as well as to promote malignant transformation. We first present evidence that TGF-ß1, while arresting parental immortalized hepatocytes in the G1 phase, induces a hepatocellular epithelial to fibroblastoid conversion (EFC) in cooperation with activated Ha-Ras. The switch to a spindle-shaped, depolarized morphology leads to the establishment of a highly malignant and invasive phenotype, which secretes TGF-ß1 in an autocrine fashion. Finally, we show that inhibition of PI3 kinase is sufficient to interfere with the TGF-ß1-mediated invasive phenotype, as fibroblastoid cells revert to an epithelial-like morphology.
| Materials and Methods |
|---|
|
|
|---|
(Sigma, St. Louis, USA), 30 ng/ml recombinant human insulin-like
growth factor II (IGF-II, Sigma, St. Louis, USA), 1.4 nM insulin (Sigma, St.
Louis, USA) and antibiotics, as described recently
(Amicone et al., 1997
MMH-R cells were generated by retroviral transmission of parental MMH-D3
cells with a vector bicistronically expressing constitutive active v-Ha-Ras
(Oft et al., 1996
;
Redmond et al., 1988
) and
green fluorescent protein (GFP). Selection and propagation of a
v-Ha-Ras/GFP-positive cell population was performed by subculturing at a ratio
of 1:3 twice a week in medium plus growth factors as described for MMH-D3
cells. Fibroblastoid-converted MMH-RT cells were cultured in RPMI 1640
supplemented with 15% FCS, 1 ng/ml recombinant human TGF-ß1 (R&D
Systems, Minneapolis, USA) and antibiotics. All cells were kept at 37°C
and 5% CO2 and routinely screened for the absence of
mycoplasma.
The inhibitors PD98059 (Alexis Corporation, San Diego, USA), Wortmannin (Alexis Corporation, San Diego, USA), UO126 (Promega, Madison, USA) and LY294.002 (Alexis Corporation, San Diego, USA) were added to the culture medium at concentrations indicated in the text.
Proliferation kinetics
5x105 cells were seeded in triplicate on petri dishes with
medium containing a combination of growth factors (as indicated in the text).
Culture medium was replaced every second day. The number of cells in the
corresponding cell populations was determined periodically in a multichannel
cell analyzer (CASY; Schärfe Systems, Reutlingen, Germany). Cumulative
cell numbers were calculated from the cell counts plus dilution factors.
Flow cytometry
The analysis of cellular DNA content was performed with a flow cytometer
(FACSCalibur, Becton Dickinson, Franklin Lakes, USA). Prior to the
cytofluorometric measurement, about 5x105 cells were washed
with phosphate buffered saline (PBS), fixed in 70% ethanol, washed again with
PBS and treated with 100 µg RNAse A/50 µg propidium iodide per ml for 10
minutes to stain cellular DNA. The percentage of cells in the various cell
cycle positions was calculated using a software package from the same
manufacturer.
Immunofluorescence
Cells grown on filters (Falcon 353090, Becton Dickinson, Franklin Lakes,
USA) and frozen sections of excised tumor tissues were fixed in 3%
formaldehyde/PBS for 20 minutes at room temperature (alternative fixation in
acetone/methanol 1:2 at -20°C for 5 minutes) and permeabilized in 0.5%
Triton X-100/PBS for 5 minutes. Subsequently, filters were cut into pieces and
each part was incubated with the primary antibody diluted in PBS/0.2% gelatine
for 60 minutes at room temperature. Dilutions of primary antibodies were as
follows: anti-E-cadherin (Transduction Laboratories (TL), Lexington, UK),
1:100; anti-N-cadherin (TL), 1:150; anti-ß-catenin (TL), 1:125;
p120ctn (TL), 1:200; anti-Smad2 (TL), 1:250; anti-ZO-1 (Zymed
Laboratories, South San Francisco, USA), 1:75; anti-desmoplakin
(Parrish et al., 1987
), 1:200;
Phalloidin-TexasRed (Molecular Probes, Leiden, The Netherlands), 1:75;
anti-von Willebrand Factor (Sigma, St.Louis, USA), 1:500. Cye-dye-conjugated
secondary antibodies (Jackson Laboratories, West-Grove, USA) were applied for
30 minutes at room temperature at a dilution of 1:150 in PBS/0.2% gelatine.
Single optical section images were generated by computer-driven data
acquisition and optimized by photomultiplier modulation. Cells were imaged
with the TCS-SP confocal microscope (Leica, Heidelberg, Germany) using a
60x1.3 NA lens objective with immersion oil (n=1.518). Conventional
microscopy of cells was performed on a Nikon Eclipse TE300 inverted light
microscope (Nikon Corporation, Tokyo, Japan) equipped for fluorescence image
acquisition. For better illustration and for reasons of enhanced contrast,
some microscopic pictures were colored green or red, respectively, in silico,
although the cells themselves fluoresce green because of GFP expression.
Immunoblotting
Cellular extracts were prepared by swelling cells on ice for 5 minutes in
hypotonic buffer (10 mM HEPES/KOH, pH 7.5, 5 mM KCl, 1.5 mM MgCl2,
1 mM EDTA, 1 mM EGTA, 2 mM DTT supplemented with a proteinase inhibitor
cocktail; 400 µl buffer per 107 cells). Cells were disrupted by
pushing through a syringe equipped with a 27 gauge needle, and complete lysis
was comfirmed by microscopic inspection. The homogenate was supplied with 50
µg/ml DNase, 20 µg/ml RNase A and 0.5% Nonidet-P40 and incubated at room
temperature for 15 minutes. The lysate was supplemented with 2xSDS-PAGE
sample buffer (40 mM Tris-HCl, pH 6.8, 2% SDS, 2% ß-mercaptoethanol, 20%
sucrose, 40 mM DTT, 0.5% bromophenol-blue) and boiled at 95°C for 5
minutes. All lysates were normalized to a protein yield of
1x105 cells. SDS-PAGE and immunoblotting was performed
essentially as described by Gotzmann et al.
(Gotzmann et al., 1997
),
except that the immunological detection of proteins was performed with the
SuperSignal detection system (Pierce Chemical Company, Rockford, USA). The
following primary antibodies diluted in TBS were used: anti-E-cadherin
(Transduction Laboratories (TL), Lexington, UK), 1:3.000; anti-N-cadherin
(TL), 1:1.500; anti-ß-catenin (TL), 1:1.000; anti-ZO-1 (Zymed
Laboratories, South San Francisco, USA), 1:1.500; anti-Ras (DAKO, Carpinteria,
USA), 1:250; anti-desmoplakin (Parrish et
al., 1987
), 1:25; anti-phosphoSmad2 (Upstate Biotechnology,
Waltham, USA), 1:150; GAPDH, 1:5000 (Chemicon, Temecula, USA). Secondary
antibodies (BioRad, Richmond, USA) were used at dilutions of 1:2.000.
Transepithelial electrical resistance (TER)
For measuring TER (Oft et al.,
1996
), cells were plated on polycarbonate filters (Falcon 353090,
Becton Dickinson, Franklin Lakes, USA) with a pore size of 0.4 µm at 70-80%
confluency. The growth medium was changed every second day and the resistance
determined with a volt-ohm meter after 7 days of growth at high density.
Measurements were performed in triplicate and assays were repeated twice. All
TER values were normalized to background values (filter in PBS only).
Colony formation in soft agar
To test the ability of cells to grow independently of anchorage in
semisolid medium, each cell type was seeded in quadruplicate at a density of
5x103 cells in 6-well plates. Cells were mixed with 1.4 ml of
0.3% agar noble in RPMI 1640 plus 10% FCS (MMH-D3, MMH-R, A549) or 15% FCS
plus 1 ng/ml TGF-ß1 (MMH-RT). The suspension was poured onto a bottom
layer of 1.4 ml of 0.7% agar noble in RPMI plus 10% FCS (MMH-D3, MMH-R, A549)
or 15% FCS plus 4 ng/ml TGF-ß1 (MMH-RT). Growth factors (40 ng/ml
TGF-
, 30 ng/ml IGF-II and 1.4 nM insulin) for MMH-D3 and MMH-R cells
were immersed at a two-fold concentration in the bottom agar layer. After 14
days, colonies were counted and evaluated statistically. The assay was
performed twice for each cell type.
