spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cerezo, A.
Right arrow Articles by Boukamp, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cerezo, A.
Right arrow Articles by Boukamp, P.
Journal of Cell Science 115, 1305-1312 (2002)
© 2002 The Company of Biologists Limited


Research Article

Dual regulation of telomerase activity through c-Myc-dependent inhibition and alternative splicing of hTERT

Ana Cerezo1, Holger Kalthoff2, Markus Schuermann3, Birgit Schäfer4 and Petra Boukamp1,*

1 Deutsches Krebsforschungszentrum, Division of Skin Carcinogenesis, Im Neuenheimer Feld 280, D-69120 Heidelberg, Germany
2 Klinik für Allg. Chirurgie und Thoraxchirurgie, Molecular Oncology, University of Kiel, D-24105 Kiel, Germany
3 University of Marburg, Department of Haematology and Oncology, Baldinger Str. D-35033 Marburg, Germany
4 University of Heidelberg, Department of Immunology, Im Neuenheimer Feld 305, D-69120 Heidelberg, Germany

* Author for correspondence (e-mail: P.Boukamp{at}DKFZ-Heidelberg.de )

Accepted 17 December 2001


    Summary
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Telomerase is believed to be induced upon proliferation and inhibited when cells differentiate. Thus, regulation of telomerase activity could be an important mechanism to limit growth of normal and cancer cells. Using transforming growth factor-beta 1 (TGF-ß1), which is known to control proliferation in epithelial cells, we now demonstrate that in the human HaCaT skin keratinocytes, TGF-ß1 downregulated c-Myc, and this blocked proliferation. This also caused a decrease in hTERT expression, which in turn inhibited telomerase activity. Overexpressing hTERT recovered telomerase activity but not proliferation, whereas constitutive expression of c-Myc recovered proliferation and hTERT expression. Nevertheless, telomerase remained inhibited, thus dissociating proliferation and telomerase activity. In addition, we show that TGF-ß1 inhibited telomerase activity despite ongoing hTERT transcription by inducing loss of the full-length hTERT transcript (mediating telomerase activity) and retaining high expression of the inactive ß variant. These changes in the splicing pattern reversed upon TGF-ß1 removal, as did inhibition of telomerase activity, suggesting that alternative splicing may represent a novel mechanism of telomerase regulation by TGF-ß1. In addition, we show that destruction of tissue integrity (in a model for epidermal blistering) resulted in a rapid induction of the inactive ß variant, whereas tissue regeneration (formation of a stratified epithelium) correlated with a shift to the active full-length transcript, which is the dominant form in intact epidermis. Thus alternative splicing may not be restricted to TGF-ß1 but may add a more general mechanism of hTERT regulation in epidermal cells.

Key words: HaCaT, Proliferation, Transcription, Splice variants, Growth factor


    Introduction
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Telomerase is a ribonucleoprotein complex that is able to counteract loss of telomeric sequences and therefore adds to chromosomal stability. The human telomerase complex includes an RNA component, hTR, which is able to attach to telomeric DNA and acts as template for the telomeric repeat synthesis (Feng et al., 1995Go), the catalytic subunit, hTERT, which provides enzymatic activity (Nakamura et al., 1997Go) and a number of associated proteins (Beattie et al., 2001Go). Active telomerase is found in about 80% of all tumor cells (Kim et al., 1994Go), in all tissues during early development (Wright et al., 1996Go) and in the adult body in tissues that continuously or periodically proliferate, such as the hematopoietic system or the epidermis (Counter et al., 1995Go; Harle-Bachor and Boukamp, 1996Go). Thus, telomerase activity is closely correlated with proliferation and is believed to be required for the unlimited growth potential of tumor cells (Greider, 1998Go).

Although tumor and immortal cells generally exhibit an unrestricted life span, proliferation can still be tightly controlled. One potent modulator is transforming growth factor-beta 1 (TGF-ß1) (Hartsough and Mulder, 1997Go). TGF-ß1 belongs to a family of growth factors that regulate cell growth, morphogenesis and apoptosis, and is proven to play an important role in several processes, such as embryogenic development (Capdevila and Belmonte, 1999Go), wound healing (Ashcroft and Roberts, 2000Go) and cancer (Gold, 1999Go). TGF-ß1 is a growth factor with a broad spectrum of actions and mediates a wide range of cellular responses in different cell types. In normal epithelial cells, TGF-ß1 causes growth arrest, whereas many tumors are refractory to this inhibition (Hartsough and Mulder, 1997Go). It is believed that progressive loss of TGF-ß1 response provides a selective growth advantage to tumor cells, and thus, TGF-ß1 insensitivity is an important step in carcinogenesis (Gold, 1999Go).

