spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Movies
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lenka, N.
Right arrow Articles by Fleischmann, B. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lenka, N.
Right arrow Articles by Fleischmann, B. K.
Journal of Cell Science 115, 1471-1485 (2002)
© 2002 The Company of Biologists Limited


Research Article

Quantitation and functional characterization of neural cells derived from ES cells using nestin enhancer-mediated targeting in vitro

Nibedita Lenka*,{ddagger}, Zhong J. Lu, Philipp Sasse, Jürgen Hescheler and Bernd K. Fleischmann

Institute of Neurophysiology, University of Cologne, Cologne, Germany
* Present address: National Centre For Cell Science, Pune University Campus, Ganeshkhind, Pune 411007, Maharashtra, India

{ddagger} Author for correspondence (e-mail: nibedital{at}yahoo.com )

Accepted 13 January 2002


    Summary
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
To gain insight into early events of neurogenesis, transgenic embryonic stem (ES) cells were generated using the enhanced green fluorescence protein (EGFP) reporter gene under the regulatory control of the neural stem cell marker, nestin. The expression of EGFP in undifferentiated ES cells suggested that the onset of endogenous nestin occurred before neurulation. Upon differentiation of ES cells, the EGFP expression became confined to the neural lineage and asynchrony in ES-cell-derived neural differentiation was evident. The EGFP intensity was prominent in the proliferative progenitors and unipolar neurons, whereas downregulation occurred in differentiating bi- and multipolar neurons. This was corroborated quantitatively using flow cytometry where maximal generation of neural progenitors was observed 4-12 days post-plating. The proliferative potential of neural progenitors as well as glia, in contrast to post-mitotic neurons, was also evident by time-lapse microscopy. The functional characterization of progenitors revealed an absence of voltage-activated inward currents, whereas the Na+ current (INa) was detected prior to Ca2+ currents (ICa) in differentiating neurons. Additionally, inhibitory receptor-operated channels could be detected at these early stages of development in bi- and multipolar neurons suggesting that the pre-committed progenitors had retained their intrinsic ability to give rise to functional neurons. This study sheds new light on early events of neurogenesis defining the quantitative and qualitative aspects and demarcating the functional neural cell types from ES cells in vitro.

Key words: ES cells, Nestin, EGFP, Neural progenitor, Neurogenesis


    Introduction
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Neurogenesis is considered to be the most complex event of organogenesis during embryonic development involving a precise signalling and cellular interaction cascade in order to generate a functional neural network. This comprises various subtypes of neurons, astroglia and oligodendroglia. Unlike the earlier belief that mammalian nervous system stem cells are confined to the embryo and that adult brain lacks the capacity to regenerate, recent studies demonstrate the presence of neural stem cells in both fetal and adult hypothalamus, olfactory bulb, subventricular zone and the dentate gyrus of hippocampus (Reynolds and Weiss, 1992Go; Gage, 2000Go; Bjornson et al., 1999Go; Doetsch et al., 1999Go; van der Kooy and Weiss, 2000Go). Since there is generally a recurrence of embryonic phenotypes in adults after injury (Laywell et al., 1992Go; Lendahl, 1997Go; Rossi et al., 1997Go), whether as a means of repair or merely a default state, it is mandatory to investigate the early embryonic events in order to understand the significance of this phenomenon. Hence, pluripotent embryonic stem (ES) cells recapitulating the in vivo events in a relatively precise manner may serve as an ideal model system for the investigation of early embryonic developmental processes (Okabe et al., 1996Go). In particular, tissue-specific promoter-mediated targeting is an efficient approach in the identification, isolation and functional characterization of lineage-specific populations in the heterogeneous cell mass of the ES-cell system (Kolossov et al., 1998Go). In the present study the ES cells have been targeted with neural-specific enhancer driving live reporter expression in order to understand early neurulation events.

The intermediate filament protein, nestin, a well known marker for neural stem cells, is expressed in the majority of mitotically active CNS and PNS progenitors (Lendahl et al., 1990Go; Lendahl, 1997Go; Cattaneo and McKay, 1990Go; Mujtaba et al., 1998Go); it is downregulated upon differentiation (Zimmerman et al., 1994Go; Lothian and Lendahl, 1997Go) and reported to reappear upon injury (Lendahl, 1997Go; Krum and Rosenstein, 1999Go; Namiki and Tator, 1999Go; Pekny et al., 1999Go). Thus, the cells expressing nestin show all the characteristic features of stem cells such as multipotency, self-renewal and regeneration. Hence, nestin could serve as an efficient candidate marker gene in order to unravel early neurogenic proceedings from ES cells in vitro. Unlike T{alpha}1 tubulin, the unipotent neuronal progenitor marker whose expression is confined only to the pre- and post-mitotic neurons (Wang et al., 1998Go; Roy et al., 2000aGo; Roy et al., 2000bGo), nestin represents a more broad spectral, multipotent neural lineage marker expressing not only in neurons but in glia as well (Hockfield and McKay, 1985Go; Messam et al., 2000Go). Thus, the generation and demarcation of both neurons and glia would pave the way in exploring the underlying mechanism(s) of neurogenesis as well as gliogenesis in the ES-cell model system.

Previous studies on the nestin gene using transgenic mice demonstrated that the second intron has the necessary cisacting enhancer motifs for driving the reporter gene expression in a neuron-specific manner in the developing CNS (Zimmerman et al., 1994Go; Lothian and Lendahl, 1997Go; Josephson et al., 1998Go; Lothian et al., 1999Go; Yaworsky and Kappen, 1999Go). Accordingly, the present investigation was carried out to identify, quantify and functionally characterize the ES-cell-derived, development-dependent, proliferating neuronal progenitors as well as the differentiating neurons based on nestin intron-II-driven EGFP expression. This study provides clues to the multifaceted and dynamic process of neurogenesis using the powerful model of stem cell differentiation in vitro that would otherwise have been a complicated task in vivo.


    Materials and Methods
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Vectors
The Nes 1852 tk/lacZ, a human nestin promoter vector construct was a kind gift of Urban Lendahl, Sweden (Lothian and Lendahl, 1997Go). The 2 Kb nestin intron II enhancer-tk promoter fragment was excised from the aforementioned vector construct using HindIII and NotI restriction enzymes. Subsequently, this fragment was subcloned into the pEGFP1 vector (Clontech, Germany) at the SmaI site by blunt end ligation and termed h-Nestin-EGFP, where the EGFP reporter is under the regulation of the nestin-tk promoter. The insertion and orientation of the promoter to pEGFP vector was verified by both restriction digestion and sequencing using an automated sequencer (ABI). To obtain the tkEGFP vector construct, the nestin intron II was released from h-Nestin-EGFP by SalI restriction digestion and by subsequent recircularization of the vector.