Tumor formation in vivo and recovery of tumor cells
Cells were detached from tissue culture plates by trypsinization, washed
with PBS and counted. Aliquots of 1x106 MMH-D3, MMH-R or
MMH-RT cells were resuspended in 200 µ1 Ringer solution and subcutaneously
injected into immunocompromized SCID/BALB/c recipient mice. Tumor induction
was viewed by palpation and the size of tumors was periodically determined
using a vernier caliper. The tumor weight was calculated from tumor size using
the formula: (diameterxdiameterxlength/2). 21 to 28 days after
cell injection, areas containing tumors were surgically removed and cut into
small pieces under sterile conditions using a scalpel. Pieces of tumor tissue
were immediately frozen in liquid nitrogen for further histological analysis.
To recover GFP-positive tumor cells for growth in tissue culture, small pieces
of tumor tissue were put in culture plates, and attached cells were
subcultured at a ratio of 1:3 twice a week in RPMI 1640 supplemented with 15%
FCS plus 1 ng/ml TGF-ß1. All experiments were performed according to the
Austrian guidelines for animal care and protection.
Invasion assay
Invasion assays were performed with 24-well Biocoat Matrigel invasion
chambers (Becton Dickinson, Franklin Lakes, USA) according to the instructions
of the manufacturer. Briefly, Matrigel inserts were re-hydrated in RPMI plus
10% FCS for 2 hours at room temperature. After aspiration of medium, cells in
their respective growth medium (500 µl) were plated at 90% confluency. The
lower chamber was filled with 250 µl of conditioned medium obtained from
mouse 3T3 fibroblasts. Following 24 and 48 hours of incubation, the Matrigel
layer and non-invasive cells were removed with a cotton swab. The filters were
fixed in 8% paraformaldehyde/PBS for 30 minutes, removed from the inserts and
mounted to detect GFP-positive cells by fluorescence microscopy.
Cell structures in collagen gels
Cells trypsinized from tissue culture plates were washed with PBS and
counted. Per collagen gel, 1x104 cells were resuspended in 50
µl serum-free mammary epithelial cell growth medium (MECGM; PromoCell,
Heidelberg, Germany) and mixed with 1 ml ice-cold collagen solution,
containing a mixture of 1-2% rat tail collagen, 1 x MEM-Hanks, 20 mM HEPES, pH
7.4, 0.22% NaHCO3, 0.21% NaOH
(Parzefall et al., 1985
). The
mixtures were put into 24-well plates and allowed to solidify into gels for 30
minutes at 37°C. Subsequently, collagen gels were overlaid with serum-free
MECGM containing 40 ng/ml TGF-
, 30 ng/ml IGF-II and 1.4 nM insulin. In
some cases, TGF-ß1 was added at a concentration of 5 ng/ml (indicated in
the text). The medium with respective growth factors was changed every second
day.
Enzyme linked immunosorbent assay (ELISA) for TGF-ß1
For determination of TGF-ß1 secreted into the medium, cells were grown
in the following media for 40 hours: MMH and MMH-R cells, RPMI/4% FCS
supplemented with TGF-
, IGF-II and insulin; MMH-RT and ex tumor cells,
serum-free MECGM plus TGF-
, IGF-II and insulin. ELISAs were performed
in triplicate, using the Quantikine® human TGF-ß1 immunoassay
(R&D Systems, Minneapolis, USA) according to the instructions of the
manufacturer. Briefly, aliquots of cell culture supernatants were used either
directly or after acidification. Latent TGF-ß1 was activated by addition
of 100 µl 1 M HCl to 500 µl supernatant. After incubation at room
temperature for 10 minutes, the solution was neutralized with 100 µl 0.2 M
NaOH and 10 mM HEPES/KOH, pH 7.5. All values were normalized to background
measurements from respective growth media and calculated on the basis of a
TGF-ß1 standard curve.
Cultivation of MMH-R cells in conditioned medium generated by
fibroblastoid MMH-RT cells
MMH-RT cells were grown in RPMI 1640 plus 15% FCS or serum-free MECGM.
Conditioned media harvested after 40 hours were supplemented with FCS to a
final concentration of 20% (total 35%) and TGF-
, IGF-II and insulin was
added. For controls, RPMI plus 15% FCS or 40% FCS was treated alike. MMH-R
cells at about 50% confluency were grown either in conditioned
TGF-ß1-activated media or control media for 48 hours.
Reverse transcriptase polymerase chain reaction (RT-PCR)
Poly(A)+-mRNA was extracted and reverse transcribed with a mRNA
isolation and first-strand cDNA synthesis kit (Roche, Mannheim, Germany).
Aliquots of the resulting products were employed as templates for specific PCR
amplifications using Ready-To-Go PCR beads (Amersham Pharmacia Biotech,
Uppsala, Sweden). The conditions for PCR reaction were optimized for each
primer pair. The following forward and reverse primers were used for specific
amplifications: pregnane X receptor (PXR), TGAGACCTGAGGAGAGCTGG and
ATGATCTCTTTCCCGTCGCT; E-cadherin, GAGCCTGAGTCCTGCAGTCC and
TGTATTGCTGCTTGGCCTCA; desmoplakin, CCGACACGACTCCGTGAGTA and
CGAGATCCGGACCTTGAACC; cytokeratin 14 (CK14), AAGATCCTGGCAGCCACCGT and
CGGTTGGTGGAGGTCACATC; laminin-alpha5, GCCAGCAAGGTCAAGGTGTC and
AACTGATGCCCGTGGTGTTC; albumin, GAGATCGCCCATCGGTATAA and TCTTCTGGCAACTTCATGCA;
PAI-1, GTGATGCTTGGCAACCCACG and GGTGGAGACATAACAGATGCAG; fibronectin,
CACTGGCTTCCAAGTCGATG and CTTCGTCGGTGCCAACTGGT; CD44, CCTGGCACATCAGCAGATCG and
AGATTCCGGGTCTCGTCAGC; matrix metalloproteinase 9 (MMP-9), CGCTCATGTACCCGCTGT
and TCACCTCATGGTCCACCTTG; snail, ACCTTCCAGCAGCCCTACGACC and
GTGTGGCTTCGGATGTGCATC; rhoA, GTGGAATTCGCCTTGCATCTGAGAAGT and
CACGAATTCAATTAACCGCATGAGGCT. The amplification products were subsequently
analyzed by electrophoresis on 1.5% agarose gels and staining with ethidium
bromide.
| Results |
|---|
|
|
|---|
|
Importantly, treatment of these epithelial MMH-D3 hepatocytes with
TGF-ß1 resulted in growth inhibition within 72 hours
(Fig. 1B) and cells arrested in
the G1 phase of the cell cycle (Fig.
1C). Furthermore, long-term treatment (>7 days) of MMH-D3 cells
with TGF-ß1 lead to cell death. Titration experiments revealed that
MMH-D3 cells effectively responded to TGF-ß1 at concentrations ranging
between 0.5 ng/ml and >30 ng/ml (data not shown). These observations are in
clear accordance with previous investigations reporting that TGF-ß1
inhibits DNA synthesis in primary hepatocytes which is associated with an
increased emergence of apoptotic events
(Oberhammer et al., 1991
;
Oberhammer et al., 1992
;
Grasl-Kraupp et al., 1998
;
Spagnoli et al., 1998
). From
the described data we concluded that MMH-D3 cells consist of a well-defined
polarized epithelial cell architecture and are, like normal hepatocytes,
susceptible to growth arrest and induction of cell death by TGF-ß1.
Polarized, epithelial hepatocytes expressing constitutive active
Ha-Ras undergo epithelial to fibroblastoid conversion (EFC) without growth
inhibition upon treatment with TGF-ß1
Epithelial MMH-D3 cells were retrovirally transmitted with a construct
bicistronically expressing constitutive active v-Ha-Ras
(Oft et al., 1996
;
Redmond et al., 1988
) and GFP.
Linkage of v-Ha-Ras cDNA under control of a virally derived long terminal
repeat ensured stable ectopic expression through multiple cell divisions of
hepatocytes (Fig. 3B)
(Huber and Cordingley, 1988
).
Interestingly, the proliferation of the resulting cell line (termed MMH-R) was
still dependent on the exogenous growth factors TGF-
, IGF-II and
insulin, and they again formed monolayers of cells with a polarized epithelial
architecture, comparable with the one displayed by the parental MMH-D3 cells
(Fig. 2, left panel). Likewise,
the immunostaining pattern for the adherens junction components E-cadherin,
ß-catenin and p120ctn remained restricted to cell-cell
boundaries. The localization of ZO-1 and desmoplakin at cell borders was
indicative of the presence of intact tight junctions and desmosomes,
respectively. Additionally, actin was found to form the typical network of
filaments lining cell boundaries, a feature characteristic of epithelial
cells. Moreover, the cytoplasmic distribution of the TGF-ß-responsive
signaling molecule Smad2 suggested its presence in a presumably inactive form,
as detected in parental MMH-D3 cells (Fig.