Part of the TGF-ß1 pathway is now well understood (Heldin et al., 1997Go; Derynck et al., 1998Go; Masague and Wotton, 2000). TGF-ß1 initiates signaling by binding to specific Ser/Thrkinase receptors which, in turn, phosphorylate members of the Smad family. Phosphorylated Smad2 and Smad3 assemble with Smad4 and translocate from the cytoplasm into the nucleus where they regulate transcription of effector genes by either directly binding to DNA or by binding to other transcription factors. One important effector is the protooncogene c-myc, which regulates cell cycle progression at different levels (Mateyak et al., 1999Go). TGF-ß1 has been shown to rapidly inhibit c-myc transcription in mouse keratinocytes, and this inhibition caused cell cycle arrest (Pietenpol et al., 1990Go). c-Myc has also been described as directly regulating expression of the hTERT gene (Oh et al., 1999Go; Wu et al., 1999Go), and it was suggested that c-Myc, in cooperation with the transcription factor Sp1, was the major determinant of hTERT expression (Kyo et al., 2000Go). Since both c-Myc and telomerase are expressed and active in the proliferating cells of the basal layer of the epidermis and are downregulated with differentiation, we reasoned that TGF-ß1 could be a link in the causal relationship between proliferation and telomerase activity. As a model system, we used the human HaCaT skin keratinocyte line, which, despite being immortal, still responds normally to TGF-ß1-mediated growth inhibition (Boukamp et al., 1988Go; Game et al., 1992Go). In this experimental system we now show that TGF-ß1 is able to regulate proliferation and telomerase activity independently, and we further demonstrate that TGF-ß1 can inhibit telomerase activity despite ongoing hTERT transcription by shifting expression from the active to the inactive splice variants. We further provide evidence that this alternative splicing is not restricted to TGF-ß1 but may be a more general mechanism of hTERT regulation.


    Materials and Methods
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Cell culture and transfection
HaCaT cells were routinely cultured as previously described (Boukamp et al., 1988Go). c-myc transfectants were maintained in the presence of 400 µg/ml G-418 (PAA). TGF-ß1 (R&D Systems) was added to the cultures in the presence of 10% FCS at a concentration of 5 ng/ml for the indicated time periods. Dispase treatment was performed as described (Schaefer et al., 2000Go). HaCaT-myc cells were generated by Ca2+-phosphate-mediated transfection of the pMSc-myc construct containing the resistance marker geneticin (Schuermann, 1990Go). The hTERT construct (Kilian et al., 1997Go), kindly provided by R. Reddel, was inserted into the rkat vector 43.261 additionally containing GFP (green fluorescence protein) and introduced into HaCaT cells by retroviral infection as described (Howard et al., 2000Go). The HaCaT-TERT cells were derived from a mass culture that was additionally selected for 100% GFP-positive cells by FACS analysis.

Organotypic cocultures of HaCaT cells
Organotypic cocultures of HaCaT cells were prepared following the method by Schoop et al. (Schoop et al., 1999Go). After the appropriate time periods (1 or 3 weeks), cultures were either selected for histology or for RNA extraction. Histology was performed following standard protocols. For RNA extraction the epithelium was carefully separated from the collagen substrate and further processed as for cell pellets.

Western blot analysis
Cell pellets were lysed in RIPA buffer, and the protein concentrations were determined (Bradford: Bio-Rad). 30 µg of total protein were separated by SDS-PAGE and transferred to nitrocellulose membrane (Schleicher & Schuell). Membranes were pre-blocked in 10% nonfat milk/phosphate-buffered-saline (PBS) for 2-12 hours, probed with the appropriate primary- (anti-c-Myc: C-33 (Santa Cruz Biotechnology); anti-phospho-Smad2, (kindly provided by C. H. Heldin)) and horseradish-peroxidase-coupled secondary antibody (Dianova) diluted in 10% milk/PBS/0.1% Tween 20 for 60 minutes. Enhanced chemiluminiscence detection was performed (Amersham-Pharmacia Biotech). Densitometric analysis was assessed with TINA 2.0 software (raytest Isotopenmeßgeräte GmbH).

Proliferation analysis
2x103 cells were seeded in 96-well plates. Where required, TGF-ß1 was added after 24 hours. 5-bromo-2'-deoxyuridine (BrdU) was added 2 hours before performing the BrdU ELISA test (Roche). Total OD values are expressed as a percentage of control (untreated) cells.

Telomerase assays
Cell lysis and telomerase assays were performed using the TRAPeze kit (Intergen). 50 ng of total protein extract were used for each assay, each with or without RNase-inactivation (RNase, DNase-free, Roche). Products were separated in non-denaturing 10% polyacrylamide gels, visualized by autoradiography and PhosphoImager scanning (Fujifilm Bas-1500) and quantified with TINA 2.0 software.

RT-PCR analysis
Total RNA was isolated from cell pellets or epithelia from organotypic cocultures using RNeasy (QIAGEN). 1 µg of total RNA was used to generate a cDNA from each sample (Omniscript, QIAGEN) in a final volume of 20 µl. 4 µl of this solution was amplified in a 25 µl mixture containing 0.2 mM dNTPs (Roche), 2.5 units Taq (Roche) and 0.2 µM of each primer. Overall hTERT expression was detected using primers TERT-1784S and TERT-1928A (Ulaner et al., 1998Go), with an initial heating at 94°C for 2 minutes, followed by 35 cycles of 94°C for 45 seconds, 60°C for 45 seconds, 72°C for 90 seconds and a final extension at 72°C for 10 minutes. Alternative splice variants were detected with primers TERT-HT2026F and TERT-HT2482R (Kilian et al., 1997Go) by 35 cycles (if not stated differently) of 94°C for 15 seconds, 60°C for 15 seconds and 72°C for 30 seconds, and GAPDH was amplified as the internal control by 23 cycles of 94°C for 30 seconds, 60°C for 30 seconds and 72°C for 60 seconds with GAPDH-sense (GAGAAGGCTGGGGCTCATTT) and -antisense (CAGTGGGGACACGGAAGG) primers. PCR products were subjected to electrophoresis in 2% agarose (FMC Bioproducts) gels and were visualized with ethidium bromide (SIGMA). For each primer set the number of amplification cycles was pre-determined in order to be in the exponential phase. To provide a high degree of standardization, all experiments including HaCaT and HaCaT-myc cells were performed simultaneously, using the same reaction mix, and GAPDH was co-amplified to confirm equal amounts of starting cDNA.