Cell culture and transfection
The ES cells of the line D3 were maintained as described before (Wobus et al., 1991Go). Briefly, ES cells were grown on inactivated feeder cells in DMEM supplemented with 15% fetal bovine serum (FBS), non-essential amino acids, 2 mM glutamine, 50 µg/ml Penn-Strep (all from Gibco BRL, Germany), 0.1 mM ß-mercaptoethanol (Sigma, Germany), and 1000 U/ml recombinant murine leukemia inhibitory factor (LIF, ESGRO, Gibco). In separate experiments, following linearization using the HindIII restriction enzyme ~5x106 cells were transfected independently by electroporation using ~30 µg of the h-Nestin-EGFP or tkEGFP reporter constructs, respectively, following the standard protocol. The NeoR clones were picked after 10-12 days of G418 selection and propagated using the same medium. G418 selection was maintained throughout the propagation period.

Neuronal differentiation
Differentiation of ES cells was initiated by cell aggregation following the hanging drop method (Wobus et al., 1991Go) in DMEM supplemented with 10% FBS. All-trans-retinoic acid (RA) was used as the inducing agent for neuronal differentiation as described (Strubing et al., 1995Go) with slight modifications. The neural differentiation was also monitored using the conditioned medium (Okabe et al., 1996Go). Since the time window (~7-10 days post-plating) for optimal neural progenitor generation was similar irrespective of the medium used, the data from RA-induced progenitors are presented here for convenience. In brief, following trypsinization, the ES cells (500cells/20µl drop) were exposed to RA (10-7 M) for 3 days during hanging drop followed by suspension culture of embryoid bodies (EBs) for 4 days and plating without RA. Alternatively, RA was added to the medium while plating the EBs and the medium was replenished with fresh medium without RA on the fourth day post-plating (i.e. d7+4).

RT-PCR
Total RNA was isolated from the undifferentiated EGFP-positive transgenic nestin ES-cell clones and the wild-type ES-cell line D3, grown with or without feeders, as well as from murine blastocysts using high pure RNA isolation kit (Roche Molecular Biochemicals, Germany). To ascertain the presence of nestin transcripts in these cells, the total RNA was subjected to reverse-transcription-based PCR following the manufacturer's instructions (Gibco-BRL). The nestin-specific primers (5' GGATACAGCTTTATTCAAGG 3' and 5' CAGCCGCTGAAGTTCACTCT 3'; GenBank, accession no. C78523) were designed from the retrieved mouse cDNA sequence, which also corresponded to the C-terminus of the latest reported full length mouse nestin gene (GenBank accession no. AF076623) at positions 5959-5940 and 5481-5500, respectively. The house-keeping HPRT (hypoxanthine phosphoribosyltransferase) (Johansson and Wiles, 1995Go) and ß-actin primers were used as internal positive controls for PCR and designed accordingly to decipher the genuineness of amplified products, based on their size from cDNA, but not from contaminating genomic DNA. The RNA samples without the reverse transcriptase served as the negative control, and the PCR product from each sample was resolved on the agarose gel and observed under a UV-transluminator.

FACS analysis
The EGFP expression of ES-cell-derived clones was analyzed at various developmental stages using a FACSCaliburTM flow cytometer (Becton Dickinson) equipped with a 488 nm argon-ion-laser (15 mW) as described (Kolossov et al., 1998Go). In brief, about 10,000-50,000 viable cells were analyzed per sample after isolation using trypsinization (0.1% trypsin and 0.01% EDTA) for 2-5 minutes at 37°C. Subsequently, the cells were resuspended by gentle trituration using PBS containing 1 mM Ca2+ and 0.5 mM Mg2+. Untransfected D3 line ES cells were used as negative controls. The emitted fluorescence of EGFP was measured in log scale at 530 nm (FITC band pass filter) and analyses were performed using CellQuest® software (Becton Dickinson).

Immunocytochemistry
The specificity of the nestin expression was verified by immunocytochemistry using antibodies against neurons and glia following the standard protocol. In brief, the ES cells and EBs at various stages of development grown on glass coverslips were washed with 0.1 M PBS, pH 7.4 and fixed with 4% paraformaldehyde for 20 minutes. After washing again with PBS the cells were permeabilized with solution containing 0.25% Triton X-100 and 0.5 M ammonium chloride in 0.25 M TBS, pH 7.4 for 10 minutes and blocked with 4% goat serum and 0.8% BSA for 1 hour. Subsequently, the cells were exposed to either of the primary antibodies: anti-nestin (Rat-401, DSHB, University of Iowa), anti-MAP2, anti-synaptophysin or anti-GFAP (all from Sigma chemicals) for 3 hours at room temperature. After washing (0.25 M TBS, three times for 10 minutes each), the cells were treated with Cy3-conjugated secondary antibody for 1 hour at 37°C for fluorescent labelling. Finally the cells were washed three times with TBS and dehydrated with ethanol gradients, followed by xylene treatment and mounting with entellan on glass slides. In each case the negative control was performed with the substitution of respective primary antibodies with goat pre-immune serum. The slides were observed under a fluorescent microscope to detect EGFP as well as Cy3-labeling.

Dissociation of EBs and preparation of single cells
For isolation, 12-16 EBs were dissociated using collagenase B (Roche Molecular Biochemicals, Germany) and re-plated on gelatin (0.1%)-coated glass coverslips as described (Maltsev et al., 1994Go). In brief, EBs were dissected and rinsed with PBS followed by collagenase B treatment (0.1% in PBS) for 30 minutes at 37°C. Subsequently, collagenase was replaced with a medium containing: 85 mM KCl; 30 mM K2HPO4; 5 mM MgSO4-7H2O; 1 mM EDTA; 5 mM Na2ATP; 5 mM Na-Pyruvate; 5 mM Creatin; 20 mM taurin and 20 mM glucose; pH 7.2). The cells were stirred slowly for 30 minutes, suspended by gentle trituration in DMEM medium and plated onto gelatin-coated glass coverslips. In initial experiments the central and peripheral regions of the EBs were separated and dissociated individually. Since the pattern of differentiation was similar in these two preparations, whole EBs were used for dissociation. Single isolated cells were used for immunocytochemical characterizations after 2-5 days of re-plating either with parallel cultures or with the same, subsequent to electrophysiological investigations.