2; data not shown).
|
|
However, treatment of MMH-R hepatocytes with TGF-ß1 induced a highly
synchronous transition from a polarized, epithelial to a depolarized,
spindle-shaped and fibroblastoid morphology within 12-24 hours
(Fig. 2, right panel). This
phenotypic switch rapidly occurred at concentrations ranging from 0.5 ng/ml to
>30 ng/ml TGF-ß1, irrespective of the attachment of MMH-R cells on
plastic or collagen-coated tissue culture plates. In sharp contrast to the
growth inhibitory role of TGF-ß1 on parental epithelial MMH-D3 cells,
TGF-ß1-treated fibroblastoid cells were found to loose contact inhibition
and to grow in polylayers. Most notably, these cells showed a proliferation
kinetics comparable to the one of untreated epithelial MMH-D3 and MMH-R cells
(Fig. 3A). Moreover,
fibroblastoid-converted MMH-R cells exhibited factor-independent growth since
the proliferation kinetics did not change, irrespective of the supplementation
of TGF
, IGF-II and insulin alone or in combination (data not shown). In
consequence, these fibroblastoid cells, later on referred to as MMH-RT, were
cultured in medium containing fetal calf serum and TGF-ß1 without
additional growth factors.
In contrast to polarized MMH cell types, fibroblastoid MMH-RT derivatives showed a dramatic change in the expression levels and subcellular distribution of epithelial markers (Fig. 2, right panel). Confocal immunofluorescence microscopy revealed that the tumor suppressor E-cadherin was hardly detectable; it also revealed the cytoplasmic redistribution of ß-catenin, p120ctn and ZO-1. Desmoplakin even declined to undetectable levels, and a pronounced stress fiber formation of actin polymers was observed. Furthermore, Smad2 was already exclusively localized in cell nuclei 30 minutes after TGF-ß1 induction, indicating TGF-ß1-mediated transactivation of the signaling molecule. In accordance with these data, the analysis of protein levels showed a loss of E-cadherin and desmoplakin expression as well as a significant reduction of ß-catenin and ZO-1 protein levels in fibroblastoid MMH-RT cells (Fig. 3B). As expected, the transepithelial electrical resistance caused by the presence of functional tight junctions, which seal the paracellular spaces between epithelial cells, was completely abolished in layers of depolarized MMH-RT cells (Table 1).
|
|
Depolarized, fibroblastoid MMH-RT cells display a highly malignant
and invasive phenotype
Transformation-related and tumorigenic properties of epithelial MMH-R
versus fibroblastoid MMH-RT cells were analyzed by a broad panel of in vitro
and in vivo assays. Both cell types showed anchorage-independent growth in
soft agar assays and formed colonies with a comparable efficiency (about 20%),
whereas non-tumorigenic parental MMH-D3 cells were not able to grow under
these conditions (Table 1)
(Amicone et al., 1997
).
Contrary to the packed colonies generated by epithelial MMH-R cells,
fibroblastoid MMH-RT-derived colonies were diffuse in appearance and exhibited
cell spreading, which is indicative of a high motility
(Fig. 4A). Interestingly, the
highly invasive lung carcinoma cell line A549 yielded dispersed colonies with
a similar formation efficiency (data not shown)
(Hirai et al., 1991
). These
data obtained by soft agar assays pointed to a malignant transformation of
epithelial MMH-R and fibroblastoid MMH-RT cells; however, depolarized cells
additionally displayed the special feature of cell spreading.
Further studies of the ability of MMH-R and MMH-RT cells to generate tumors in vivo revealed yet another difference. Epithelial MMH-R cells produced tumors palpable 11-12 days after subcutaneous injection into immunocompromized SCID/BALB/c recipient mice. However, tumors formed by fibroblastoid MMH-RT were already palpable after 6-7 days (Fig. 4B; Table 1). In addition, fibroblastoid-derived tumors developed an about three-fold higher tumor mass as compared with tumors that originated from epithelial MMH-R cells. These observations, which suggest a more aggressive tumor formation in depolarized MMH-RT cells, were corroborated by the finding that a pronounced vascularization was detectable in fibroblastoid-derived tumors, whereas scarce blood vessel formation was observed in tumors established from epithelial MMH-R cells (Fig. 4C; Table 1). Since large necrotic areas were exclusively localized in MMH-R-derived tumors (data not shown), the proper vascularization might account for the more rapid development of MMH-RT-derived tumors.
Histological analysis revealed that both types of experimental tumors consist of poorly differentiated cells without significant differences in morphology. ZO-1 appeared to be cytoplasmically distributed in sections of both MMH-R- and MMH-RT-derived tumor tissues, indicating a depolarized phenotype of cells in vivo (Fig. 4D). In this regard it is important to note that cells recultivated from both tumors displayed a fibroblastoid morphology pointing to an EFC of MMH-R cells in vivo as well (Table 1). The isolated GFP-positive cell type of MMH-R-derived tumors, termed ex tumor, again exhibited a diffuse cytoplasmic localization of E-cadherin and ZO-1 along with stress fiber formation of actin (data not shown). Hence, this phenotype, which is similar to that of MMH-RT cells generated in vitro, suggests that TGF-ß1 might be also a potential candidate to govern hepatocellular EFC in vivo.
By employing Matrigel-coated invasion chambers, we finally observed that fibroblastoid MMH-RT cells show the ability to migrate through Matrigel layers, whereas epithelial MMH-R cells have very restricted behavior in this respect (Fig. 4E; Table 1). Quantitative analysis yielded an about ten-fold higher number of MMH-RT cells with this migratory capacity compared with epithelial MMH-R cells. Taken together, these data indicate that fibroblastoid cells become more malignant and adopt an invasive phenotype after EFC, which accounts for severely vascularized experimental tumors in vivo.
Fibroblastoid MMH-RT cells generate disordered structures in
reconstituted collagen gels
The data outlined above were confirmed by using an alternative experimental
system, which is thought to mimic more closely the situation in vivo
(Oft et al., 1996
). For this
purpose, cells were cultured in reconstituted collagen matrices in combination
with serum-free media in order to monitor hepatocellular EFC under defined
conditions. Polarized epithelial cell types developed into lumen-forming
structures, which were visible between 7-10 days of cultivation
(Fig. 5A). However, upon
addition of TGF-ß1 to serum-free media overlaying collagen cultures of
MMH-R cells, disordered structures of elongated branching cords were observed,
again, within 7-10 days of incubation (Fig.
5B). Notably, these disordered structures could be grown into
highly dense networks. The observed drastic alterations of cellular plasticity
were highly reminiscent of phenotypical changes mediated by Ha-Ras and
TGF-ß1 on conventional tissue culture plastic. From these results we
concluded that the conversion to a fibroblastoid phenotype is the prerequisite
for the accumulation of branching cord-like structures, which reflect an
invasively growing phenotype in three-dimensional collagen cultures.
|
Depolarized, fibroblastoid MMH-RT cells establish an autocrine loop
of TGF-ß1 regulation
As it has been reported that TGF-ß1 is highly expressed in
hepatocellular carcinomas (Bedossa et al.,
1995
; Factor et al.,
1997
; Grasl-Kraupp et al.,
1998
; Huggett et al.,
1991
; Ito et al.,
1991
; Zhao and Zimmermann,
1998
), we next asked whether fibroblastoid MMH-RT themselves
produce TGF-ß1. Thus, we assayed cell culture supernatants harvested from
epithelial and fibroblastoid cell cultures for their respective TGF-ß1
content. As described for primary hepatocytes, which synthesize TGF-ß in
culture, both, MMH-D3 and MMH-R cells, produced low amounts of latent
TGF-ß1 (Gao et al.,
1996
). However, we found that fibroblastoid MMH-RT and ex tumor
cells secreted about 10-fold higher levels of TGF-ß1 into the media than
MMH-D3 and MMH-R cells (Fig.