    Results
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
TGF-ß1 regulates proliferation and telomerase activity by independent mechanisms
In order to establish how TGF-ß1 acts on proliferation and telomerase activity in the HaCaT keratinocytes, the cells were maintained under optimal growth conditions (culture medium containing 10% FCS) and treated with 5 ng/ml TGF-ß1. Activation of the Smad pathway was assessed with a phosphorylation-specific antibody against Smad2. Smad2 was quickly phosphorylated after TGF-ß1 treatment, with a maximum activity already seen after 15 minutes, and phosphorylation was maintained for the entire observation period of 4 days (Fig. 1a). One important effector of TGF-ß1 is c-myc. In agreement with previous studies (Pietenpol et al., 1990Go), the level of c-Myc protein was already reduced after 6 hours. This reduction in c-Myc correlated with strong and continuous inhibition of proliferation, as measured by BrdU incorporation. Concomitantly, telomerase activity was reduced after 48 hours and hardly detectable by 96 hours.



View larger version (59K):
[in this window]
[in a new window]
 
Fig. 1. Effect of TGF-ß1 signaling on proliferation and telomerase activity in either untransfected HaCaT cells (a), hTERT- (HaCaT-TERT) (b) or c-Myc (HaCaT-myc) transfectants (c). Upper panels: Western blot showing phosphorylation of Smad2 and expression of c-Myc after TGF-ß1 treatment. Middle panels: BrdU incorporation assay. Untreated cells are taken as 100%. Lower panel: TGF-ß1 downregulation of telomerase activity in HaCaT and HaCaT-myc cells and telomerase maintenance in HaCaT-TERT cells. Telomerase activity was measured by conventional TRAP assay. From each sample an RNase-inactivated negative control was assayed in parallel. IC, internal control.

 

To determine a causal link between proliferation and telomerase activity, we aimed to interfere with this co-regulation by generating HaCaT cells that either expressed hTERT (HaCaT-TERT cells) or c-Myc (HaCaT-myc cells) under the control of a constitutive promoter, that is, a promoter that should be insensitive to regulation by TGF-ß1 or endogenous regulatory pathways. When treated with TGF-ß1, both cell types showed normal Smad2 phosphorylation (Fig. 1b,c), thereby demonstrating unaltered activation of the TGF-ß1/Smad pathway. As expected, in HaCaT-TERT cells telomerase activity was not altered. The same high activity was detected throughout the 96 hours observation period. The Myc level, on the other hand, was reduced. Unlike in the parental cells, however, we did only detect a ~50% inhibition. Since it had a recently been shown that hTERT-immortalized cells also upregulated c-Myc (Wang et al., 2000Go), it remains to be investigated whether in addition to the known positive regulation of c-Myc on hTERT expression (Wang et al., 1998Go; Oh et al., 1999Go; Wu et al., 1999Go; Kyo et al., 2000Go) overexpression of hTERT can in turn affect c-Myc (feed-back loop). In agreement with this partial inhibition of c-Myc, proliferation was also less strongly affected. The BrdU-labeling index decreased to <50% as compared with ~ 25% in the parental cells. In HaCaT-myc cells, c-Myc remained expressed during TGF-ß1 treatment and also proliferation remained high. However, telomerase activity decreased after 72 hours (Fig. 1c). Since in HaCaT-TERT cells proliferation was inhibited despite high telomerase activity and, conversely, in HaCaT-myc cells proliferation continued despite inhibition of telomerase activity, these studies established that both traits were not causally linked and that TGF-ß1 was able to regulate both individually.

c-Myc activates hTERT transcription without restoring telomerase activity
It was recently shown that c-Myc is a positive regulator of hTERT (Wang et al., 1998Go; Oh et al., 1999Go; Wu et al., 1999Go; Kyo et al., 2000Go). Nevertheless, the above data showed that despite high levels of c-Myc, telomerase activity was reduced. In order to unravel this discrepancy, we analyzed hTERT expression in HaCaT and HaCaT-myc cells during TGF-ß1 treatment by RT-PCR, using primers that were designed to detect overall hTERT transcription (Ulaner et al., 1998Go). The level of hTERT mRNA was decreased in HaCaT cells after 6 hours, and expression remained low throughout the experiment. In HaCaT-myc cells, on the other hand, hTERT expression was not altered. The same level was expressed throughout (Fig. 2a). Thus, when c-Myc remained unaffected by TGF-ß1, hTERT also remained expressed. Since it had been shown previously that Myc-Max complexes can directly bind to E-box elements in the hTERT promoter and activate hTERT transcription (Oh et al., 1999Go; Wu et al., 1999Go), our results suggest that, similar to results in other cell types, in HaCaT cells the endogenous hTERT gene seemed to be positively regulated by c-Myc.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 2. Effect of TGF-ß1 treatment on hTERT expression. (a) hTERT transcription in HaCaT (upper gel) and HaCaT-myc cells (lower gel) after TGF-ß1 treatment. hTERT total mRNA expression was measured by RT-PCR using primers 1784S and 1928A (Ulaner et al., 1998Go). (b) hTERT splicing after TGF-ß1 treatment. RT-PCR was carried out with primers TERT-HT2026F and TERT-HT2482R (Kilian et al., 1997Go). fl, full length; {alpha}, {alpha} splice; ß, ß splice. (c) hTERT expression in HaCaT-TERT cells: RT-PCR as in (b), but to remain in the exponential phase only 30 cycles of amplification were performed. The endogenous {alpha} and ß splice variants are not detectable owing to high expression of the exogenous hTERT transcript. Untransfected HaCaT cells (control and treated with TGF-ß1 for 96 hours) were amplified under the same conditions and included for comparison of the expression level of the endogenous with the exogenous gene and as control for the TGF-ß1 activity.

