|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
Research Article |
1 Deutsches Krebsforschungszentrum, Division of Skin Carcinogenesis, Im
Neuenheimer Feld 280, D-69120 Heidelberg, Germany
2 Klinik für Allg. Chirurgie und Thoraxchirurgie, Molecular Oncology,
University of Kiel, D-24105 Kiel, Germany
3 University of Marburg, Department of Haematology and Oncology, Baldinger Str.
D-35033 Marburg, Germany
4 University of Heidelberg, Department of Immunology, Im Neuenheimer Feld 305,
D-69120 Heidelberg, Germany
* Author for correspondence (e-mail: P.Boukamp{at}DKFZ-Heidelberg.de )
Accepted 17 December 2001
| Summary |
|---|
|
|
|---|
Key words: HaCaT, Proliferation, Transcription, Splice variants, Growth factor
| Introduction |
|---|
|
|
|---|
Although tumor and immortal cells generally exhibit an unrestricted life
span, proliferation can still be tightly controlled. One potent modulator is
transforming growth factor-beta 1 (TGF-ß1)
(Hartsough and Mulder, 1997
).
TGF-ß1 belongs to a family of growth factors that regulate cell growth,
morphogenesis and apoptosis, and is proven to play an important role in
several processes, such as embryogenic development
(Capdevila and Belmonte, 1999
),
wound healing (Ashcroft and Roberts,
2000
) and cancer (Gold,
1999
). TGF-ß1 is a growth factor with a broad spectrum of
actions and mediates a wide range of cellular responses in different cell
types. In normal epithelial cells, TGF-ß1 causes growth arrest, whereas
many tumors are refractory to this inhibition
(Hartsough and Mulder, 1997
).
It is believed that progressive loss of TGF-ß1 response provides a
selective growth advantage to tumor cells, and thus, TGF-ß1 insensitivity
is an important step in carcinogenesis
(Gold, 1999
).
Part of the TGF-ß1 pathway is now well understood
(Heldin et al., 1997
;
Derynck et al., 1998
; Masague
and Wotton, 2000). TGF-ß1 initiates signaling by binding to specific
Ser/Thrkinase receptors which, in turn, phosphorylate members of the Smad
family. Phosphorylated Smad2 and Smad3 assemble with Smad4 and translocate
from the cytoplasm into the nucleus where they regulate transcription of
effector genes by either directly binding to DNA or by binding to other
transcription factors. One important effector is the protooncogene
c-myc, which regulates cell cycle progression at different levels
(Mateyak et al., 1999
).
TGF-ß1 has been shown to rapidly inhibit c-myc transcription in
mouse keratinocytes, and this inhibition caused cell cycle arrest
(Pietenpol et al., 1990
).
c-Myc has also been described as directly regulating expression of the
hTERT gene (Oh et al.,
1999
; Wu et al.,
1999
), and it was suggested that c-Myc, in cooperation with the
transcription factor Sp1, was the major determinant of hTERT expression
(Kyo et al., 2000
). Since both
c-Myc and telomerase are expressed and active in the proliferating cells of
the basal layer of the epidermis and are downregulated with differentiation,
we reasoned that TGF-ß1 could be a link in the causal relationship
between proliferation and telomerase activity. As a model system, we used the
human HaCaT skin keratinocyte line, which, despite being immortal, still
responds normally to TGF-ß1-mediated growth inhibition
(Boukamp et al., 1988
;
Game et al., 1992
). In this
experimental system we now show that TGF-ß1 is able to regulate
proliferation and telomerase activity independently, and we further
demonstrate that TGF-ß1 can inhibit telomerase activity despite ongoing
hTERT transcription by shifting expression from the active to the inactive
splice variants. We further provide evidence that this alternative splicing is
not restricted to TGF-ß1 but may be a more general mechanism of hTERT
regulation.
| Materials and Methods |
|---|
|
|
|---|
Organotypic cocultures of HaCaT cells
Organotypic cocultures of HaCaT cells were prepared following the method by
Schoop et al. (Schoop et al.,
1999
). After the appropriate time periods (1 or 3 weeks), cultures
were either selected for histology or for RNA extraction. Histology was
performed following standard protocols. For RNA extraction the epithelium was
carefully separated from the collagen substrate and further processed as for
cell pellets.