6A). In line with these results, cell culture supernatants
obtained from fibroblastoid MMH-RT and ex-tumor cells were on the one hand
able to mediate growth inhibition of parental MMH-D3 cells and on the other
hand were competent to trigger EFC of MMH-R cells (data not shown). The
massive TGF-ß1 secretion of fibroblastoid cell types suggests additional
functions in the stepwise malignant transformation of hepatocytes. In the
initial phase, TGF-ß1 induces EFC after cell autonomous Ras activation
but at the fibroblastoid stage, TGF-ß1 might be necessary to maintain the
invasive phenotype.
|
Loss of E-cadherin is accompanied by upregulation of the
transcription factor snail upon hepatocellular EFC
A selective array of genes belonging to diverse functional classes was
further analyzed to estimate a potential reprogramming of gene expression upon
hepatocellular EFC. By determining steady state mRNA levels from polarized
MMH-R versus depolarized MMH-RT cells using RT-PCR, we found that the
expression of genes associated with differentiation of hepatocytes like PXR, a
putative downstream target of the hepatocyte nuclear factor (HNF)-4
(Li et al., 2000
), and albumin
were virtually abolished (Fig.
6B). In accordance with the entire collapse of epithelial
architecture, the expression of E-cadherin and desmoplakin declined to almost
undetectable levels (Fig. 2,
Fig. 3B). A similar result was
obtained for the intermediate filament component CK14. Laminin A5,
representing a ligand of integrins, whose signaling contributes to cell
adhesion and the maintenance of a differentiated epithelial phenotype
(Kikkawa et al., 1998
), was
also significantly reduced. In contrast, PAI-1 and fibronectin, previously
identified as TGF-ß targets, which fulfil crucial functions in the
modification of the extracellular matrix (ECM) composition
(Ten-Dijke et al., 2000
;
Hocevar et al., 1999
), were
strongly upregulated in fibroblastoid MMH-RT cells
(Fig. 6B). Moreover, in line
with invasiveness of MMH-RT cells, MMP-9 appeared to be exclusively expressed
in depolarized cells. Additionally, a significant increase of the hyaluronan
receptor CD44 was detected, whose elevated abundance has already been
described at later stages of liver carcinomas
(Endo and Terada, 2000
). Most
interestingly with respect to the loss of E-cadherin expression in
fibroblastoid cells, a strong accumulation of the zinc finger transcription
factor Snail was detectable. This finding is of particular interest, as Snail
has been reported to act as a potential regulator that is able to repress the
E-cadherin promoter and to govern epithelial to mesenchymal (fibroblastoid)
transition on its own (Batlle et al.,
2000
; Cano et al.,
2000
). These results suggest that hepatocellular EFC correlates
with both functional dedifferentiation and reprogramming of the epithelial
gene expression pattern towards an invasive stage, including remodeling of ECM
proteins and repression of E-cadherin by Snail.
Fibroblastoid MMH-RT cells revert to an epithelial-like phenotype
through the inactivation of PI3 kinase but not of Mek1/2
In a final set of experiments, we started to analyze the signaling pathways
responsible for the maintenance of the fibroblastoid state. Thus, experiments
were performed that aimed to revert the fibroblastoid phenotype of long-term
growing MMH-RT cells to an epithelial-like morphology within 24 hours, a time
period representative of the induction of hepatocellular EFC. Interestingly,
inhibition of Mek1/2 activity, which operates downstream of Raf and stimulates
Erk, by the low molecular inhibitor UO126, had no effect on the established
fibroblastoid cell architecture (Fig.
7A). Similar results were obtained with the Mek1/2 antagonist
PD98059 (data not shown), suggesting that signaling through the Mek pathway is
not required to maintain the fibroblastoid state. In sharp contrast, the
functional inactivation of PI3 kinase signaling by treatment of cells with
LY294.002 resulted in a reversion of fibroblastoid MMH-RT to an
epithelial-like morphology (Fig.
7A). A similar interference with PI3 kinase activity through the
use of wortmannin as an inhibitory component verified the data achieved with
LY294.002 (data not shown). Phenotypic analysis further revealed that this
reversion to an epithelium-like one was accompanied by the relocalization of
E-cadherin and its associated protein ß-catenin on cell margins, whereas
ZO-1 still displayed a cytoplasmic distribution
(Fig. 7B). The reconversion was
further indicated by an increasing re-expression of the tumor suppressor
E-cadherin as well as by the reduction of MMP-9 protein levels
(Fig. 7C). After prolonged
treatment of fibroblastoid cells with LY294.002, E-cadherin and MMP-9 showed
expression levels almost comparable with those observed in epithelial MMH-R
cells. These data suggest that the inactivation of PI3 kinase in fibroblastoid
cells provides epithelial reorganization, which points to a key function of
this signal transducer in maintaining the fibroblastoid state. Moreover, the
reversion appears as a hierarchical reconstruction of intercellular complexes
with a delayed repolarization of cells, as adherens junctions were fully
restored at times when tight junctions were still disintegrated.
|
| Discussion |
|---|
|
|
|---|
Hepatocellular EFC: the impact of Ha-Ras and TGF-ß1
TGF-ß has conflicting roles, with both an anti-proliferative and a
tumor-promoting effect. The functional role of TGF-ß in liver and other
normal epithelial tissues is widely accepted to be an anti-proliferative one.
As observed in our model system employing well differentiated, immortalized
MMH-D3 (Amicone et al., 1997
),
TGF-ß1 is quite effective at accomplishing this tumor-suppressive task.
Treatment of growing MMH-D3 cells with TGF-ß1 results in an arrest of
proliferation, followed by cell death. Interestingly, TGF-ß1-treated
MMH-D3 hepatocytes acquired a fibroblastoid morphology before undergoing cell
death, which is associated with a breakdown of intercellular complexes at
final stages (data not shown). This observation suggests that TGF-ß1 is
not only a mediator of anti-proliferative events but it also causes drastic
alterations in the epithelial organization of hepatocytes. Similar
TGF-ß1-induced changes in morphology and polarity were also observed in
mammary epithelial cells protected from apoptosis by Bcl-2 (E. Janda and H.B.,
unpublished). Likewise, these morphogenetic changes are obvious in cooperation
with oncogenic activated Ha-Ras. However, these cells show unaffected
proliferation kinetics and develop to a more malignant and invasive phenotype
under these conditions. From that point of view, TGF-ß1 activity can be
considered as an executor of hepatocellular fibroblastoid conversion, and
activated Ha-Ras signaling is the major source providing the tumorigenic
potential. This interpretation is corroborated by the fact that constitutive
Ras activation on its own leads to non-invasive malignant transformation
(Fig. 4; Table 1), which hardly affects
epithelial polarity (Fig. 2). Yet, at the time when Ha-Ras is activated in combination with TGF-ß1
stimulation, both signals act synergistically to adopt an invasive phenotype.
The latter aspects give a clear-cut rationale for the potential of TGF-ß1
to provide a tumor-promoting function, while Ha-Ras can do more than
conferring resistance to the growth inhibitory and proapoptotic effects of
TGF-ß1 (Huggett et al.,
1991
; Houck et al.,
1989
).
Interestingly, hepatocyte growth factor (HGF), fibroblast growth factor
(FGF)-1 and FGF-2 failed to trigger EFC of MMH-R cells (data not shown),
although ligand activation of respective cognate receptors has been suggested
to induce scattering of cells in various experimental settings, a process
closely related to epithelial to mesenchymal (fibroblastoid) transitions
(Boyer et al., 2000
). The
reason for the lack of induction of EFC, however, might be that the
stimulation of HGF or FGF receptors again results in activation of Ras,
without affecting pathways contributing to morphogenesis. With this in mind,
hyperactivation of Ras appears to be the prerequisite for hepatocellular EFC
rather than a trigger on its own.
PI3 kinase probably plays a key role in the maintenance of the
fibroblastoid state, as its inhibition results in a reversion to an
epithelial-like phenotype (Fig.
7). A similar finding on the crucial role of PI3 kinase has been
reported in the TGF-ß-mediated mesenchymal transition of murine NMuMG
mammary epithelial cells (Bakin et al.,
2000
). An indication of the significance of PI3 kinase signaling
in hepatocellular EFC was seen by the detection of phosphorylation of its
downstream target PKB/Akt in fibroblastoid MMH-RT cells, which could also be
detected in epithelial MMH-R cells (data not shown). In contrast, deactivation
of Erk1/2 through inhibition of Mek1/2 failed to revert fibroblastoid cells,
which is in line with the observation that phosphorylation of Erk1/2 could be
detected in epithelial MMH-R cells; however, it was hardly present in
established MMH-RT cells (J.G. and W.M., unpublished). Similar low levels of
activated Erk1/2 were observed in parental MMH-D3 cells. Importantly, these
data argue on the one hand for an essential role of the putatively unperturbed
Ras/PI3 kinase pathway in sustaining the dedifferentiated state (obviously
through its role in cell survival) and on the other hand, Erk1/2 activity
appears to be crucial to induce hepatocellular EFC.