 

TGF-ß1 regulates hTERT alternative splicing
Since telomerase activity was not affected by TGF-ß1 in HaCaT-TERT cells, a direct inhibition of the telomerase complex could be excluded. Furthermore, telomerase is a very stable complex, with a half life >24 hours (Holt et al., 1996Go). The delay of 48 hours seen for telomerase inhibition in HaCaT and HaCaT-myc cells also argued for transcriptional regulation. It was recently described that hTERT is characterized by different transcripts generated through alternative splicing (Kilian et al., 1997Go). We, therefore, asked whether modulation of the hTERT splicing pattern might be a potential mechanism of telomerase inhibition in the HaCaT-myc cells.

To test this, we reinvestigated expression of hTERT in HaCaT and HaCaT-myc cells during TGF-ß1 treatment by using a set of primers that recognize four possible hTERT splice variants (Kilian et al., 1997Go); full-length, {alpha}, ß and {alpha}+ß transcripts. Under standard conditions, the full-length (fl), {alpha} and the ß splice variants were detected in HaCaT cells, whereas the {alpha} variant was generally absent (Fig. 2b). Upon TGF-ß1 treatment, expression of all transcripts was reduced within 48 hours and hardly detectable after 72 hours. In the untreated HaCaT-myc cells, the overall expression level seemed slightly increased, giving rise to an about equal expression level of the full length and {alpha} splice variants and a slightly increased level of the ß splice form (Fig. 2b). During treatment with TGF-ß1, however, we only observed a reduction in the expression of the longer transcripts (full-length and {alpha} variant). Expression of the ß splice variant remained high throughout the experiment.

These data demonstrated that only when c-Myc was present did hTERT remain expressed. In addition, however, they also showed that TGF-ß1 was able to interfere with hTERT expression by causing loss of full length and {alpha} splice transcripts and maintaining expression of the ß variant. The reason for such an altered pattern could be twofold. First, TGF-ß1 might cause rapid degradation of hTERT transcripts, and c-Myc would specifically stabilize the smaller ß variant. Alternatively, TGF-ß1 may affect alternative splicing in favor of the smaller and, in the case of hTERT, the inactive transcripts.

To address this, we studied hTERT expression in the TGF-ß1-treated HaCaT-TERT cells, which, owing to the lack of splice sites in the exogenous cDNA, overexpress full-length hTERT transcripts (Fig. 2c). The endogenous splice forms were expressed at too lower level to be detectable under the same conditions. If TGF-ß1 was able to induce degradation of hTERT transcripts, this should account for the full-length transcripts of the HaCaT-TERT cells as well. As shown in Fig. 2c, expression of these transcripts remained unaltered during TGF-ß1 treatment. Furthermore, since the HaCaT-TERT cells remained telomerase positive in the presence of TGF-ß1, the data further confirmed that only expression of the full-length hTERT transcript was causal for telomerase activity.

TGF-ß1 regulation of hTERT splicing is reversible and correlates with telomerase activity
It is well known that the action of TGF-ß1 is reversible, thus telomerase regulation by TGF-ß1 through alternative splicing of hTERT should also be reversible. To test this, HaCaT-myc cells were treated with TGF-ß1 for 96 hours, TGF-ß1 was removed, and the cells were grown in the absence of TGF-ß1 for another 96 hours. As expected, after 96 hours of TGF-ß1 treatment the full-length transcript was hardly detectable and also the level of the {alpha}-splice variant was reduced. Only expression of the ß splice variant was high (Fig. 3a). This correlated with a strong inhibition of telomerase activity (Fig. 3b). Within 96 hours of TGF-ß1 removal, the full-length hTERT transcript was re-expressed at about equal levels to the ß splice variant (Fig. 3a). Although transcription was not fully restored by 96 hours, reactivation of the full-length hTERT closely correlated with an increase in telomerase activity (Fig. 3b). These data established that TGF-ß1 was able to induce a shift in the hTERT splicing pattern that caused inhibition of telomerase activity and that this regulation pathway was reversible.



View larger version (40K):
[in this window]
[in a new window]
 
Fig. 3. Splicing modulation by TGF-ß1 is reversible. (a) hTERT alternative splicing in HaCaT-myc cells after 96 hours of TGF-ß1 treatment and after additional growth for 96 hours without TGF-ß1. fl, full length; {alpha}, {alpha} splice; ß, ß splice. (b) TRAP assay of parallel cultures. IC, internal control.

 

Alternative splicing is a more general mechanism for hTERT regulation in epidermal cells
In vivo, TGF-ß1 is involved in processes such as wound healing, which are characterized by tissue destruction and reconstruction and which, in addition to inhibition of proliferation and differentiation, are likely to also require inhibition of hTERT expression. We thus determined whether modulation of hTERT splicing may also be a relevant regulatory mechanism in two different in vitro growth processes that largely reflect tissue destruction and reconstruction.