Western blot analysis
Cell pellets were lysed in RIPA buffer, and the protein concentrations were
determined (Bradford: Bio-Rad). 30 µg of total protein were separated by
SDS-PAGE and transferred to nitrocellulose membrane (Schleicher &
Schuell). Membranes were pre-blocked in 10% nonfat
milk/phosphate-buffered-saline (PBS) for 2-12 hours, probed with the
appropriate primary- (anti-c-Myc: C-33 (Santa Cruz Biotechnology);
anti-phospho-Smad2, (kindly provided by C. H. Heldin)) and
horseradish-peroxidase-coupled secondary antibody (Dianova) diluted in 10%
milk/PBS/0.1% Tween 20 for 60 minutes. Enhanced chemiluminiscence detection
was performed (Amersham-Pharmacia Biotech). Densitometric analysis was
assessed with TINA 2.0 software (raytest Isotopenmeßgeräte
GmbH).
Proliferation analysis
2x103 cells were seeded in 96-well plates. Where required,
TGF-ß1 was added after 24 hours. 5-bromo-2'-deoxyuridine (BrdU) was
added 2 hours before performing the BrdU ELISA test (Roche). Total OD values
are expressed as a percentage of control (untreated) cells.
Telomerase assays
Cell lysis and telomerase assays were performed using the TRAPeze kit
(Intergen). 50 ng of total protein extract were used for each assay, each with
or without RNase-inactivation (RNase, DNase-free, Roche). Products were
separated in non-denaturing 10% polyacrylamide gels, visualized by
autoradiography and PhosphoImager scanning (Fujifilm Bas-1500) and quantified
with TINA 2.0 software.
RT-PCR analysis
Total RNA was isolated from cell pellets or epithelia from organotypic
cocultures using RNeasy (QIAGEN). 1 µg of total RNA was used to generate a
cDNA from each sample (Omniscript, QIAGEN) in a final volume of 20 µl. 4
µl of this solution was amplified in a 25 µl mixture containing 0.2 mM
dNTPs (Roche), 2.5 units Taq (Roche) and 0.2 µM of each primer. Overall
hTERT expression was detected using primers TERT-1784S and TERT-1928A
(Ulaner et al., 1998
), with an
initial heating at 94°C for 2 minutes, followed by 35 cycles of 94°C
for 45 seconds, 60°C for 45 seconds, 72°C for 90 seconds and a final
extension at 72°C for 10 minutes. Alternative splice variants were
detected with primers TERT-HT2026F and TERT-HT2482R
(Kilian et al., 1997
) by 35
cycles (if not stated differently) of 94°C for 15 seconds, 60°C for 15
seconds and 72°C for 30 seconds, and GAPDH was amplified as the internal
control by 23 cycles of 94°C for 30 seconds, 60°C for 30 seconds and
72°C for 60 seconds with GAPDH-sense (GAGAAGGCTGGGGCTCATTT) and -antisense
(CAGTGGGGACACGGAAGG) primers. PCR products were subjected to electrophoresis
in 2% agarose (FMC Bioproducts) gels and were visualized with ethidium bromide
(SIGMA). For each primer set the number of amplification cycles was
pre-determined in order to be in the exponential phase. To provide a high
degree of standardization, all experiments including HaCaT and HaCaT-myc cells
were performed simultaneously, using the same reaction mix, and GAPDH was
co-amplified to confirm equal amounts of starting cDNA.
| Results |
|---|
|
|
|---|
|
To determine a causal link between proliferation and telomerase activity,
we aimed to interfere with this co-regulation by generating HaCaT cells that
either expressed hTERT (HaCaT-TERT cells) or c-Myc (HaCaT-myc cells) under the
control of a constitutive promoter, that is, a promoter that should be
insensitive to regulation by TGF-ß1 or endogenous regulatory pathways.