Estimation of EGFP intensity and electrophysiology
The semiquantitative estimation of EGFP intensity was performed as described (Kolossov et al., 1998Go). For the analysis, the EGFP fluorescence intensity comprising the whole area of the cell was integrated and average fluorescence intensities determined in counts.

For patch clamp recordings, isolated neurons of different developmental stages were investigated, using the whole-cell patch clamp technique (Hamill et al., 1981Go). The cells were voltage-clamped using an EPC-9 amplifier (Heka, Germany), held at -80 mV and depolarizing pulses or ramps were applied (for detail, see figure legends). For the registration of inward currents ramp depolarizations were performed and INa was inhibited by tetrodotoxin (TTX, 0.1 µM). For estimation of voltage-dependent Ca2+ currents, the extracellular solution was exchanged to a Na+-free solution containing Ba2+ as charge carrier. The expression of the various subtypes of voltage-dependent Ca2+ channels was tested using selective antagonists [Isradipine, {omega}-Conotoxin GVIA ({omega}-CgTX), {omega}-agatoxin IVA ({omega}-AgaTX), Almone Labs, Israel], which were bath added. For the recording of receptor-operated currents, substances were applied (15 milliseconds) through a puffer pipette connected to a pressure ejection system (General Valves, USA) placed into the vicinity of the cell of interest (holding potential (HP) -80 mV). The receptor-operated currents were characterized by applying competitive antagonists via the gravitational perfusion system. The ionic nature of these currents was analyzed using subtracted voltage ramps. Data were acquired at a sampling rate of 10 kHz, filtered at 1 kHz, stored on hard disk and analyzed off-line using the Pulse-Fit (Heka) software package. Averaged data are expressed as means±s.e.m. Membrane capacity was determined on-line using the Pulse acquisition software program (Heka). Statistical analysis was performed using paired or unpaired Student's t-test, and a P value of <0.05 was considered significant.

The glass coverslips containing the cells were placed into a temperature-controlled (37°C) recording chamber and perfused continuously with extracellular solution by gravity at a rate of 1 ml/minute. Substances were applied by exchanging the solution in the chamber, a 90% volume exchange was achieved within approximately 20 seconds. Patch pipettes (2-4 M{Omega} resistance) from borosilicate glass from Clark (Electromedical Instruments, UK) were pulled using a Zeitz puller (DMZ, Germany). The solutions used had the following composition. Standard external solution, 140 mM NaCl, 5.4 mM KCl, 1.8 mM CaCl2, 1 mM MgCl2, 10 mM glucose and 10 mM Hepes (pH 7.4, adjusted with NaOH). External solution for measurement of IBa: 120 mM D(-)-N-methylglucamine, 10.8 mM BaCl2, 5.4 mM CsCl, 1 mM MgCl2, 10 mM glucose and 10 mM Hepes (pH 7.4, adjusted with HCl). Normal intracellular solution: 50 mM KCl, 80 mM K-Asparate, 1 mM MgCl2, 3 mM Mg2ATP, 10 mM EGTA and 10 mM Hepes (pH 7.2, adjusted with NaOH). Internal solution for recording of inward currents: 120 mM CsCl, 1 mM MgCl2, 3 mM Mg2ATP, 10 mM Hepes and 10 mM EGTA (pH 7.2, adjusted with CsOH). All these chemicals were purchased from Sigma (Germany). The toxins were aliquoted, diluted in normal external solution and frozen at -22°C prior to use.

Online supplemental material (time-lapse microscopy)
For live monitoring of neurogenesis, one day after isolation (d7+7) the cells were continuously observed for 3 days. An inverted microscope (Axiovert 100, Zeiss) equipped with a movable computer controlled state (Nikon, Germany), an objective 20x (Plan-Neofluar, Zeiss) and a temperature/CO2-controlled chamber (Nikon) were used. Cells were monitored at 30 minute intervals using alternate transmission and fluorescent excitation light with a conventional halogen lamp and a FITC filter set. Images were acquired using a colour video camera (Sony, DXC 950P, AVT Horn, Germany) controlled by the Lucia software (Nikon) and digitized on-line via a video frame grabber card (Matrox Corona, Nikon). For fluorescence pictures, the integration mode of the camera (10 single pictures) and a video-based buffer device (Sony MPU-F100P, AVT Horn) were employed. Movies 1 and 2 depict Fig. 5A and B, respectively, showing the neuro- and gliogenesis from neural progenitors. The cells subsequent to the monitoring were subjected to immonocytochemical verification and neural specification using neuronal and glial specific antibodies (see http://jcs.biologists.org/supplemental ).



View larger version (114K):
[in this window]
[in a new window]
 
Fig. 5. Time-lapse experiments showed live the neural progenitor proliferation and differentiation into neurons as well as glia. (A) Transmitted light and fluorescence monitoring of isolated EB-derived cells. Starting from a single progenitor (arrow), characterized by its typical morphology and prominent EGFP expression, cell division (2.5 h, 6 h, 36.5 h) and differentiation into neuronal (unipolar, 11.5 h; bipolar, 12 h) cells (arrowhead) was observed in a representative experiment. Upon migration and further differentiation the EGFP fluorescence declined. (B) In line with the retained capacity of proliferation of glia (arrow), prior to division rounding-up of the glial cell was noticed (54.5 h). After division, migration, cellular interaction as well as flattening of the cells occurred. The cell labelled with arrowhead is likely of other origin. Bars, 30 µM (A); 50 µM (B).