First, HaCaT cells were allowed to grow as dense monolayers, and the intact sheets were detached from the substrate by dispase treatment — a situation resembling epidermal blistering (Schaefer et al., 2000Go). This treatment does not cause irreversible growth defects, which had previously been indicated by the fact that comparable sheets of normal keratinocytes are routinely used as transplants for burnt patients (Compton et al., 1989Go). When analyzing hTERT splicing in such HaCaT sheets, we observed a steady increase in hTERT mRNA within 8 hours of detachment. Most notably, a major increase was detected for the ß splice variant, whereas the {alpha} and full-length transcripts remained low (Fig. 4). Thus, disturbance of tissue integrity in the parental HaCaT cells included modulation of the hTERT splicing pattern, and this resulted in a shift from an about equal expression of full-length, {alpha} and ß variants to predominant expression of the ß splice form.



View larger version (28K):
[in this window]
[in a new window]
 
Fig. 4. hTERT splicing regulation in dispase-detached HaCaT cells. RT-PCR for hTERT alternative splicing. Increase in the ß splice variant within 8 hours of detachment of HaCaT sheets with dispase is shown. Densitometric analysis of expression of the different splice variants is shown below the gel. fl, full length; {alpha}, {alpha} splice; ß, ß splice.

 

As a second in-vivo-like model, we investigated tissue regeneration in organotypic cultures. For this, HaCaT cells were grown on a collagen substrate with integrated dermal fibroblasts and exposed to the air. In contrast to conventional growth on plastic, these culture conditions allow a mutual paracrine interaction of keratinocytes and fibroblasts by a number of growth factors (Szabowski et al., 2000Go), which favors stratification and the formation of a differentiated epithelium (Schoop et al., 1999Go). Correspondingly, one week after plating, the HaCaT cells had covered the collagen substrate and began to stratify (Fig. 5a). At this growth state, which still largely resembled that of dense cultures on plastic, the hTERT splicing pattern was still very similar to that of conventional cultures with about equal expression of the fulllength, {alpha} and ß splice forms (compare Fig. 5b with Fig. 2b). Three weeks after plating, the cells had formed a multilayered epidermis-like epithelium (Fig. 5a). In these cultures, the splicing pattern had shifted, showing predominantly now the full-length, active, hTERT transcript (Fig. 5b), a pattern also characteristic of intact epidermis (data not shown). A similar shift in the splicing pattern was seen for three-week-old HaCaT-myc cultures, which had formed a differentiated although somewhat less stratified epithelium. Only in HaCaT-TERT cultures, which overexpressed hTERT from the exogenous cDNA, were full-length hTERT transcripts detected in unstratified as well as stratified cultures (Fig. 5b). Since these and the above studies demonstrate that a shift to the inactive ß variant correlated with tissue destruction and a shift to the full-length transcript with reconstruction, these data suggest that alternative splicing is a also relevant mechanism of hTERT regulation for the epithelium in situ.



View larger version (70K):
[in this window]
[in a new window]
 
Fig. 5. Regeneration of a epidermis-like epithelium includes changes in hTERT splicing. (a) Organotypic cocultures of HaCaT cells with fibroblasts after one and three weeks. After three weeks the cells have formed an stratified epidermis-like epithelium with all characteristic layers (Bar=50 µm). (b) hTERT splicing pattern of HaCaT, HaCaT-myc and HaCaT-TERT one and three weeks after plating. With regeneration of the epithelium, the full-length hTERT transcript predominates. fl, full length; {alpha}, {alpha} splice; ß, ß splice.

 


    Discussion
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Using the HaCaT model as paradigm for telomerase-positive cells that still respond normally to proliferation and differentiation stimuli, we provide evidence that proliferation and telomerase activity, although generally tightly linked, can be dissociated and thus are not causally linked. Treatment of these cells with TGF-ß1 caused growth arrest, most probably induced by TGF-ß1-dependent inhibition of c-Myc. Whereas in normal HaCaT cells this correlated with inhibition of telomerase activity, constitutive expression of c-Myc prevented TGF-ß1-dependent inhibition of proliferation but did not restore telomerase activity. On the other hand, overexpression of hTERT counteracted TGF-ß1-dependent inhibition of telomerase activity whereas proliferation was still affected. This is in agreement with a recent report that shows that the c-Myc induction of hTERT is independent of cell proliferation (Wu et al., 1999Go). This also means that proliferation and telomerase activity need to be controlled by different mechanisms.

In order to unravel potential regulatory mechanisms, we asked whether TGF-ß1, which is well known for its growth inhibition of epithelial cells, would also control telomerase activity. Our present data underline the importance of TGF-ß1 in growth regulation of HaCaT cells and in addition demonstrate that TGF-ß1 is able to inhibit telomerase activity independently of proliferation. TGF-ß1 is a growth factor involved in many regulatory processes (Capdevila and Belmonte, 1999Go; Gold, 1999Go; Ashcroft and Roberts, 2000Go), and it is, therefore, tempting to speculate that the TGF-ß1-dependent mechanism of telomerase inhibition unraveled here is relevant and important for these processes.