When treated with TGF-ß1, both cell types showed normal Smad2
phosphorylation (Fig. 1b,c),
thereby demonstrating unaltered activation of the TGF-ß1/Smad pathway. As
expected, in HaCaT-TERT cells telomerase activity was not altered. The same
high activity was detected throughout the 96 hours observation period. The Myc
level, on the other hand, was reduced. Unlike in the parental cells, however,
we did only detect a
50% inhibition. Since it had a recently been shown
that hTERT-immortalized cells also upregulated c-Myc
(Wang et al., 2000
), it
remains to be investigated whether in addition to the known positive
regulation of c-Myc on hTERT expression
(Wang et al., 1998
;
Oh et al., 1999
;
Wu et al., 1999
;
Kyo et al., 2000
)
overexpression of hTERT can in turn affect c-Myc (feed-back loop). In
agreement with this partial inhibition of c-Myc, proliferation was also less
strongly affected. The BrdU-labeling index decreased to <50% as compared
with
25% in the parental cells. In HaCaT-myc cells, c-Myc remained
expressed during TGF-ß1 treatment and also proliferation remained high.
However, telomerase activity decreased after 72 hours
(Fig. 1c). Since in HaCaT-TERT
cells proliferation was inhibited despite high telomerase activity and,
conversely, in HaCaT-myc cells proliferation continued despite inhibition of
telomerase activity, these studies established that both traits were not
causally linked and that TGF-ß1 was able to regulate both
individually.
c-Myc activates hTERT transcription without restoring telomerase
activity
It was recently shown that c-Myc is a positive regulator of hTERT
(Wang et al., 1998
;
Oh et al., 1999
;
Wu et al., 1999
;
Kyo et al., 2000
).
Nevertheless, the above data showed that despite high levels of c-Myc,
telomerase activity was reduced. In order to unravel this discrepancy, we
analyzed hTERT expression in HaCaT and HaCaT-myc cells during TGF-ß1
treatment by RT-PCR, using primers that were designed to detect overall hTERT
transcription (Ulaner et al.,
1998
). The level of hTERT mRNA was decreased in HaCaT cells after
6 hours, and expression remained low throughout the experiment. In HaCaT-myc
cells, on the other hand, hTERT expression was not altered. The same level was
expressed throughout (Fig. 2a).
Thus, when c-Myc remained unaffected by TGF-ß1, hTERT also remained
expressed. Since it had been shown previously that Myc-Max complexes can
directly bind to E-box elements in the hTERT promoter and activate hTERT
transcription (Oh et al.,
1999
; Wu et al.,
1999
), our results suggest that, similar to results in other cell
types, in HaCaT cells the endogenous hTERT gene seemed to be
positively regulated by c-Myc.
|
TGF-ß1 regulates hTERT alternative splicing
Since telomerase activity was not affected by TGF-ß1 in HaCaT-TERT
cells, a direct inhibition of the telomerase complex could be excluded.
Furthermore, telomerase is a very stable complex, with a half life >24
hours (Holt et al., 1996
). The
delay of 48 hours seen for telomerase inhibition in HaCaT and HaCaT-myc cells
also argued for transcriptional regulation. It was recently described that
hTERT is characterized by different transcripts generated through alternative
splicing (Kilian et al.,
1997
). We, therefore, asked whether modulation of the hTERT
splicing pattern might be a potential mechanism of telomerase inhibition in
the HaCaT-myc cells.
To test this, we reinvestigated expression of hTERT in HaCaT and HaCaT-myc
cells during TGF-ß1 treatment by using a set of primers that recognize
four possible hTERT splice variants
(Kilian et al., 1997
);
full-length,
, ß and
+ß transcripts. Under standard
conditions, the full-length (fl),
and the ß splice variants were
detected in HaCaT cells, whereas the
+ß variant was generally
absent (Fig. 2b). Upon
TGF-ß1 treatment, expression of all transcripts was reduced within 48
hours and hardly detectable after 72 hours. In the untreated HaCaT-myc cells,
the overall expression level seemed slightly increased, giving rise to an
about equal expression level of the full length and
splice variants
and a slightly increased level of the ß splice form
(Fig. 2b). During treatment
with TGF-ß1, however, we only observed a reduction in the expression of
the longer transcripts (full-length and
variant). Expression of the
ß splice variant remained high throughout the experiment.
These data demonstrated that only when c-Myc was present did hTERT remain
expressed. In addition, however, they also showed that TGF-ß1 was able to
interfere with hTERT expression by causing loss of full length and
splice transcripts and maintaining expression of the ß variant. The
reason for such an altered pattern could be twofold. First, TGF-ß1 might
cause rapid degradation of hTERT transcripts, and c-Myc would specifically
stabilize the smaller ß variant. Alternatively, TGF-ß1 may affect
alternative splicing in favor of the smaller and, in the case of hTERT, the
inactive transcripts.