Stimulation of TGF-ß signaling causes a rapid shift of Smad2 from a
diffuse cellular distribution in epithelial MMH-R cells to a nuclear
localization in fibroblastoid MMH-RT cells
(Fig. 2). Similarly, nuclear
Smad2 localization was recently observed in human HCCs
(Matsuzaki et al., 2000
). So
far, these data support the idea that Smad2 might be activated to modulate
gene expression in complex with common Smad4; the latter component was
recently reported to be constitutively expressed in MMH cell types
(Spagnoli et al., 2000
).
Future work will have to concentrate on the respective roles of Smad signaling
and Ras-downstream pathways crosstalking to these TßR-dependent pathways
in order to better understand the highly synergistic but also extremely
complex interplay between Ha-Ras and TGF-ß1 in promoting late events of
hepatic tumorigenesis.
Hepatocellular EFC and late stage tumor progression
Our model system mimics the progression of malignant cell transformation
towards an invasive phenotype and suggests for the first time that EFC of
hepatocytes might be a relevant phenomenon upon hepatocarcinogenesis. This
idea is strongly supported by the experimental observations that fibroblastoid
MMH-RT cells (i) lose intercellular contacts and respective proteins
characteristic of polarized epithelial cells, (ii) show strong modifications
of the cytoskeletal framework, (iii) display cell spreading in semisolid soft
agar, (iv) generate severely vascularized experimental tumors in vivo, and
finally and (v) migrate through reconstituted basement membranes in vitro
(Figs 2,
4;
Table 1). In sharp contrast,
the Ras-transformed but polarized MMH-R cells are restricted with respect to
these properties, although their tumorigenesis in the animal is preceded by
EFC, presumably owing to TGF-ß secreted by mesenchymal cells surrounding
the injected MMH-R cells. This synergistic action of Ha-Ras and TGF-ß1
causing a shift to a fibroblastoid state in vitro and during tumorigenesis in
vivo has been described in other epithelial lineages, that is keratinocytes
(Cui et al., 1996
;
Portella et al., 1998
),
prostate epithelial (Park et al.,
2000
) and mammary gland epithelial cells
(Oft et al., 1996
;
Oft et al., 1998
;
Somasiri et al., 2000
,
Piek et al., 1999
). Consistent
with our data, downregulation of the tumor suppressor E-cadherin has been
reported to occur frequently in human HCCs and, moreover, has been suggested
to be necessary for intrahepatic metastasis
(Matsumara et al., 2001
;
Osada et al., 1996
;
Slagle et al., 1993
).
Similarly, the inactivation of E-cadherin-associated ß-catenin along with
a nuclear accumulation was found in a high percentage of mouse and human HCCs
(Terris et al., 1999
) as well
as in the mesenchymal (fibroblastoid) transition of mammary epithelial cells
(Eger et al., 2000
). Since
EFC-like events were closely correlated with late stage carcinogenesis in
several mouse models and owing to the respective observations in human HCCs,
it is tempting to speculate that hepatocellular EFC might be a critical event
in late liver tumorigenesis.
Establishment of an autocrine loop of TGF-ß1 regulation
Interactions between the epithelium and the mesenchyme clearly involves
soluble factors acting in a paracrine manner to transmit specific information
(Birchmeier et al., 1995
;
Birchmeier and Birchmeier,
1993
). In the liver, the nonparenchymal compartment has been
described as the major source for TGF-ß1, whereas hepatocytes in the
parenchyma fail to express detectable levels of this cytokine
(Rossmanith and Schulte-Hermann,
2001
). Thus, the mito-inhibitory function of TGF-ß on normal
hepatocytes has been suggested to arise from a paracrine mode of regulation.
By contrast, as shown by several reports, abundant TGF-ß levels are
detectable in HCCs accompanied by a malignant progression
(Bedossa et al., 1995
) and,
furthermore, elevated TGF-ß concentrations could be measured in the serum
of HCC patients (Shirai et al.,
1994
). The first light to be shed on this obvious discrepancy was
by recent studies demonstrating that TGF-ß1 constitutively activates
Smad2 in an autocrine fashion in human HCCs
(Matsuzaki et al., 2000
).
Interestingly, the data provided by the current study clearly confirm this
finding, as TGF-ß1 secretion was highly increased in fibroblastoid MMH-RT
cells and cell culture supernatants of these cells were able to induce EFC of
MMH-R cells along with a stimulation of nuclear Smad2 localization. Our data
provide further evidence that a switch from a paracrine to an autocrine
regulation of TGF-ß signaling occurs, which might be important for the
late steps in hepatocarcinogenesis. However, the switch in the regulatory loop
leading to an autocrine stimulatory mechanism, which is above sub-threshold
levels of TGF-ß1 production, appears to depend on the activation of Ras.
In synergy with Ras, the autocrine regulation of TGF-ß signaling has on
the one hand the potential to recruit epithelial MMH-R cells to undergo EFC,
and on the other hand to the potential to maintain the fibroblastoid, invasive
state.
Reprogramming of gene expression upon hepatocellular EFC
Not surprisingly, the induction of hepatocellular EFC depends on de novo
RNA and protein synthesis, as inhibition of transcription and translation by
the treatment of MMH-R cells with actinomycin D and cycloheximide,
respectively, prevented the TGF-ß1-mediated fibroblastoid conversion
(data not shown). These observations motivated us to analyze changes in the
steady state transcript levels of a selective panel of genes in epithelial
versus fibroblastoid cells (>30 genes in total). The results obtained
clearly indicate that hepatocellular EFC is accompanied by an epithelial
dedifferentiation process as the expression of albumin, PXR, E-cadherin and
desmoplakin is abolished in fibroblastoid cells
(Fig. 6B). In addition, the
increased expression of PAI-1, fibronectin and MMP-9 strongly suggest that
MMH-RT cells have acquired a stage capable of remodeling and degrading the
ECM, as has been described for various types of tumor tissues at late stages
of malignant progression. A potential regulatory candidate responsible for
promoting hepatocellular EFC might yet be identified through studies on Snail.
This transcription factor is able to bind directly as a repressor to the
E-cadherin promoter, and when overexpressed, it has been reported to induce
epithelial cells to transform into an invasive, fibroblastoid phenotype on its
own (Batlle et al., 2000
;
Cano et al., 2000
). In
accordance with these studies, the loss of the tumor suppressor E-cadherin
inversely correlated with the upregulation of Snail upon hepatocellular EFC.
So far, however, Snail-mediated alterations could not be detected in
experiments aimed at ectopically expressing Snail in MMH-D3 and MMH-R cells,
most probably owing to the low level of exogenous Snail expression (data not
shown). Further investigations will focus on the regulatory role of Snail upon
EFC and will elucidate whether Snail represents a potential marker for
HCCs.
A promising future prospect is the study of the sequence of molecular events following TGF-ß1-induced progression of Ras-hepatocytes (MMH-R) towards an increased malignant and invasive phenotype. Importantly, the described hepatocellular EFC occurs highly synchronously on simple tissue culture plastic without requiring more complex conditions. This makes the described tumor model system an ideal tool for high-throughput approaches in order to analyze alterations at the level of gene expression between cell populations simultaneously passing the steps towards establishing the fibroblastoid state. We expect that such kinetic analyses of gene expression profiles during EFC will help to dissect the molecular mechanisms responsible for late malignant events of hepatocytes. In this respect, (de)activation of gene products contributing to vascularization are of potential interest. The proposed detailed analysis at the molecular level and the comparison of results with observations made in human HCCs will clarify the relevance of this murine tumor model for investigation of human hepatocarcinogenesis. The identification of signaling pathways contributing to hepatocellular EFC may help to identify new targets for therapeutical intervention at late steps in hepatocarcinogenesis, such as PI3 kinase or up/downstream signal transducers.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Amicone, L., Galimi, M. A., Spagnoli, F. M., Tommasini, C., De-Luca, V. and Tripodi, M. (1995). Temporal and tissue-specific expression of the MET ORF driven by the complete transcriptional unit of human A1AT gene in transgenic mice. Gene 162,323 -328.[Medline]
Amicone, L., Spagnoli, F. M., Spath, G., Giordano, S., Tommasini, C., Bernardini, S., De-Luca, V., Della-Rocca, C., Weiss, M. C., Comoglio, P. M. and Tripodi, M. (1997). Transgenic expression in the liver of truncated Met blocks apoptosis and permits immortalization of hepatocytes. EMBO J. 16,495 -503.[Medline]
Bakin, A. V., Tomlinson, A. K., Bhowmick, N. A., Moses, H. L.
and Arteaga, C. L. (2000). Phosphatidylinositol 3-kinase
function is required for transforming growth factor beta-mediated epithelial
to mesenchymal transition and cell migration. J. Biol.