TGF-ß1-dependent regulation of telomerase activity occurred at two levels. First and as also documented by others (Pietenpol et al., 1990Go), TGF-ß1 inhibited c-myc. Loss of c-Myc caused inhibition of hTERT transcription and consequently downregulation of telomerase activity. Thus, these findings confirm that also in keratinocytes c-Myc is a key activator of hTERT expression and with that of telomerase activity. It was recently reported that c-Myc is responsible for forcing stem cells into the highly proliferative compartment of transit amplifying cells (Gandarillas and Watt, 1997Go). In addition, we could already demonstrate earlier that the transition from stem to transit amplifying cells was correlated with upregulation of telomerase activity (Bickenbach et al., 1998Go). Together, these findings suggest that the increase in telomerase activity is due to c-Myc-dependent upregulation of hTERT. With differentiation, c-Myc is replaced by Mad (Hurlin et al., 1995Go), a repressor of hTERT transcription (Gunes et al., 2000Go; Oh et al., 2000Go), and correspondingly telomerase is downregulated (Harle-Bachor and Boukamp, 1996Go). Thus, this c-Myc-dependent activation of hTERT transcription is likely to be a major mechanism for maintained expression of telomerase activity in the epidermis.

As a second and novel mechanism for telomerase regulation, we propose that TGF-ß1 is able to modulate the splicing pattern of hTERT by shifting its expression from the full-length active hTERT splice form to the inactive smaller ß variant. It was recently shown that at least six different hTERT splice variants can be generated (Kilian et al., 1997Go; Colgin et al., 2000Go; Yi et al., 2000Go) and different splicing patterns were found during development and in the cancer specimen (Ulaner et al., 1998Go; Ulaner et al., 2000Go). As previously shown, these variants were not equal in their ability to generate an active telomerase complex. Telomerase activity was only provided by the full-length transcript. The smaller splice variants (ß and {alpha}+ß) were inactive whereas the {alpha} variant could act in a dominant-negative manner (Colgin et al., 2000Go; Yi et al., 2000Go). Surprisingly, we did not find an upregulation of this {alpha} variant but instead observed loss of the longer transcripts and maintained high expression of the smaller ß variant. This may imply that the shift in splicing is not a consequence of active selection for an endogenous hTERT inhibitor. An alternative explanation may be that TGF-ß1 induces rapid degradation of the hTERT transcripts whereas c-Myc preferentially stabilizes the ß variant. Also this appears unlikely because expression of the full-length transcripts remained unchanged in the HaCaT-TERT cells upon TGF-ß1 treatment. Instead, we would like to propose that TGF-ß1 is able to modulate the hTERT splicing pattern by alternative splicing and that, in agreement with the observed reversibility, this is a dynamic process. It was recently shown that alternative splicing can be regulated by changes in the subcellular re-localization of splicing factors (van der Houven van Oordt et al., 2000Go). Such a regulation should affect several genes simultaneously. Accordingly, hTERT would be now the third gene, together with fibronectin and tenascin (Borsi et al., 1990Go; Zhao and Young, 1995Go), that is regulated by TGF-ß1 through alternative splicing.

Finally, modulation of the hTERT splicing pattern does not seem to be exclusive for TGF-ß1-treated HaCaT-myc cells. Although this specific regulation allowed us to unravel this potential mechanism of hTERT regulation, we found changes in the splicing pattern during tissue destruction as well as during tissue regeneration. While detachment of intact HaCaT sheets was correlated with a rapid inhibition of the full length and increase of the ß splice form, the formation of a stratified epithelium was correlated with a shift to the full-length hTERT. Since this is also the characteristic hTERT mRNA pattern for intact epidermis, expression of the full-length active hTERT transcript is obviously the dominant form under optimal growth conditions. The factors responsible for this shift are presently still elusive. It is, however, well known that TGF-ß1 is involved in a number of temporary processes, such as wound healing (Ashcroft and Roberts, 2000Go), and it is also well established that epidermal stratification and differentiation is the result of a close interplay of a variety of growth factors mutually induced by the keratinocytes and fibroblasts (Szabowsky et al., 2000). Thus, irrespective of which additional factors will turn out to be responsible for modulating the hTERT splicing pattern, it is tempting to suggest that alternative splicing provides an additional regulatory mechanism for hTERT expression and telomerase activity also in the epidermis in situ.


    Acknowledgments
 
We would like to thank Roger Reddel for the hTERT construct and Carl-Henrik Heldin and Peter ten Dijke for the phospho-smad2 antibody. The experimental support of Lars Bönicke and Christiane Sandberg in retroviral transduction and Sven Bachmann in transfection is gratefully acknowledged. We wish to extend our thanks to Norbert Fusenig, Margareta Müller, Mike Rogers and Jackie Bickenbach for helpful discussions and for their help in editing the manuscript. This work was supported by grants from the Deutsche Forschungsgemeinschaft (Bo 1246/4-2) and European Union (QLRT-1999-01341) (both to P.B.).


    References
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

Ashcroft, G. S. and Roberts, A. B. (2000). Loss of Smad3 modulates wound healing. Cytokine Growth Factor Rev. 11,125 -131.[Medline]

Beattie, T. L., Zhou, W., Robinson, M. O. and Harrington, L. (2001). Functional multimerization of the human telomerase reverse transcriptase. Mol. Cell. Biol. 21,6151 -6160.[Abstract/Free Full Text]

Bickenbach, J. R., Vormwald-Dogan, V., Bachor, C., Bleuel, K., Schnapp, G. and Boukamp, P. (1998). Telomerase is not an epidermal stem cell marker and is downregulated by calcium. J. Invest Dermatol. 111,1045 -1052.[Medline]

Borsi, L., Castellani, P., Risso, A. M., Lepreini, A. and Zardi, L. (1990). Transforming growth factor-beta regulates the splicing pattern of fibronectin messenger RNA precursor. FEBS Lett. 261,175 -178.[Medline]