To address this, we studied hTERT expression in the TGF-ß1-treated HaCaT-TERT cells, which, owing to the lack of splice sites in the exogenous cDNA, overexpress full-length hTERT transcripts (Fig. 2c). The endogenous splice forms were expressed at too lower level to be detectable under the same conditions. If TGF-ß1 was able to induce degradation of hTERT transcripts, this should account for the full-length transcripts of the HaCaT-TERT cells as well. As shown in Fig. 2c, expression of these transcripts remained unaltered during TGF-ß1 treatment. Furthermore, since the HaCaT-TERT cells remained telomerase positive in the presence of TGF-ß1, the data further confirmed that only expression of the full-length hTERT transcript was causal for telomerase activity.
TGF-ß1 regulation of hTERT splicing is reversible and correlates
with telomerase activity
It is well known that the action of TGF-ß1 is reversible, thus
telomerase regulation by TGF-ß1 through alternative splicing of hTERT
should also be reversible. To test this, HaCaT-myc cells were treated with
TGF-ß1 for 96 hours, TGF-ß1 was removed, and the cells were grown in
the absence of TGF-ß1 for another 96 hours. As expected, after 96 hours
of TGF-ß1 treatment the full-length transcript was hardly detectable and
also the level of the
-splice variant was reduced. Only expression of
the ß splice variant was high (Fig.
3a). This correlated with a strong inhibition of telomerase
activity (Fig. 3b). Within 96
hours of TGF-ß1 removal, the full-length hTERT transcript was
re-expressed at about equal levels to the ß splice variant
(Fig. 3a). Although
transcription was not fully restored by 96 hours, reactivation of the
full-length hTERT closely correlated with an increase in telomerase activity
(Fig. 3b). These data
established that TGF-ß1 was able to induce a shift in the hTERT splicing
pattern that caused inhibition of telomerase activity and that this regulation
pathway was reversible.
|
Alternative splicing is a more general mechanism for hTERT regulation
in epidermal cells
In vivo, TGF-ß1 is involved in processes such as wound healing, which
are characterized by tissue destruction and reconstruction and which, in
addition to inhibition of proliferation and differentiation, are likely to
also require inhibition of hTERT expression. We thus determined whether
modulation of hTERT splicing may also be a relevant regulatory mechanism in
two different in vitro growth processes that largely reflect tissue
destruction and reconstruction.
First, HaCaT cells were allowed to grow as dense monolayers, and the intact
sheets were detached from the substrate by dispase treatment a
situation resembling epidermal blistering
(Schaefer et al., 2000
). This
treatment does not cause irreversible growth defects, which had previously
been indicated by the fact that comparable sheets of normal keratinocytes are
routinely used as transplants for burnt patients
(Compton et al., 1989
). When
analyzing hTERT splicing in such HaCaT sheets, we observed a steady increase
in hTERT mRNA within 8 hours of detachment. Most notably, a major increase was
detected for the ß splice variant, whereas the
and full-length
transcripts remained low (Fig.
4). Thus, disturbance of tissue integrity in the parental HaCaT
cells included modulation of the hTERT splicing pattern, and this resulted in
a shift from an about equal expression of full-length,
and ß
variants to predominant expression of the ß splice form.
|
As a second in-vivo-like model, we investigated tissue regeneration in
organotypic cultures. For this, HaCaT cells were grown on a collagen substrate
with integrated dermal fibroblasts and exposed to the air. In contrast to
conventional growth on plastic, these culture conditions allow a mutual
paracrine interaction of keratinocytes and fibroblasts by a number of growth
factors (Szabowski et al.,
2000
), which favors stratification and the formation of a
differentiated epithelium (Schoop et al.,
1999
). Correspondingly, one week after plating, the HaCaT cells
had covered the collagen substrate and began to stratify
(Fig. 5a). At this growth
state, which still largely resembled that of dense cultures on plastic, the
hTERT splicing pattern was still very similar to that of conventional cultures
with about equal expression of the fulllength,
and ß splice forms
(compare Fig. 5b with
Fig. 2b). Three weeks after
plating, the cells had formed a multilayered epidermis-like epithelium
(Fig. 5a). In these cultures,
the splicing pattern had shifted, showing predominantly now the full-length,
active, hTERT transcript (Fig.