 


    Results
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Establishment of stable transgenic nestin ES-cell clones and monitoring of EGFP expression
A number of stable G418 resistant transgenic ES-cell clones of the line D3 were generated by transfection of the h-Nestin-EGFP construct. Several of these selected clones were differentiated into various neural phenotypes following the in vitro differentiation protocol as described before using retinoic acid as the inducer and simultaneously monitored for EGFP expression. 96% of the G418-resistant nestin ES-cell clones (n=100) were observed to be EGFP positive even at the undifferentiated state (Fig. 1A-C). Typically, the clones exhibited a heterogeneous expression pattern of EGFP during propagation on feeder (Fig. 1B,C) or feeder-free cultures indirectly implying the nestin transcription to be active even in undifferentiated ES cells prior to any lineage commitment. Since almost all of our selected, undifferentiated ES-cell clones happened to be EGFP positive, the possibility of non-specificity due to positional effect could be ruled out. Additionally, the non-specific EGFP expression pattern due to the constitutively active heterologous thymidine-kinase (tk) basal promoter was also excluded by performing another set of transfections using the tkEGFP promoter construct without the nestin intron II segment. In less than 15% of these G418-resistant clones only weak EGFP expression was detected (Fig. 1D,E). This is in line with the observation by Lothian and Lendahl who demonstrated the absence of any ectopic lacZ expression driven by the same tk basal promoter in transgenic mice (Lothian and Lendahl, 1997Go).



View larger version (89K):
[in this window]
[in a new window]
 
Fig. 1. Human nestin intron-II-driven EGFP expression in undifferentiated ES cells and corresponding immunocytochemical expression pattern. (A) A single NeoR clone after electroporation of h-Nestin-EGFP construct and G418 selection for 12 days shows heterogeneous EGFP expression. (B,C) The EGFP expression in ES cells (arrow) remains patchy during propagation on mitotically inactive feeders (arrow head) in clone-1. (D,E) Weak EGFP expression in one of the few (<15%) EGFP-positive ES-cell clones transfected with tkEGFP. (B,D) Combined transmission and fluorescent light; (C,E) fluorescence light alone. (G,H) A complete overlap between EGFP expression (G) and (H) nestin-immunoreactivity was observed in undifferentiated ES cells during feeder-free propagation. Bars, 100 µM (A), 75 µM (D,E), 50 µM (B,C,G,H).

 

Validation of early onset of endogenous nestin and concomitant EGFP expression
To correlate nestin-driven EGFP expression in undifferentiated ES cells with endogenous nestin expression, both, RT-PCR and immunostaining were performed. As shown in Fig. 2, by RT-PCR with total RNA isolated from undifferentiated ES cells from one of the EGFP-positive transgenic clones (clone-1) as well as from untransfected D3 cells grown in presence or absence of feeders using sequence specific nestin primers, a PCR product of the expected 478 bp size was amplified. Interestingly, the nestin product was detectable in the murine blastocyst RNA (Fig. 2, lower panel, lane 14), but with a comparatively low intensity. This is probably caused by either a low transcript level or low initial RNA content in the RT reaction containing the blastocyst sample because, by using two housekeeping primers (HPRT and ß-actin), the respective apparent product intensities with the blastocyst sample were low compared with that of other samples. Hence, we took double the quantity of reverse transcribed first strand from the blastocyst sample in order (1.5 times loading sample volume on gel) to scale up the visible intensity of the product during PCR (Fig. 2, lower panel, lane 8). We further corroborated this finding by immunostaining using a monoclonal antibody against nestin. All the EGFP-positive cells were nestin positive in the feeder-free cultured transgene ES cell clone-1 (Fig. 1G,H). Immunostaining with a monoclonal antibody against nestin in the feeder-free cultured transgenic ES cell clone-1 indicated that all EGFP-positive cells were nestin positive (Fig. 1G,H). In addition, preliminary studies indicate that the inner cell mass (ICM) of murine blastocysts is nestin positive (data not shown), confirming the observation in ES cells. Unlike earlier reports on nestin expression (Okabe et al., 1996Go; Lee et al., 2000Go) our findings imply that its onset occurs much earlier than neural plate induction at E7.5.



View larger version (71K):
[in this window]
[in a new window]
 
Fig. 2. RT-PCR revealed the presence of nestin transcripts in undifferentiated ES cells as well as murine blastocysts. The upper panel shows nestin transcripts from D3 undifferentiated ES cells (lane 2), transgenic h-Nestin-EGFP ES cells (n-ES cells; lane 5) grown on feeders and from D3 undifferentiated ES cells grown without feeders (lane 8). The lower panel shows nestin transcripts in the transgenic ES cells without feeders (lane 2) and in the murine blastocysts (lanes 8, 14). The length of the nestin PCR product corresponds to the expected size of 478 bp. The corresponding products for housekeeping HPRT (upper panel, lanes 4,7,10; lower panel, lanes 5,10) and ß-actin (lower panel, lanes 6,12) are shown as controls. Lanes 3,6,9 (upper panel) and 3,4,7,9,11,13 (lower panel) represent the respective negative controls where the reverse transcriptase was omitted from the reaction.

 

Nestin intron-II-driven EGFP expression profile during neural differentiation and neurogenic progression
The transition from uncommitted ES cells to a neural lineagedefined state was brought about by RA exposure of EBs. To rule out clonal diversity several (n=6) of the clones were analyzed to examine the nestin intron-II-driven EGFP expression profile and specificity in ES-cell-derived neurons during differentiation. During cell aggregation and commencement of differentiation, localized expression of EGFP in EBs marked the transition. Moreover, under no time points studied was there ever complete absence of EGFP-expressing cells in the EBs. After 1 or 2 days post-plating (d7+1/2), the EBs showed a few intense bright shining areas (Fig. 3A,B). By d7+2/3, the cells at the periphery exhibited an epithelial phenotype implicating the differentiation into ectodermal lineage. Starting from d7+4, outgrowths from the central part of the EB with areas of intense EGFP expression were detected (Fig. 3C,D). This further signified the presence of neuroepithelial cells as confirmed by immunostaining with the nestin antibody (Fig. 3J,K).



View larger version (94K):
[in this window]
[in a new window]
 
Fig. 3. EGFP expression profile during differentiation and neural specification. The expression was prominent in progenitors and downregulated in differentiating neurons. Localized EGFP expression in the EB (A,B; d7+2) and in outgrowths (arrow) of the EB (C; d7+4) post-plating. (C) Arrowhead, central part of EB. (D) EBs (d7+7) show differentiating neurons (arrow) at the periphery with EGFP expression (see inset); arrowhead shows the central part of the EB. (E) d7+14; three clusters of neurons (1,2,3) with short and long processes. (F) (d7+20); with further plating time cluster 2 shows an extension of neurite outgrowths from the central cell mass. (G,H) Magnified view of the same cluster, where some neurites are still EGFP positive. The arrowhead indicates the presence of EGFP-positive neural progenitors in the vicinity of mature neurons, and the arrow indicates the lengthening of neurite processes with longer plating time from d7+14 to d7+20 (E-H). (J,K) Almost all of the EGFP-expressing cells (J) in EBs (d7+7) are nestin positive (K); the yellow colour indicates the superimposed pattern between EGFP and Cy3. (L,M) In the differentiated neurons labelled with MAP2 (M, double filter), a weak or no EGFP signal (L, d7+7) was observed. Combined transmission and fluorescent light: A,C,D-F,G. Fluorescent light alone: B,H,J,L,inset D. Bars, 50 µM (A,B,inset D); 100 µM (C,D,G,H,J-M); 250 µM (E,F).