Boukamp, P., Petrussevska, R. T., Breitkreutz, D., Hornung, J., Markham, A. and Fusenig, N. E. (1988). Normal keratinization in a spontaneously immortalized aneuploid human keratinocyte cell line. J. Cell Biol. 106,761 -771.[Abstract/Free Full Text]

Capdevila, J. and Belmonte, J. C. (1999). Extracellular modulation of the Hedgehog, Wnt and TGF-beta signalling pathways during embryonic development. Curr. Opin. Genet. Dev. 9, 427-433.[Medline]

Colgin, L. M., Wilkinson, C., Englezou, A., Kilian, A., Robinson, M. O. and Reddel, R. R. (2000). The hTERT alpha splice variant is a dominant negative inhibitor of telomerase activity. Neoplasia 2,426 -432.[Medline]

Compton, C. C., Gill, J. M., Bradford, D. A., Regauer, S., Gallico, G. G. and O'Connor, N. E. (1989). Skin regenerated from cultured epithelial autografts on full-thickness burn wounds from 6 days to 5 years after grafting. A light, electron microscopic and immunohistochemical study. Lab. Invest. 60,600 -612.[Medline]

Counter, C. M., Gupta, J., Harley, C. B., Leber, B. and Bacchetti, S. (1995). Telomerase activity in normal leukocytes and in hematologic malignancies. Blood 85,2315 -2320.[Abstract/Free Full Text]

Derynck, R., Zhang, Y. and Feng, X. H. (1998). Smads: transcriptional activators of TGF-beta responses. Cell 95,737 -740.[Medline]

Feng, J., Funk, W. D., Wang, S. S., Weinrich, S. L., Avilion, A. A., Chiu, C. P., Adams, R. R., Chang, E., Allsopp, R. C., Yu, J. et al. (1995). The RNA component of human telomerase. Science 269,1236 -1241.[Abstract/Free Full Text]

Game, S. M., Huelsen, A., Patel, V., Donnelly, M., Yeudall, W. A., Stone, A., Fusenig, N. E. and Prime, S. S. (1992). Progressive abrogation of TGF-beta 1 and EGF growth control is associated with tumour progression in rastransfected human keratinocytes. Int. J. Cancer 52,461 -470.[Medline]

Gandarillas, A. and Watt, F. T. (1997). c-Myc promotes differentiation of human epidermal stem cells. Genes Dev. 11,2869 -2882.[Abstract/Free Full Text]

Gold, L. I. (1999). The role for transforming growth factor-beta (TGF-beta) in human cancer. Crit. Rev. Oncology 10,303 -360.

Greider, C. W. (1998). Telomerase activity, cell proliferation, and cancer. Proc. Natl. Acad. Sci. USA 95,90 -92.[Free Full Text]

Gunes, C., Lichtsteiner, S., Vasserot, A. P. and Englert, C. (2000). Expression of the hTERT gene is regulated at the level of transcriptional initiation and repressed by Mad1. Cancer Res. 60,2116 -2121.[Abstract/Free Full Text]

Harle-Bachor, C. and Boukamp, P. (1996). Telomerase activity in the regenerative basal layer of the epidermis in human skin and in immortal and carcinoma-derived skin keratinocytes. Proc. Natl Acad. Sci. USA 93,6476 -6481.[Abstract/Free Full Text]

Hartsough, M. T. and Mulder, K. M. (1997). Transforming growth factor-beta signaling in epithelial cells. Pharmacol. Ther. 75,21 -41.[Medline]

Heldin, C. H., Miyazono, K. and ten Dijke, P. (1997). TGF-beta signalling from cell membrane to nucleus through SMAD proteins. Nature 390,465 -471.[Medline]

Holt, S. E., Wright, W. E. and Shay, J. W. (1996). Regulation of telomerase activity in immortal cell lines. Mol. Cell. Biol. 16,2932 -2939.[Abstract]

Howard, B. D., Boenicke, L., Schniewind, B., Henne-Bruns, D. and Kalthoff, H. (2000). Transduction of human pancreatic tumor cells with vesicular stomatitis virus G-pseudotyped retroviral vectors containing a herpes simplex virus thymidine kinase mutant gene enhances bystander effects and sensitivity to ganciclovir. Cancer Gene Ther. 7,927 -938.[Medline]

Hurlin, P. H., Foley, K. P., Ayer, D. E., Eisenman, R. N., Hanahan, D. and Arbeit, J. M. (1995). Regulation of Myc and Mad during epidermal differentiation and HPV-associated tumorigenesis. Oncogene 11,2487 -2501.[Medline]

Kilian, A., Bowtell, D. D., Abud, H. E., Hime, G. R., Venter, D. J., Keese, P. K., Duncan, E. L., Reddel, R. R. and Jefferson, R. A. (1997). Isolation of a candidate human telomerase catalytic subunit gene, which reveals complex splicing patterns in different cell types. Hum. Mol. Genet. 6,2011 -2019.[Abstract/Free Full Text]

Kim, N. W., Piatyszek, M. A., Prowse, K. R., Harley, C. B., West, M. D., Ho, P. L., Coviello, G. M., Wright, W. E., Weinrich, S. L. and Shay, J. W. (1994). Specific association of human telomerase activity with immortal cells and cancer. Science 266,2011 -2015.[Abstract/Free Full Text]