5b), a pattern also characteristic of intact epidermis (data not
shown). A similar shift in the splicing pattern was seen for three-week-old
HaCaT-myc cultures, which had formed a differentiated although somewhat less
stratified epithelium. Only in HaCaT-TERT cultures, which overexpressed hTERT
from the exogenous cDNA, were full-length hTERT transcripts detected in
unstratified as well as stratified cultures
(Fig. 5b). Since these and the
above studies demonstrate that a shift to the inactive ß variant
correlated with tissue destruction and a shift to the full-length transcript
with reconstruction, these data suggest that alternative splicing is a also
relevant mechanism of hTERT regulation for the epithelium in situ.
|
| Discussion |
|---|
|
|
|---|
In order to unravel potential regulatory mechanisms, we asked whether
TGF-ß1, which is well known for its growth inhibition of epithelial
cells, would also control telomerase activity. Our present data underline the
importance of TGF-ß1 in growth regulation of HaCaT cells and in addition
demonstrate that TGF-ß1 is able to inhibit telomerase activity
independently of proliferation. TGF-ß1 is a growth factor involved in
many regulatory processes (Capdevila and
Belmonte, 1999
; Gold,
1999
; Ashcroft and Roberts,
2000
), and it is, therefore, tempting to speculate that the
TGF-ß1-dependent mechanism of telomerase inhibition unraveled here is
relevant and important for these processes.
TGF-ß1-dependent regulation of telomerase activity occurred at two
levels. First and as also documented by others
(Pietenpol et al., 1990
),
TGF-ß1 inhibited c-myc. Loss of c-Myc caused inhibition of hTERT
transcription and consequently downregulation of telomerase activity. Thus,
these findings confirm that also in keratinocytes c-Myc is a key activator of
hTERT expression and with that of telomerase activity. It was recently
reported that c-Myc is responsible for forcing stem cells into the highly
proliferative compartment of transit amplifying cells
(Gandarillas and Watt, 1997
).
In addition, we could already demonstrate earlier that the transition from
stem to transit amplifying cells was correlated with upregulation of
telomerase activity (Bickenbach et al.,
1998
). Together, these findings suggest that the increase in
telomerase activity is due to c-Myc-dependent upregulation of hTERT. With
differentiation, c-Myc is replaced by Mad
(Hurlin et al., 1995
), a
repressor of hTERT transcription (Gunes et
al., 2000
; Oh et al.,
2000
), and correspondingly telomerase is downregulated
(Harle-Bachor and Boukamp,
1996
). Thus, this c-Myc-dependent activation of hTERT
transcription is likely to be a major mechanism for maintained expression of
telomerase activity in the epidermis.
As a second and novel mechanism for telomerase regulation, we propose that
TGF-ß1 is able to modulate the splicing pattern of hTERT by shifting its
expression from the full-length active hTERT splice form to the inactive
smaller ß variant. It was recently shown that at least six different
hTERT splice variants can be generated
(Kilian et al., 1997
;
Colgin et al., 2000
;
Yi et al., 2000
) and different
splicing patterns were found during development and in the cancer specimen
(Ulaner et al., 1998
;
Ulaner et al., 2000
). As
previously shown, these variants were not equal in their ability to generate
an active telomerase complex. Telomerase activity was only provided by the
full-length transcript. The smaller splice variants (ß and
+ß) were inactive whereas the
variant could act in a
dominant-negative manner (Colgin et al.,
2000
; Yi et al.,
2000
). Surprisingly, we did not find an upregulation of this
variant but instead observed loss of the longer transcripts and
maintained high expression of the smaller ß variant. This may imply that
the shift in splicing is not a consequence of active selection for an
endogenous hTERT inhibitor. An alternative explanation may be that TGF-ß1
induces rapid degradation of the hTERT transcripts whereas c-Myc
preferentially stabilizes the ß variant. Also this appears unlikely
because expression of the full-length transcripts remained unchanged in the
HaCaT-TERT cells upon TGF-ß1 treatment. Instead, we would like to propose
that TGF-ß1 is able to modulate the hTERT splicing pattern by alternative
splicing and that, in agreement with the observed reversibility, this is a
dynamic process. It was recently shown that alternative splicing can be
regulated by changes in the subcellular re-localization of splicing factors
(van der Houven van Oordt et al.,
2000
). Such a regulation should affect several genes
simultaneously. Accordingly, hTERT would be now the third gene, together with
fibronectin and tenascin (Borsi et al.,
1990
; Zhao and Young,
1995
), that is regulated by TGF-ß1 through alternative
splicing.