 

By d4-6 of plating, few EGFP-positive uni-/bi-/multipolar neurons were observed at the periphery of the differentiating EBs along with the glial cells, most probably the radial glia (Rat 401 positive) (Hockfield and McKay, 1985Go). However, the number of neurons with distinct neurite outgrowths significantly increased with time after plating, associated with weakening of EGFP expression (Fig. 3D). By d8-15, bundles of neurons forming extensive networks were observed (Fig. 3E-H). As would be expected, progressive neurogenesis was accompanied by an increase in the number and the length of neurite outgrowths. (Fig. 3, compare E with F-H). Most of the terminally differentiated neurons lost EGFP, thus mimicking the endogenous nestin expression pattern as well as reporter gene expression in vivo (Zimmerman et al., 1994Go; Lothian and Lendahl, 1997Go). Nevertheless, in many differentiating neurons with distinct neurite outgrowths weak EGFP expression was preserved; this was probably due to accumulation because of its slow metabolic rate (Fig. 3F-H). No significant differences were noticed in the neural differentiation pattern, irrespective of the application of RA, during hanging drop preparation or plating in contradiction to an earlier report (Rohwedel et al., 1999Go).

Neural specificity of EGFP expression during differentiation
Immunocytochemical studies on whole EBs (Fig. 3J-M) confirmed neural specific confinement of nestin enhancer-driven EGFP expression at different developmental stages (d7+4 to d7+12). A similar neural differentiation pattern was observed in isolated cells (Fig. 4A-K). All EGFP-positive cells stained with the antibody directed against nestin, proving the neural-specific expression of EGFP. These EGFP+/nestin+ cells (Fig. 3J,K; Fig. 4C-D) were thought to be neural progenitors because of their proliferation (BrDU+ or Ki67+; data not shown) (Fig. 5; time-lapse observation) and differentiation potential, giving rise to neurons with uni-, bi- and multipolar morphologies as well as glia; as discerned by immunostaining with both neuron (synaptophysin, MAP2) and glial (GFAP) specific antibodies, respectively (Fig. 3L,M; Fig. 4E-K). The differentiated bi- and multipolar neurons with longer processes were either weak or negative for EGFP (Fig. 4A,B), but stained positively with MAP2, a marker for post-mitotic neurons (Fig. 3L,M; Fig. 4J,K). These cells maintained synaptic connections as evident from synaptophysin staining (Fig. 4G,H) and appeared to form networks with adjacent neurons and glia. More often differentiating neurons grew on top of or adjacent to a monolayer of flat glial cells establishing extensive connections with each other (Fig. 4J,K). These observations further confirmed that the EGFP/nestin positive neural progenitors retained the ability of multipotentiality since they were able to generate MAP2-positive neurons and GFAP-positive glial cells upon differentiation. Notably, at every developmental stage investigated there was a representative population from proliferating (BrDU+; Ki67+; nestin+) and differentiating cells (MAP2+; GFAP+), indicating an asynchronous profile in neural differentiation.



View larger version (74K):
[in this window]
[in a new window]
 
Fig. 4. Isolated cells mimic neurogenesis observed in whole EBs (d7+7). (A,B) Differentiating neurons with bipolar-(arrow) and multipolar (arrowhead) morphology were seen after plating of isolated cells A: combined transmission and fluorescence; B: fluorescence. (C,D) A high overlap (D, yellow) between EGFP expression (C) and nestin labelling was observed. Besides the generation of neurons, EGFP-positive and -negative glial cells (E) were identified based on GFAP staining (F, superimposed). Flat glial cells were weak/negative for EGFP (arrowhead), while elongated fibre-like glial cells were EGFP positive (arrow). (G,H) The formation of synaptic connections between isolated neurons was confirmed by synaptophysin staining (H). As expected for differentiated neurons, low or no EGFP signal (G) was detected in synaptophysin-positive cells. Little overlap (K, superimposed) between MAP-2 staining (K) and EGFP expression (J) was detected. The flat glial cells (green) and differentiating neurons (red) were found to closely associate. Bars, 25 µM.

 

Monitoring of neural differentiation with time-lapse microscopy
A clearer picture of neurogenic progression emerged in time-lapse experiments. As seen in Fig. 5A, a single EGFP-positive progenitor was observed to divide into two and then into three cells. The triplet underwent positional changes between 6 and 10 hours after the inception of monitoring (see movie; http://jcs.biologists.org/supplemental ). Subsequently, one of these cells underwent morphogenic change and showed neurite outgrowth to become uni- and then bipolar. At subsequent time periods the extension of a neurite in association with migration and interaction with other cells became evident from this observation (Fig. 5A). One of the other two cells exhibited further divisions at 23 hours (data not shown) and 36.5 hours, indicating the probable occurrence of self-renewing asymmetric division and retention of stem/progenitor potential. Many of the bipolar neurons did undergo a further morphogenic change into multipolar ones, depending on their interaction with neighbouring neurons or glia (data not shown), whereas some remained bipolar until the end of monitoring (Fig. 5A). These changes indicate the co-existence of a diverse phenotypic population of mature neurons and neural progenitors at any given time during neuronal differentiation from ES cells in vitro. Similarly, the generation of cells with glial phenotype with subsequent division (Fig. 5B; 55 hours and 58.5 hours), migration and interaction with each other could be clearly depicted from EGFP-positive progenitors (Fig. 5B; 55-66.5 hours). The noteworthy feature was both symmetric and asymmetric division of progenitor and, unlike the neuronal cells, the glial cells underwent further division after undergoing transformation from a flat (Fig. 5B; 54 hours) to a round phenotype (Fig. 5B; 54.5 hours) like the progenitor. However, in both cases weakening of EGFP remained associated with progressive morphogenesis into neuron and glia.