Chem. 275,36803
-36810.
Batlle, E., Sancho, E., Franci, C., Dominguez, D., Monfar, M., Baulida, J. and Garcia-De-Herreros, A. (2000). The transcription factor snail is a repressor of E-cadherin gene expression in epithelial tumor cells. Nat. Cell. Biol. 2, 84-89.[Medline]
Bedossa, P., Peltier, E., Terris, B., Franco, D. and Poynard T. (1995). Transforming growth factor-beta 1 (TGF-beta 1) and TGF-beta 1 receptors in normal, cirrhotic, and neoplastic human livers. Hepatology 21,760 -766.[Medline]
Birchmeier, C. and Birchmeier, W. (1993). Molecular aspects of mesenchymal-epithelial interactions. Annu. Rev. Cell Biol. 9,511 -540.
Birchmeier, C., Meyer, D. and Riethmacher, D. (1995). Factors controlling growth, motility, and morphogenesis of normal and malignant epithelial cells. Int. Rev. Cytol. 160,221 -266.[Medline]
Bos, J. L. (1989). Ras oncogenes in human
cancer: a review. Cancer Res.
49,4682
-4689.
Boyer, B., Valles, A. M. and Edme, N. (2000). Induction and regulation of epithelial-mesenchymal transitions. Biochem. Pharmacol. 60,1091 -1099.[Medline]
Cano, A., Perez-Moreno, M. A., Rodrigo, I., Locascio, A., Blanco, M. J., del-Barrio, M.G., Portillo, F. and Nieto, M. A. (2000). The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nat. Cell. Biol. 2,76 -83.[Medline]
Clark, G. J. and Der, C. J. (1995). Aberrant function of the Ras signal transduction pathway in human breast cancer. Breast Cancer Res. Treat. 35,133 -144.[Medline]
Cui, W., Fowlis, D. J., Bryson, S., Duffie, E., Ireland, H., Balmain, A. and Akhurst, R. J. (1996). TGFbetal inhibits the formation of benign skin tumors, but enhances progression to invasive spindle carcinomas in transgenic mice. Cell 86,531 -542.[Medline]
Downward, J. (1998). Ras signaling and apoptosis. Curr. Opin. Genet. Dev. 8, 49-54.[Medline]
Eger, A., Stockinger, A., Schaffhauser, B., Beug, H. and Foisner, R. (2000). Epithelial mesenchymal transition by c-Fos estrogen receptor activation involves nuclear translocation of beta-catenin and upregulation of beta-catenin/lymphoid enhancer binding factor-1 transcriptional activity. J. Cell Biol. 148,173 -188.[Medline]
Endo, K. and Terada, T. (2000). Protein expression of CD44 (standard and variant isoforms) in hepatocellular carcinoma: relationships with tumor grade, clinicopathologic parameters, p53 expression, and patient survival. J. Hepatol. 32, 78-84.[Medline]
Factor, V. M., Kao, C. Y., Santoni-Rugiu, E., Woitach, J. T.,
Jensen, M. R. and Thorgeirsson, S. S. (1997). Constitutive
expression of mature transforming growth factor betal in the liver accelerates
hepatocarcinogenesis in transgenic mice. Cancer Res.
57,2089
-2095.
Fausto, N. and Webber, E. M. (1993). Control of liver growth. Crit. Rev. Eukaryot. Gene Expr. 3,1117 -1135.
Fausto, N. (2000). Liver regeneration. J. Hepatol. 32,19 -31.[Medline]
Gao, C., Gressner, G., Zoremba, M. and Gressner, A. M. (1996). Transforming growth factor beta (TGF-beta) expression in isolated and cultured rat hepatocytes. J. Cell. Physiol. 167,394 -405.[Medline]
Gotzmann, J., Eger, A., Meissner, M., Grimm, R., Gerner, C., Sauermann, G. and Foisner R. (1997). Two-dimensional electrophoresis reveals a nuclear matrix-associated nucleolin complex of basic isoelectric point. Electrophoresis 18,2645 -2653.[Medline]
Grasl-Kraupp, B., Rossmanith, W., Ruttkay-Nedecky, B., Mullauer, L., Kammerer, B., Bursch, W. and Schulte-Hermann, R. (1998). Levels of transforming growth factor beta and transforming growth factor beta receptors in rat liver during growth, regression by apoptosis and neoplasia. Hepatology 28,717 -726.[Medline]
Graziani, A., Gramaglia, D., dalla-Zonca, P. and Comoglio, P.
M. (1993). Hepatocyte growth factor/scatter factor stimulates
the Ras-guanine nucleotide exchanger. J. Biol. Chem.
268,9165
-9168.
Hanahan, D. and Weinberg, R. A. (2000). The hallmarks of cancer. Cell 100, 57-70.[Medline]
Hay, E. D. (1990). Epithelial-mesenchymal transitions. Semin. Dev. Biol. 1, 347-356.
Hirai, K., Shimada, H., Ogawa, T. and Taji, S. (1991). The spread of human lung cancer cells on collagens and its inhibition by type III collagen. Clin. Exp. Metastasis 9,517 -527.[Medline]
Hocevar, B. A., Brown, T. L. and Howe, P. H. (1999). TGF-beta induces fibronectin synthesis through a c-Jun N-terminal kinase-dependent, Smad4-independent pathway. EMBO J. 18,1345 -1356.[Medline]
Houck, K. A., Michalopoulos, G. K. and Strom, S. C. (1989). Introduction of a Ha-ras oncogene into rat liver epithelial cells and parenchymal hepatocytes confers resistance to the growth inhibitory effects of TGF-beta. Oncogene 4, 19-25.[Medline]
Huber, B. E. and Cordingley, M. G. (1988). Expression and phenotypic alterations caused by an inducible transforming ras oncogene introduced into rat liver epithelial cells. Oncogene 3,245 -256.[Medline]
Huggett, A. C., Ellis, P. A., Ford, C. P., Hampton, L. L.,
Rimoldi, D. and Thorgeirsson, S. S. (1991). Development of
resistance to the growth inhibitory effects of transforming growth factor beta
1 during the spontaneous transformation of rat liver epithelial cells.
Cancer Res. 51,5929
-5936.
Iglesias, M., Frontelo, P., Gamallo, C. and Quintanilla, M. (2000). Blockade of Smad4 in transformed keratinocytes containing a Ras oncogene leads to hyperactivation of the Ras-dependent Erk signalling pathway associated with progression to undifferentiated carcinomas. Oncogene 19,4134 -4145.[Medline]
Ito, N., Kawata, S., Tamura, S., Takaishi, K., Shirai, Y., Kiso,
S., Yabuuchi, I., Matsuda, Y., Nishioka, M. and Tarui, S.
(1991). Elevated levels of transforming growth factor beta
messenger RNA and its polypeptide in human hepatocellular carcinoma.
Cancer Res. 51,4080
-4083.
Jo, M., Stolz, D. B., Esplen, J. E., Dorko, K., Michalopoulos,
G. K. and Strom, S. C. (2000). Cross-talk between epidermal
growth factor receptor and c-Met signal pathways in transformed cells.
J. Biol. Chem. 275,8806
-8811.
Kikkawa, Y., Sanzen, N. and Sekiguchi, K.
(1998). Isolation and characterization of laminin-10/11 secreted
by human lung carcinoma cells. laminin-10/11 mediates cell adhesion through
integrin alpha3 beta1. J. Biol. Chem.
273,15854
-15859.
Li, J., Ning, G. and Duncan, S. A. (2000).
Mammalian hepatocyte differentiation requires the transcription factor
HNF-4alpha. Genes Dev.
14,464
-474.
Markowitz, S., Wang, J., Myeroff, L., Parsons, R., Sun, L.,
Lutterbaugh, J., Fan, R. S., Zborowska, E., Kinzler, K. W., Vogelstein, B.,
Brattain, M. and Wilson, J. K. V. (1995). Inactivation of the
type II TGF-beta receptor in colon cancer cells with microsatellite
instability. Science
268,1336
-1338.
Massague, J. (1990). The transforming growth factor-beta family. Annu. Rev. Cell. Biol. 6, 597-641.
Massague, J. and Chen, Y. G. (2000).
Controlling TGF-beta signaling. Genes Dev.
14,627
-644.
Matsumura, T., Makino, R. and Mitamura, K.