Finally, modulation of the hTERT splicing pattern does not seem to be
exclusive for TGF-ß1-treated HaCaT-myc cells. Although this specific
regulation allowed us to unravel this potential mechanism of hTERT regulation,
we found changes in the splicing pattern during tissue destruction as well as
during tissue regeneration. While detachment of intact HaCaT sheets was
correlated with a rapid inhibition of the full length and increase of the
ß splice form, the formation of a stratified epithelium was correlated
with a shift to the full-length hTERT. Since this is also the characteristic
hTERT mRNA pattern for intact epidermis, expression of the full-length active
hTERT transcript is obviously the dominant form under optimal growth
conditions. The factors responsible for this shift are presently still
elusive. It is, however, well known that TGF-ß1 is involved in a number
of temporary processes, such as wound healing
(Ashcroft and Roberts, 2000
),
and it is also well established that epidermal stratification and
differentiation is the result of a close interplay of a variety of growth
factors mutually induced by the keratinocytes and fibroblasts (Szabowsky et
al., 2000). Thus, irrespective of which additional factors will turn out to be
responsible for modulating the hTERT splicing pattern, it is tempting to
suggest that alternative splicing provides an additional regulatory mechanism
for hTERT expression and telomerase activity also in the epidermis in
situ.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Ashcroft, G. S. and Roberts, A. B. (2000). Loss of Smad3 modulates wound healing. Cytokine Growth Factor Rev. 11,125 -131.[Medline]
Beattie, T. L., Zhou, W., Robinson, M. O. and Harrington, L.
(2001). Functional multimerization of the human telomerase
reverse transcriptase. Mol. Cell. Biol.
21,6151
-6160.
Bickenbach, J. R., Vormwald-Dogan, V., Bachor, C., Bleuel, K., Schnapp, G. and Boukamp, P. (1998). Telomerase is not an epidermal stem cell marker and is downregulated by calcium. J. Invest Dermatol. 111,1045 -1052.[Medline]
Borsi, L., Castellani, P., Risso, A. M., Lepreini, A. and Zardi, L. (1990). Transforming growth factor-beta regulates the splicing pattern of fibronectin messenger RNA precursor. FEBS Lett. 261,175 -178.[Medline]
Boukamp, P., Petrussevska, R. T., Breitkreutz, D., Hornung, J.,
Markham, A. and Fusenig, N. E. (1988). Normal keratinization
in a spontaneously immortalized aneuploid human keratinocyte cell line.
J. Cell Biol. 106,761
-771.
Capdevila, J. and Belmonte, J. C. (1999). Extracellular modulation of the Hedgehog, Wnt and TGF-beta signalling pathways during embryonic development. Curr. Opin. Genet. Dev. 9, 427-433.[Medline]
Colgin, L. M., Wilkinson, C., Englezou, A., Kilian, A., Robinson, M. O. and Reddel, R. R. (2000). The hTERT alpha splice variant is a dominant negative inhibitor of telomerase activity. Neoplasia 2,426 -432.[Medline]
Compton, C. C., Gill, J. M., Bradford, D. A., Regauer, S., Gallico, G. G. and O'Connor, N. E. (1989). Skin regenerated from cultured epithelial autografts on full-thickness burn wounds from 6 days to 5 years after grafting. A light, electron microscopic and immunohistochemical study. Lab. Invest. 60,600 -612.[Medline]
Counter, C. M., Gupta, J., Harley, C. B., Leber, B. and
Bacchetti, S. (1995). Telomerase activity in normal
leukocytes and in hematologic malignancies. Blood
85,2315
-2320.
Derynck, R., Zhang, Y. and Feng, X. H. (1998). Smads: transcriptional activators of TGF-beta responses. Cell 95,737 -740.[Medline]
Feng, J., Funk, W. D., Wang, S. S., Weinrich, S. L., Avilion, A.
A., Chiu, C. P., Adams, R. R., Chang, E., Allsopp, R. C., Yu, J. et al.