Flow-cytometric quantification of neurogenesis from ES cells in vitro
The qualitative aspect of neurogenesis in vitro was complemented by a quantitative assessment performing flow-cytometry at different stages of development. In several of the EGFP-positive clones analyzed (n=4), the undifferentiated ES cells exhibited about 40-50% of bright and weak EGFP fluorescence each when compared with D3 wild-type ES cells (Fig. 6A). Upon differentiation by cell aggregation, RA treatment and prior to plating (Fig. 6A; left panel, 7+0), there was a clear leftward shift in the EGFP peak (28% weak: 20-100 intensity range; and 2% bright: 100-1000 range) with the majority (70%) of cells being EGFP negative (1-20 range). In the post-plating EBs, EGFP fluorescence further intensified in line with the microscopic observation pattern reported above. About 1-6% of the total bright shining population of cells from the RA-treated group (clone-1) was very intense after plating, with EGFP intensity levels beyond the 1000 range (Fig. 6A). This population was observed even up to 24 days after plating. As seen in Fig. 6A, there was a rightward shift in the EGFP-positive peak in the 4 day post-plated EBs (70% EGFP+: 20-10,000 range; 30% EGFP-: 1-20 range) indicating a biphasic distribution pattern that remained almost the same in the 10-12 day post-plated EBs (52-57% EGFP+ and 43-48% EGFP-) and gradually decreased with the course of time from 12 to 24 days post-plating (20% EGFP+ and 80% EGFP-). This clearly complied with an increase in the number of post-mitotic differentiating neurons during the course of differentiation as directly monitored with time-lapse microscopy. The time course of the neurogenic development indicated that the percentage of the brightest EGFP-positive (EGFP+++: 1000-10,000 intensity range) progenitor population in the plated EBs remained stable between d7+4 (7.2±2.0%) and d7+10/12 (6.0±1.3%) of plating and declined to 2.5±1.0% after 24 days of plating (Fig. 6B). Similarly, the proportion of cells belonging to the bright EGFP-positive (EGFP++: 100-1000 range) group showed gradual decline in EGFP intensity (from 27.9±3.3% to 10.9±5.0%), implying the loss of residual EGFP in these differentiating neural populations during a longer plating period. By contrast, the proportion of weak EGFP-positive cells (EGFP+: 20-100 range) remained unchanged (24±11.3% to 28.7±2.3%) and an almost exponential rise in the EGFP-negative cells from 36.1±2.0% to 62.6±17.3% could be observed between day 4 and day 24 after plating (Fig. 6B). Taken together, these data suggested an asynchronous neural differentiation profile and that the maximum number of neural progenitors was generated from ES cells in vitro between 4 and 12 days after EB plating. A similar profile was observed in EBs treated with RA during plating (data not shown).



View larger version (33K):
[in this window]
[in a new window]
 
Fig. 6. The quantitative evaluation of in vitro neurogenesis using flow-cytometry revealed a development-dependent distribution pattern. A clear delay in the generation of strong EGFP-positive progenitors was observed in the retinoic acid untreated (right panels) versus the treated (left panels) EBs. The maximal generation of progenitors occurred between d4 and d10 after plating in the RA-treated cells. Notice the decline in the number of EGFP-positive cells accompanied by a compensatory increase in EGFP-negative cells, suggesting a transition to the differentiated neuronal population. While the population of undifferentiated D3 ES cells (A) was used for calibration of the system (estimate of the range of auto-fluorescence), a relatively homogenous EGFP expression was noticed in the undifferentiated h-nestin-EGFP cells (B). The EGFP fluorescence intensity on the horizontal axis is displayed as log scale; the vertical axis represents the percentage of gated cells. Numbers in the top-left corner indicate the differentiation stage. (B) A quantitative evaluation of the in vitro neurogenesis was obtained by averaging two to three experiments per time point of differentiation. This analysis clearly showed that the decline in the strong EGFP-positive (EGFP+++ and EGFP++) and weak EGFP-positive (EGFP+) cell population was accompanied by a parallel increase in EGFP-negative (EGFP-) cells.

 

In contrast to the RA-treated groups, cells without RA exposure displayed intensities hardly beyond the 103 log and the majority (71-90%) of post-plated EBs were EGFP negative (Fig. 6A, right panel). Additionally, the percentage of EGFP-positive cells increased from 9% (d7+4) to 28% (d7+24) after two to three weeks of plating. This clearly indicated the effect of RA on early onset neural specification and neurogenesis that was otherwise delayed in the untreated ones. It was further corroborated by immunocytochemical findings where the RA-untreated EBs displayed low percentage of MAP2 immunoreactivity after 2-3 weeks of plating (data not shown).

Functional features of transgenic nestin ES-cell-derived neurons
It is well known that ion channels determine development as well as function of neurons. Therefore, we have focused on the development-dependent expression of ion channels, in particular voltage-activated inward currents. In fact, the live labelling of ES-cell-derived neurons enabled for the first time the investigation of ion channel expression in isolated neurons at very early stages of neurogenesis. Since the differentiation of ES-cell-derived neurons was found to be asynchronous, cells undergoing functional characterization were classified according to the following criteria: (1) time after plating; and (2) morphological characteristics and semi-quantitative assessment of EGFP expression. Isolated neurons from d3-19 after plating were investigated using the classic whole cell patch-clamp technique combined with single cell fluorescence imaging to estimate EGFP intensity. In line with our previous observations, neural progenitors (1804±223, n=25) and unipolar neurons (1585±457, n=25) were characterized by significantly higher EGFP intensities than more differentiated neurons (bipolar neurons, 545±86, n=66; multipolar neurons, 482±77, n=56). Many of the multipolar neurons, probably of a more advanced state of differentiation, were without detectable fluorescence (n=8).