(2001). Frequent down-regulation of E-cadherin by genetic and
epigenetic changes in the malignant progression of hepatocellular carcinomas.
Clin. Cancer Res. 7,594
-599.
Matsuzaki, K., Date, M., Furukawa, F., Tahashi, Y., Matsushita,
M., Sakitani, K., Yamashiki, N., Seki, T., Saito, H., Nishizawa, M., Fujisawa,
J. and Inoue, K. (2000). Autocrine stimulatory mechanism by
transforming growth factor beta in human hepatocellular carcinoma.
Cancer Res. 60,1394
-1402.
McCormick, F. (1999). Signalling networks that cause cancer. Trends Cell. Biol. 9, M53-56.[Medline]
Michalopoulos, G. K. and DeFrances, M. C.
(1997). Liver regeneration. Science
276, 60-66.
Oberhammer, F., Bursch, W., Parzefall, W., Breit, P., Erber, E.,
Stadler, M. and Schulte-Hermann, R. (1991). Effect of
transforming growth factor beta on cell death of cultured rat hepatocytes.
Cancer Res. 51,2478
-2485.
Oberhammer, F. A., Pavelka, M., Sharma, S., Tiefenbacher, R.,
Purchio, A. F., Bursch, W. and Schulte-Hermann, R. (1992).
Induction of apoptosis in cultured hepatocytes and in regressing liver by
transforming growth factor beta 1. Proc. Natl. Acad. Sci.
USA 89,5408
-5412.
Oft, M., Peli, J., Rudaz, C., Schwarz, H., Beug, H. and
Reichmann, E. (1996). TGF-beta1 and Ha-Ras collaborate in
modulating the phenotypic plasticity and invasiveness of epithelial tumor
cells. Genes Dev. 10,2462
-2477.
Oft, M., Heider, K. H. and Beug, H. (1998). TGFbeta signaling is necessary for carcinoma cell invasiveness and metastasis. Curr. Biol. 8,1243 -1252.[Medline]
Osada, T., Sakamoto, M., Ino, Y., Iwamatsu, A., Matsuno, Y., Muto, T. and Hirohashi, S. (1996). E-cadherin is involved in the intrahepatic metastasis of hepatocellular carcinoma. Hepatology 24,1460 -1467.[Medline]
Park, B. J., Park, J. I., Byun, D. S., Park, J. H. and Chi, S.
G. (2000). Mitogenic conversion of transforming growth
factor-beta1 effect by oncogenic Ha-Ras-induced activation of the
mitogen-activated protein kinase signaling pathway in human prostate cancer.
Cancer Res. 60,3031
-3038.
Parrish, E. P., Steart, P. V., Garrod, D. R. and Weller, R. O. (1987). Antidesmosomal monoclonal antibody in the diagnosis of intracranial tumours. J. Pathol. 153,265 -273.[Medline]
Parzefall, W., Galle, P. R. and Schulte-Hermann, R. (1985). Effect of calf and rat serum on the induction of DNA synthesis and mitosis in primary cultures of adult rat hepatocytes by cyproterone acetate and epidermal growth factor. In Vitro Cell. Dev. Biol. 21,665 -673.[Medline]
Piek, E., Moustakas, A., Kurisaki, A., Heldin, C.-H. and tenDijke, P. (1999). TGF-ß type I receptor/ALK-5 and Smad proteins mediate epithelial to mesenchymal transdifferentiation in NMuMG breast epithelial cells. J. Cell Sci. 112,4557 -4568.[Abstract]
Portella, G., Cumming, S. A., Liddell, J., Cui, W., Ireland, H., Akhurst, R. J. and Balmain, A. (1998). Transforming growth factor beta is essential for spindle cell conversion of mouse skin carcinoma in vivo: implications for tumor invasion. Cell Growth Differ. 9,393 -404.[Abstract]
Redmond, S. M., Reichmann, E., Muller, R. G., Friis, R. R., Groner, B. and Hynes, N. E. (1988). The transformation of primary and established mouse mammary epithelial cells by p21-ras is concentration dependent. Oncogene 2, 259-265.[Medline]
Reynisdottir, I., Polyak, K., Iavarone, A. and Massague, J.
(1995). Kip/Cip and Ink4 Cdk inhibitors cooperate to induce cell
cycle arrest in response to TGF-beta. Genes Dev.
9,1831
-1845.
Reynolds, S. H., Stowers, S. J., Maronpot, R. R., Anderson, M.
W. and Aaronson, S. A. (1986). Detection and identification
of activated oncogenes in spontaneously occurring benign and malignant
hepatocellular tumors of the B6C3F1 mouse. Proc. Natl. Acad. Sci.
USA 83,33
-37.
Reynolds, S. H., Stowers, S. J., Patterson, R. M., Maronpot, R.
R., Aaronson, S. A. and Anderson, M. W. (1987). Activated
oncogenes in B6C3F1 mouse liver tumors: implications for risk assessment.
Science 237,1309
-1316.
Rommel, C. and Hafen, E. (1998). Ras a versatile cellular switch. Curr. Opin. Genet. Dev. 8, 412-418.[Medline]
Rossmanith, W. and Schulte-Hermann, R. (2001). Biology of transforming growth factor ß in hepatocarcinogenesis. Microscopy Res. Technique 52,430 -436.
Saitoh, A., Kimura, M., Takahashi, R., Yokoyama, M., Nomura, T., Izawa, M., Sekiya, T., Nishimura, S. and Katsuki, M. (1990). Most tumors in transgenic mice with human c-Ha-ras gene contained somatically activated transgenes. Oncogene 5,1195 -1200.[Medline]
Sandgren, E. P., Quaife, C. J., Pinkert, C. A., Palmiter, R. D. and Brinster, R. L. (1989). Oncogene-induced liver neoplasia in transgenic mice. Oncogene 4, 715-724.[Medline]
Schmitz, A. A., Govek, E. E., Bottner, B. and Van Aelst, L. (2000). Rho GTPases: signaling, migration, and invasion. Exp. Cell Res. 261,1 -12.[Medline]
Shields, J. M., Pruitt, K., McFall, A., Shaub, A. and Der, C. J. (2000). Understanding Ras: `it ain't over `til it's over'. Trends Cell Biol. 10,147 -154.[Medline]
Shirai, Y., Kawata, S., Tamura, S., Ito, N., Tsushima, H., Takaishi, K., Kiso, S. and Matsuzawa, Y. (1994). Plasma transforming growth factor-beta 1 in patients with hepatocellular carcinoma. Comparison with chronic liver diseases. Cancer 73,2275 -2279.[Medline]
Slagle, B. L., Zhou, Y. Z., Birchmeier, W. and Scorsone, K. A. (1993). Deletion of the E-cadherin gene in hepatitis B virus-positive Chinese hepatocellular carcinomas. Hepatology 18,757 -762.[Medline]
Somasiri, A., Howarth, A., Goswami, D., Dedhar, S. and Roskelley C.D. (2000). Overexpression of the integrin-linked kinase mesenchymally transforms mammary epithelial cells. J. Cell Sci. 114,1125 -1136.[Abstract]
Spagnoli, F. M., Amicone, L., Tripodi, M. and Weiss, M. C.
(1998). Identification of a bipotential precursor cell in hepatic
cell lines derived from transgenic mice expressing cyto-Met in the liver.
J. Cell Biol. 143,1101
-1112.