(1995). The RNA component of human telomerase.
Science 269,1236
-1241.
Game, S. M., Huelsen, A., Patel, V., Donnelly, M., Yeudall, W. A., Stone, A., Fusenig, N. E. and Prime, S. S. (1992). Progressive abrogation of TGF-beta 1 and EGF growth control is associated with tumour progression in rastransfected human keratinocytes. Int. J. Cancer 52,461 -470.[Medline]
Gandarillas, A. and Watt, F. T. (1997). c-Myc
promotes differentiation of human epidermal stem cells. Genes
Dev. 11,2869
-2882.
Gold, L. I. (1999). The role for transforming growth factor-beta (TGF-beta) in human cancer. Crit. Rev. Oncology 10,303 -360.
Greider, C. W. (1998). Telomerase activity,
cell proliferation, and cancer. Proc. Natl. Acad. Sci.
USA 95,90
-92.
Gunes, C., Lichtsteiner, S., Vasserot, A. P. and Englert, C.
(2000). Expression of the hTERT gene is regulated at the level of
transcriptional initiation and repressed by Mad1. Cancer
Res. 60,2116
-2121.
Harle-Bachor, C. and Boukamp, P. (1996).
Telomerase activity in the regenerative basal layer of the epidermis in human
skin and in immortal and carcinoma-derived skin keratinocytes.
Proc. Natl Acad. Sci. USA
93,6476
-6481.
Hartsough, M. T. and Mulder, K. M. (1997). Transforming growth factor-beta signaling in epithelial cells. Pharmacol. Ther. 75,21 -41.[Medline]
Heldin, C. H., Miyazono, K. and ten Dijke, P. (1997). TGF-beta signalling from cell membrane to nucleus through SMAD proteins. Nature 390,465 -471.[Medline]
Holt, S. E., Wright, W. E. and Shay, J. W. (1996). Regulation of telomerase activity in immortal cell lines. Mol. Cell. Biol. 16,2932 -2939.[Abstract]
Howard, B. D., Boenicke, L., Schniewind, B., Henne-Bruns, D. and Kalthoff, H. (2000). Transduction of human pancreatic tumor cells with vesicular stomatitis virus G-pseudotyped retroviral vectors containing a herpes simplex virus thymidine kinase mutant gene enhances bystander effects and sensitivity to ganciclovir. Cancer Gene Ther. 7,927 -938.[Medline]
Hurlin, P. H., Foley, K. P., Ayer, D. E., Eisenman, R. N., Hanahan, D. and Arbeit, J. M. (1995). Regulation of Myc and Mad during epidermal differentiation and HPV-associated tumorigenesis. Oncogene 11,2487 -2501.[Medline]
Kilian, A., Bowtell, D. D., Abud, H. E., Hime, G. R., Venter, D.
J., Keese, P. K., Duncan, E. L., Reddel, R. R. and Jefferson, R. A.
(1997). Isolation of a candidate human telomerase catalytic
subunit gene, which reveals complex splicing patterns in different cell types.
Hum. Mol. Genet. 6,2011
-2019.
Kim, N. W., Piatyszek, M. A., Prowse, K. R., Harley, C. B.,
West, M. D., Ho, P. L., Coviello, G. M., Wright, W. E., Weinrich, S. L. and
Shay, J. W. (1994). Specific association of human telomerase
activity with immortal cells and cancer. Science
266,2011
-2015.
Kyo, S., Takakura, M., Taira, T., Kanaya, T., Itoh, H., Yutsudo,
M., Ariga, H. and Inoue, M. (2000). Sp1 cooperates with c-Myc
to activate transcription of the human telomerase reverse transcriptase gene
(hTERT). Nucleic Acids Res.
28,669
-677.
Massague, J. and Wotton, D. (2000). Transcriptional control by the TGF-beta/Smad signaling system. EMBO J. 19,1745 -1754.[Medline]
Mateyak, M. K., Obaya, A. J. and Sedivy, J. M.
(1999). c-Myc regulates cyclin D-Cdk4 and -Cdk6 activity but
affects cell cycle progression at multiple independent points. Mol.
Cell. Biol. 19,4672
-4683.
Nakamura, T. M., Morin, G. B., Chapman, K. B., Weinrich, S. L.,
Andrews, W. H., Lingner, J., Harley, C. B. and Cech, T. R.