When the expression pattern of ion channels was characterized in the four population of neurons, no voltage-dependent ion currents were detected in neural progenitors/apolar cells during the entire developmental stage (Fig. 7A, n=25). Indeed, at this stage ramp depolarizations as well as single voltage steps (data not shown) did not yield macroscopic currents. EGFP-positive neural progenitors were carefully selected (morphological criteria) in order to avoid contamination by other cell types. The unipolar EGFP-positive neurons (Fig. 7B) expressed voltage-dependent outward rectifying currents (n=7), whereas no voltage-activated inward currents, neither INa nor IBa, could be detected in the large majority of cells (22 out of 24). The outward rectifying currents recorded in the bipolar as well as multipolar neurons were identified as K+ currents based on their sensitivity towards the K+ channel blocker, 4-aminopyridine (4-AP). 4-AP (2 mM) inhibited 73.69±8.2% of the aggregate outward current (HP -80 mV, step potential +50 mV) (n=6, data not shown). Interestingly, at the early developmental stage (EDS, d7+3/4), INa but not IBa (Fig. 7E) was detected in 86% of bipolar neurons (n=7), whereas almost all (80%) the multipolar neurons (n=5) expressed both INa and IBa. At subsequent stages (LDS, d7-19) all the bipolar and multipolar neurons functionally expressed both currents. INa was further characterized using the Na+ channel selective antagonist TTX which, as expected for neuronal Na+ channels, blocked INa completely at a concentration of 0.1 µM (Fig. 7C,D). INa densities in bipolar neurons increased significantly with plating time (Fig. 7F) from 48.1±8.3 to 106.4±10.1 pA/pF (n=60) and in multipolar neurons (data not shown) from 40.4±10.9 to 80.7±7.0 pA/pF (n=50), respectively. INa density in the bipolar neurons was higher than that in the multipolar neurons (Fig. 7G). To further envisage whether there were qualitative and/or quantitative differences in the expression pattern of IBa subtypes during development, we investigated both bipolar and multipolar neurons by applying selective antagonists. In four typical experiments of bipolar neurons we found that the L-type Ca2+ channel antagonist Isradipine (3 µM) suppressed 22.7±3.6% of the aggregate IBa, the N-type specific Ca2+ channel blocker {omega}-CgTX (3 µM) suppressed 14.2±3.7% and the P/Q type channel blocker {omega}-AgaTX (0.1 µM) suppressed 8.5±1.6%, respectively (Fig. 8B,C). The remaining Cd2+- sensitive (50 µM CdCl2) component amounted to 54.6±8.2% of control IBa. Similarly, in four typical multipolar neurons the fraction of different Ca2+ channel subtypes amounted to: L-type, 27.3±1.9%; N-type, 9.1±3.2%; P/Q type, 16.2±3.7%; and othertypes, 47.4±5.6%, respectively (Fig. 8D).



View larger version (23K):
[in this window]
[in a new window]
 
Fig. 7. The functional characterization of EGFP-positive cells demonstrated a development-dependent pattern of ion channel expression. Ramp depolarizations (150 ms from -100 mV to 50 mV, Hp -80 mV) showed that at the apolar stage (A) no voltage-dependent ion channels were detected, whereas unipolar stages (B) expressed voltage-activated outward currents. Starting from the bipolar stage, TTX hypersensitive INa was detected (C,D). In the early developmental stage (EDS), bipolar neurons INa were detected first, whereas IBa appeared at later stages (E). While INa density in bipolar neurons increased (P=0.01) during further development (F), the mean current density in multipolar neurons was less (P=0.05) than that of bipolar neurons (G).

 


View larger version (29K):
[in this window]
[in a new window]
 
Fig. 8. Functional expression of IBa during early stages of neuronal development. (A) The IBa current-voltage relationship (voltage steps lasting for 150 milliseconds, from -60 to +50 mV in 10 mV increments, HP -80 mV) in a representative bipolar LDS neuronal cell. The threshold of activation was between -60 and -50 mV and peak currents were measured at -10 mV. (B) The fraction of different IBa subtypes composing the whole cell current was evaluated using selective antagonists. (C,D) The percentage of the different current components did not significantly differ between bipolar- and multipolar neurons.

 

Since receptor-operated ion channels are known to play an essential role not only in carrying out fast synaptic transmission but also in the mediation of trophic signals, and migration and synaptic arrangement during neuronal development, we tested their functional expression at different time points during neurogenesis. The neural progenitors (n=3) and unipolar neurons (n=4) did not respond to {gamma}-aminobutyric (GABA), glycine, kainate and NMDA. Clear agonist responses to GABA (1 mM) and glycine (1 mM) were detected (Fig. 9A,B) in bipolar (n=8, current density 52.1±22.0 pA/pF) and multipolar neurons (n=8, current density 119.1±51.1 pA/pF). Moreover, as expected, the receptor-operated currents were blocked by the competitive antagonists bicuculline (100 nM, n=8) and strychnine (30 µM, n=8), respectively (HP -80 mV; Fig. 9A,B). To further confirm the ionic nature of the GABA and glycine-evoked currents, voltage ramps in the presence of the agonist were substracted from control ramps. As can be seen in the inset of Fig. 9A, the subtracted voltage ramps for GABA yielded a reversal potential of -28.3±1.1 mV (n=5), a value close to the calculated Cl- equilibrium potential of -28.3 mV at 35°C. We could also observe kainate responses in bipolar (n=8) as well as multipolar cells (n=7), however current amplitude was low with slow activation kinetics (data not shown).



View larger version (20K):
[in this window]
[in a new window]
 
Fig. 9. Functional expression of receptor-operated channels during early neuronal development. GABA (A) as well as glycine (B) evoked fast-activating and inactivating inward currents (HP -80 mV) in bipolar strong EGFP-positive cells. Co-application of the selective antagonists Bicuculline (A) and Strychnine (B) almost completely inhibited the activation of GABA- and glycine-evoked inward currents, respectively. The ionic nature was determined by performing ramp depolarizations (from -100 mV to 50 mV in 150 milliseconds) in the presence and absence of the agonist yielding a reversal potential of -27 mV, as expected for a Cl- current (see inset in A).

 


    Discussion
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Nestin as the name spun from neuro-epithelial stem cell has been considered to be an efficient marker for proliferating cells whose expression is downregulated upon differentiation. Hence, examining the nestin intron-II-driven EGFP expression in our ES-cell model helped not only in demarcating the progenitor population and neural subtypes but also in unravelling the quantitative, qualitative and functional neurogenic developmental pattern both prior and subsequent to the onset of neurogenesis.