Kyo, S., Takakura, M., Taira, T., Kanaya, T., Itoh, H., Yutsudo, M., Ariga, H. and Inoue, M. (2000). Sp1 cooperates with c-Myc to activate transcription of the human telomerase reverse transcriptase gene (hTERT). Nucleic Acids Res. 28,669 -677.[Abstract/Free Full Text]

Massague, J. and Wotton, D. (2000). Transcriptional control by the TGF-beta/Smad signaling system. EMBO J. 19,1745 -1754.[Medline]

Mateyak, M. K., Obaya, A. J. and Sedivy, J. M. (1999). c-Myc regulates cyclin D-Cdk4 and -Cdk6 activity but affects cell cycle progression at multiple independent points. Mol. Cell. Biol. 19,4672 -4683.[Abstract/Free Full Text]

Nakamura, T. M., Morin, G. B., Chapman, K. B., Weinrich, S. L., Andrews, W. H., Lingner, J., Harley, C. B. and Cech, T. R. (1997). Telomerase catalytic subunit homologs from fission yeast and human. Science 277,955 -959.[Abstract/Free Full Text]

Oh, S., Song, Y.-H., Kim, U.-J., Yim, J. and Kim, T. K. (1999) In vivo and in vitro analyses of c-Myc for differential promoter activities of human telomerase (hTERT) gene in normal and tumor cells. Biochem. Biophys. Res. Commun. 263,361 -365.[Medline]

Oh, S., Song, Y.-H., Kim, U.-J., Yim, J. and Kim, T. K. (2000). Identification of Mad as a repressor of the human telomerase (hTERT) gene. Oncogene 19,1485 -1490.[Medline]

Pietenpol, J. A., Holt, J. T., Stein, R. W. and Moses, H. L. (1990). Transforming growth factor beta 1 suppression of c-myc gene transcription: role in inhibition of keratinocyte proliferation. Proc. Natl Acad. Sci. USA 87,3758 -3762.[Abstract/Free Full Text]

Schaefer, B. M., Wallich, R., Schmolke, K., Fink, W., Bechtel, M., Reinartz, J. and Kramer, M. D. (2000). Immunohistochemical and molecular characterization of cultured keratinocytes after dispase-mediated detachment from the growth substratum. Exp. Dermatol. 9,58 -64.[Medline]

Schoop, V. M., Mirancea, N. and Fusenig, N. E. (1999). Epidermal organization and differentiation of HaCaT keratinocytes in organotypic coculture with human dermal fibroblasts. J. Invest. Dermatol, 112,343 -353.[Medline]

Schuermann, M. (1990) An expression vector system for stable expression of oncogenes. Nucleic Acids Res. 18,4945 -4946.[Free Full Text]

Szabowski, A., Maas-Szabowski, N., Andrecht, S., Kolbus, A., Schorpp-Kistner, M., Fusenig, N. E. and Angel, P. (2000). c-Jun and JunB antagonistically control cytokine-regulated mesenchymal-epidermal interaction in skin. Cell 103,745 -755.[Medline]

Ulaner, G. A., Hu, J. F., Vu, T. H., Giudice, L. C. and Hoffman, A. R. (1998). Telomerase activity in human development is regulated by human telomerase reverse transcriptase (hTERT) transcription and by alternate splicing of hTERT transcripts. Cancer Res. 58,4168 -4172.[Abstract/Free Full Text]

Ulaner, G. A., Hu, J. F., Vu, T. H., Oruganti, H., Giudice, L. C. and Hoffman, A. R. (2000). Regulation of telomerase by alternate splicing of human telomerase reverse transcriptase (hTERT) in normal and neoplastic ovary, endometrium and myometrium. Int. J. Cancer 85,330 -335.[Medline]

van der Houven van Oordt, W., Diaz-Meco, M. T., Lozano, J., Krainer, A. R., Moscat, J. and Caceres, J. F. (2000). The MKK(3/6)-p38-signaling cascade alters the subcellular distribution of hnRNP A1 and modulates alternative splicing regulation. J. Cell Biol. 149,307 -316.[Abstract/Free Full Text]

Wang, J., Xie, L. Y., Allan, S., Beach, D. and Hannon, G. J. (1998). Myc activates telomerase. Genes Dev. 12,1769 -1774.[Abstract/Free Full Text]

Wang, J., Hannon, G. J. and Beach, D. H. (2000). Risky immortalization by telomerase. Nature 405,755 -756.[Medline]

Wright, W. E., Piatyszek, M. A., Rainey, W. E., Byrd, W. and Shay, J. W. (1996). Telomerase activity in human germline and embryonic tissues and cells. Dev. Genet. 18,173 -179.[Medline]

Wu, K. J., Grandori, C., Amacker, M., Simon-Vermot, N., Polack, A., Lingner, J. and Dalla-Favera, R. (1999). Direct activation of TERT transcription by c-MYC. Nat. Genet. 21,220 -224.[Medline]

Yi, X., White, D. M., Aisner, D. L., Baur, J. A., Wright, W. E. and Shay, J. W. (2000). An alternate splicing variant of the human telomerase catalytic subunit inhibits telomerase activity. Neoplasia 2,433 -440.[Medline]

Zhao, Y. and Young, S. L. (1995). TGF-beta regulates expression of tenascin alternative splicing isoforms in fetal rat lung. Am. J. Physiol. 268,L173 -L180.[Abstract/Free Full Text]





This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Cerezo, A.
Right arrow Articles by Boukamp, P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Cerezo, A.
Right arrow Articles by Boukamp, P.