(1997). Telomerase catalytic subunit homologs from fission yeast
and human. Science 277,955
-959.
Oh, S., Song, Y.-H., Kim, U.-J., Yim, J. and Kim, T. K. (1999) In vivo and in vitro analyses of c-Myc for differential promoter activities of human telomerase (hTERT) gene in normal and tumor cells. Biochem. Biophys. Res. Commun. 263,361 -365.[Medline]
Oh, S., Song, Y.-H., Kim, U.-J., Yim, J. and Kim, T. K. (2000). Identification of Mad as a repressor of the human telomerase (hTERT) gene. Oncogene 19,1485 -1490.[Medline]
Pietenpol, J. A., Holt, J. T., Stein, R. W. and Moses, H. L.
(1990). Transforming growth factor beta 1 suppression of
c-myc gene transcription: role in inhibition of keratinocyte
proliferation. Proc. Natl Acad. Sci. USA
87,3758
-3762.
Schaefer, B. M., Wallich, R., Schmolke, K., Fink, W., Bechtel, M., Reinartz, J. and Kramer, M. D. (2000). Immunohistochemical and molecular characterization of cultured keratinocytes after dispase-mediated detachment from the growth substratum. Exp. Dermatol. 9,58 -64.[Medline]
Schoop, V. M., Mirancea, N. and Fusenig, N. E. (1999). Epidermal organization and differentiation of HaCaT keratinocytes in organotypic coculture with human dermal fibroblasts. J. Invest. Dermatol, 112,343 -353.[Medline]
Schuermann, M. (1990) An expression vector
system for stable expression of oncogenes. Nucleic Acids
Res. 18,4945
-4946.
Szabowski, A., Maas-Szabowski, N., Andrecht, S., Kolbus, A., Schorpp-Kistner, M., Fusenig, N. E. and Angel, P. (2000). c-Jun and JunB antagonistically control cytokine-regulated mesenchymal-epidermal interaction in skin. Cell 103,745 -755.[Medline]
Ulaner, G. A., Hu, J. F., Vu, T. H., Giudice, L. C. and Hoffman,
A. R. (1998). Telomerase activity in human development is
regulated by human telomerase reverse transcriptase (hTERT) transcription and
by alternate splicing of hTERT transcripts. Cancer
Res. 58,4168
-4172.
Ulaner, G. A., Hu, J. F., Vu, T. H., Oruganti, H., Giudice, L. C. and Hoffman, A. R. (2000). Regulation of telomerase by alternate splicing of human telomerase reverse transcriptase (hTERT) in normal and neoplastic ovary, endometrium and myometrium. Int. J. Cancer 85,330 -335.[Medline]
van der Houven van Oordt, W., Diaz-Meco, M. T., Lozano, J.,
Krainer, A. R., Moscat, J. and Caceres, J. F. (2000). The
MKK(3/6)-p38-signaling cascade alters the subcellular distribution of hnRNP A1
and modulates alternative splicing regulation. J. Cell
Biol. 149,307
-316.
Wang, J., Xie, L. Y., Allan, S., Beach, D. and Hannon, G. J.
(1998). Myc activates telomerase. Genes
Dev. 12,1769
-1774.
Wang, J., Hannon, G. J. and Beach, D. H. (2000). Risky immortalization by telomerase. Nature 405,755 -756.[Medline]
Wright, W. E., Piatyszek, M. A., Rainey, W. E., Byrd, W. and Shay, J. W. (1996). Telomerase activity in human germline and embryonic tissues and cells. Dev. Genet. 18,173 -179.[Medline]
Wu, K. J., Grandori, C., Amacker, M., Simon-Vermot, N., Polack, A., Lingner, J. and Dalla-Favera, R. (1999). Direct activation of TERT transcription by c-MYC. Nat. Genet. 21,220 -224.[Medline]
Yi, X., White, D. M., Aisner, D. L., Baur, J. A., Wright, W. E. and Shay, J. W. (2000). An alternate splicing variant of the human telomerase catalytic subunit inhibits telomerase activity. Neoplasia 2,433 -440.[Medline]
Zhao, Y. and Young, S. L. (1995). TGF-beta
regulates expression of tenascin alternative splicing isoforms in fetal rat
lung. Am. J. Physiol.
268,L173
-L180.
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||