Spagnoli, F. M., Cicchini, C., Tripodi, M. and Weiss, M. C. (2000). Inhibition of MMH (Met murine hepatocyte) cell differentiation by TGFbeta is abrogated by pre-treatment with the heritable differentiation effector FGF-1. J. Cell. Sci. 113,3639 -3647.[Abstract]
Strom, S. C. and Faust, J. B. (1990). Oncogene activation and hepatocarcinogenesis. Pathobiology 58,153 -167.[Medline]
Ten-Dijke, P., Miyazono, K. and Heldin, C. H. (2000). Signaling inputs converge on nuclear effectors in TGF-beta signaling. Trends Biochem. Sci. 25, 64-70.[Medline]
Terris, B., Pineau, P., Bregeaud, L., Valla, D., Belghiti, J., Tiollais, P., Degott, C. and Dejean, A. (1999). Close correlation between beta-catenin gene alterations and nuclear accumulation of the protein in human hepatocellular carcinomas. Oncogene 18,6583 -6588.[Medline]
Thiery, J. P. and Chopin, D. (1999). Epithelial cell plasticity in development and tumor progression. Cancer Metastasis Rev. 18,31 -42.[Medline]
Zhao, M. and Zimmermann, A. (1998). Liver cell dysplasia: reactivities for c-met protein, Rb protein, E-cadherin and transforming growth factor-beta 1 in comparison with hepatocellular carcinoma. Histol. Histopathol. 13,657 -670.[Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
R. Massoumi, S. Kuphal, C. Hellerbrand, B. Haas, P. Wild, T. Spruss, A. Pfeifer, R. Fassler, and A. K. Bosserhoff Down-regulation of CYLD expression by Snail promotes tumor progression in malignant melanoma J. Exp. Med., January 16, 2009; 206(1): 221 - 232. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Wheelock, Y. Shintani, M. Maeda, Y. Fukumoto, and K. R. Johnson Cadherin switching J. Cell Sci., March 15, 2008; 121(6): 727 - 735. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. L. Andarawewa, A. C. Erickson, W. S. Chou, S. V. Costes, P. Gascard, J. D. Mott, M. J. Bissell, and M. H. Barcellos-Hoff Ionizing Radiation Predisposes Nonmalignant Human Mammary Epithelial Cells to Undergo Transforming Growth Factor {beta} Induced Epithelial to Mesenchymal Transition Cancer Res., September 15, 2007; 67(18): 8662 - 8670. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Shirakihara, M. Saitoh, and K. Miyazono Differential Regulation of Epithelial and Mesenchymal Markers by {delta}EF1 Proteins in Epithelial Mesenchymal Transition Induced by TGF-beta Mol. Biol. Cell, September 1, 2007; 18(9): 3533 - 3544. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Gu, L. F. Zerbini, H. H. Otu, M. Bhasin, Q. Yang, M. G. Joseph, F. Grall, T. Onatunde, R. G. Correa, and T. A. Libermann Reduced PDEF Expression Increases Invasion and Expression of Mesenchymal Genes in Prostate Cancer Cells Cancer Res., May 1, 2007; 67(9): 4219 - 4226. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Petz, D. Kozina, H. Huber, T. Siwiec, J. Seipelt, W. Sommergruber, and W. Mikulits The leader region of Laminin B1 mRNA confers cap-independent translation Nucleic Acids Res., April 3, 2007; 35(8): 2473 - 2482. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Wang, I. Shin, F. Y. Wu, D. B. Friedman, and C. L. Arteaga HER2/Neu (ErbB2) Signaling to Rac1-Pak1 Is Temporally and Spatially Modulated by Transforming Growth Factor {beta} Cancer Res., October 1, 2006; 66(19): 9591 - 9600. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Biswas, T. L. Criswell, S. E. Wang, and C. L. Arteaga Inhibition of Transforming Growth Factor-{beta} Signaling in Human Cancer: Targeting a Tumor Suppressor Network as a Therapeutic Strategy. Clin. Cancer Res., July 15, 2006; 12(14): 4142 - 4146. [Full Text] [PDF] |
||||
![]() |
J. Castillo, E. Erroba, M. J. Perugorria, M. Santamaria, D. C. Lee, J. Prieto, M. A. Avila, and C. Berasain Amphiregulin contributes to the transformed phenotype of human hepatocellular carcinoma cells. Cancer Res., June 15, 2006; 66(12): 6129 - 6138. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Brachner, S. Sasgary, C. Pirker, C. Rodgarkia, M. Mikula, W. Mikulits, H. Bergmeister, U. Setinek, M. Wieser, S.-F. Chin, et al. Telomerase- and Alternative Telomere Lengthening-Independent Telomere Stabilization in a Metastasis-Derived Human Non-Small Cell Lung Cancer Cell Line: Effect of Ectopic hTERT. Cancer Res., April 1, 2006; 66(7): 3584 - 3592. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Peiro, M. Escriva, I. Puig, M. J. Barbera, N. Dave, N. Herranz, M. J. Larriba, M. Takkunen, C. Franci, A. Munoz, et al. Snail1 transcriptional repressor binds to its own promoter and controls its expression. Nucleic Acids Res., January 1, 2006; 34(7): 2077 - 2084. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Y. Irie, R. V. Pearline, D. Grueneberg, M. Hsia, P. Ravichandran, N. Kothari, S. Natesan, and J. S. Brugge Distinct roles of Akt1 and Akt2 in regulating cell migration and epithelial-mesenchymal transition J. Cell Biol., December 19, 2005; 171(6): 1023 - 1034. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Brachner, S. Reipert, R. Foisner, and J. Gotzmann LEM2 is a novel MAN1-related inner nuclear membrane protein associated with A-type lamins J. Cell Sci., December 15, 2005; 118(24): 5797 - 5810. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. De Craene, B. Gilbert, C. Stove, E. Bruyneel, F. van Roy, and G. Berx The Transcription Factor Snail Induces Tumor Cell Invasion through Modulation of the Epithelial Cell Differentiation Program Cancer Res., July 15, 2005; 65(14): 6237 - 6244. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Barrallo-Gimeno and M. A. Nieto The Snail genes as inducers of cell movement and survival: implications in development and cancer Development, July 15, 2005; 132(14): 3151 - 3161. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. N.M. Fischer, B. Herrera, M. Mikula, V. Proell, E. Fuchs, J. Gotzmann, R. Schulte-Hermann, H. Beug, and W. Mikulits Integration of Ras subeffector signaling in TGF-{beta} mediated late stage hepatocarcinogenesis Carcinogenesis, May 1, 2005; 26(5): 931 - 942. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Y. Yi, I. Shin, and C. L. Arteaga Type I Transforming Growth Factor {beta} Receptor Binds to and Activates Phosphatidylinositol 3-Kinase J. Biol. Chem., March 18, 2005; 280(11): 10870 - 10876. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Maeda, K. R. Johnson, and M. J. Wheelock Cadherin switching: essential for behavioral but not morphological changes during an epithelium-to-mesenchyme transition J. Cell Sci., March 1, 2005; 118(5): 873 - 887. [Abstract] [Full Text] [PDF] |
||||
![]() |
S.S. Prime, M. Davies, M. Pring, and I.C. Paterson THE ROLE OF TGF-{beta} IN EPITHELIAL MALIGNANCY AND ITS RELEVANCE TO THE PATHOGENESIS OF ORAL CANCER (PART II) Critical Reviews in Oral Biology & Medicine, November 1, 2004; 15(6): 337 - 347. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Vega, A. V. Morales, O. H. Ocana, F. Valdes, I. Fabregat, and M. A. Nieto Snail blocks the cell cycle and confers resistance to cell death Genes & Dev., May 15, 2004; 18(10): 1131 - 1143. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Seton-Rogers, Y. Lu, L. M. Hines, M. Koundinya, J. LaBaer, S. K. Muthuswamy, and J. S. Brugge Cooperation of the ErbB2 receptor and transforming growth factor {beta} in induction of migration and invasion in mammary epithelial cells PNAS, February 3, 2004; 101(5): 1257 - 1262. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Saika, Y. Okada, T. Miyamoto, O. Yamanaka, Y. Ohnishi, A. Ooshima, C.-Y. Liu, D. Weng, and W. W.-Y. Kao Role of p38 MAP Kinase in Regulation of Cell Migration and Proliferation in Healing Corneal Epithelium Invest. Ophthalmol. Vis. Sci., January 1, 2004; 45(1): 100 - 109. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Peinado, M. Quintanilla, and A. Cano Transforming Growth Factor {beta}-1 Induces Snail Transcription Factor in Epithelial Cell Lines: MECHANISMS FOR EPITHELIAL MESENCHYMAL TRANSITIONS J. Biol. Chem., May 30, 2003; 278(23): 21113 - 21123. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Mareel and A. Leroy Clinical, Cellular, and Molecular Aspects of Cancer Invasion Physiol Rev, April 1, 2003; 83(2): 337 - 376. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Valdes, A. M. Alvarez, A. Locascio, S. Vega, B. Herrera, M. Fernandez, M. Benito, M. A. Nieto, and I. Fabregat The Epithelial Mesenchymal Transition Confers Resistance to the Apoptotic Effects of Transforming Growth Factor {beta} in Fetal Rat Hepatocytes Mol. Cancer Res., November 1, 2002; 1(1): 68 - 78. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Rosivatz, I. Becker, K. Specht, E. Fricke, B. Luber, R. Busch, H. Hofler, and K.-F. Becker Differential Expression of the Epithelial-Mesenchymal Transition Regulators Snail, SIP1, and Twist in Gastric Cancer Am. J. Pathol., November 1, 2002; 161(5): 1881 - 1891. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||