Neural ontogeny and nestin expression
Nestin expression in transgenic mice was reported to occur as early as stage E7.5 (Zimmerman et al., 1994Go; Lothian and Lendahl, 1997Go; Josephson et al., 1998Go; Lothian et al., 1999Go; Yaworsky and Kappen, 1999Go), although it remains unclear whether or not it was investigated at earlier stages. In the transgenic ES-cell model and in murine blastocysts we demonstrated that nestin was expressed before lineage specification. The reported cDNA sequence in the GenBank database from 3.5 dpc murine blastocyst (accession no. C78523) having sequence similarity to mouse, rat, and human nestin genes corroborated our findings on the presence of nestin transcript in vivo. Similar observations on early expression of other tissue-specific cytoskeletal proteins have also been described (Bain et al., 1995Go). Recently, Streit et al. reported that neural induction in chick embryo occurred before gastrulation, indirectly implicating that nestin, being a neural stem cell marker, is probably evolutionarily conserved and might express prior to gastrulation (Streit et al., 2000Go). However, the role of nestin, a cytoskeletal protein belonging to the intermediate filament family, prior to the onset of neurulation remains to be determined. It is possible that nestin, being one of the earliest expressing cytoskeletal proteins, is required for laying a strong cytoarchitectural foundation during early embryonic development.

Promoter/enhancer targeted neural specification
Previous studies from our group had already demonstrated the efficacy of promoter-mediated targeting in the ES-cell system for a better understanding of cardiomyogenesis (Kolossov et al., 1998Go). The current investigation allowed us to explore details of in vitro neurogenesis. Previously, Steven Goldman's group used a promoter-targeted and EGFP-reporter-based transient expression system in primary cultures for neural cell type selection and isolation (Wang et al., 1998Go; Roy et al., 2000aGo; Roy et al., 2000bGo). However, here we took advantage of the versatility of transgenic nestin ES-cell clones combined with stable EGFP expression. The immunocytochemical, electrophysiological and time-lapse observations provided direct proof of the neural lineage confinement of nestin intron-II-driven EGFP expression in our pluripotent transgenic ES-cell clones. The absence of EGFP expression in the spontaneously beating clusters (data not shown) generated from the differentiating EBs following the cardiac differentiation protocol (Kolossov et al., 1998Go) in fact supported this. Additionally, the flow-cytometry-assisted quantification of stably expressed nestin-driven EGFP provided insight to demarcating the time and development-dependent neural progenitor population induction.

Neural differentiation and neurogenic quantification
Based on the qualitative microscopic observation, time-lapse monitoring and concurrent quantitative FACS, two distinct temporal nestin induction patterns (lineage- and lineage+), as discerned by EGFP expression, were revealed. The biphasic EGFP expression pattern indeed indicated the decrease in uncommitted ES cells upon differentiation by LIF withdrawal and cell aggregation and concomitant increase in lineage-specified neural progenitors. This indicates that a critical time window exists during this one week regimen for the neural cell fate decision. Hence, selecting these population of nestin-driven, EGFP-expressing ES cells and EB-derived cells through FACS, and conditioning them to a selective lineage such as neurons, astrocytes and oligodendrocytes would further provide us with useful information regarding the guiding cues prior to lineage commitment and specification. Indeed, the time-lapse monitoring of whole EBs (data not shown) as well as of isolated cells unequivocally demonstrated the proliferation, migration and differentiation of EGFP-positive neural progenitors into neurons and glia. Thus, further study in this regard could answer the critical question whether neurons and glia are generated from a common progenitor and the existing crosstalk between these two cell types, as proposed in a number of studies (Tamada et al., 1998Go; Vernadakis, 1996Go).

The time course in neurogenic progression revealed that the maximum number of neural progenitors was generated between 4 and 12 days after EB plating. Accordingly, we could subdivide the transgenic EB-derived cells broadly into three groups. The brightest shining, EGFP-positive cells on plated EBs were categorized into group I, which included the sub-population of mitotically active neural progenitors as revealed by nestin immunostaining and semi-quantitative fluorescence detection in isolated cells. Group II, with medium and low EGFP, included the population of weak shining bi- and multipolar neurons as well as glia. EGFP-negative cells were categorized under group III, which included the more differentiated neurons and glia along with other non-neural cell types. Hence, the overall heterogeneity in the full length human nestin intron-II-enhancer-driven EGFP expression in ES cells upon differentiation reflects clearly the endogenous nestin expression as reported (Yaworsky and Kappen, 1999Go) and the asynchrony in neural progenitor generation. Although the significance of this heterogeneity is not well understood, the temporal- and region-dependent differential expression of specific transcription factors leading to neural stem cell heterogeneity might be the causal basis (Yaworsky and Kappen, 1999Go).

Ion channel expression during neural development
Voltage-dependent ion channels were acclaimed to be cellular fingerprints for the properties and patterns of neuronal cells during differentiation (Takahashi and Okamura, 1998Go). In earlier studies on the whole EB (Strubing et al., 1995Go; Arnhold et al., 2000Go), only cells with distinct neuronal morphology located at the periphery could be characterized. We have taken advantage of single cell isolation and EGFP labelling for the identification and functional characterization; this allowed easy detection of neural progenitors and unipolar neurons that were otherwise almost impossible to discern from non-neural cell types. Based on morphology and EGFP intensity we could distinguish four populations of neuronal cells with different electrophysiological characteristics. The undifferentiated neural progenitors did not display voltage-dependent ion channels, whereas unipolar neurons were found to express voltage-dependent 4-AP sensitive K+ channels. By contrast, differentiated neurons such as bipolar and multipolar neurons expressed voltage-dependent K+ and Ca2+, as well as TTX-sensitive neuronal Na+ channels. Earlier reports (Barish, 1991Go; Grantyn et al., 1989Go; Gottmann et al., 1989Go) in cultured neuronal precursors suggested the expression of low-voltage-activated Ca2+ currents prior to the appearance of voltage-dependent Na+- and Ca2+ currents. However, in line with our findings, Bain et al. reported that, within the first four days of plating, there was a small number of ES-cell-derived neuron-like cells that lacked voltage-activated inward currents, although their differentiation state was not defined (Bain et al., 1995Go).

The cell-type-specific ion channel expression might serve specific functions during neuronal maturation. It is possible that neurite outgrowth in conjunction with inter-synaptic connections determine the expression of voltage-activated inward currents or vice versa. Neuronal Na+ channels were detected prior to the onset of voltage-dependent Ca2+ channels in differentiating neurons indirectly suggesting the possible existence of two diverse (lagging and leading in terms of ion channel expression), ES-cell-derived bipolar neuronal subtypes. Similar differences in the inception of ICa expression between cultured chick sensory and autonomic neuronal precursors have been reported earlier (Gottmann et al., 1988Go). Since the Ca2+ entry into neuronal cells through voltage-gated Ca2+ channels influences neuronal excitability as well as synaptic transmission (Augustine et al., 1987Go; Spitzer et al., 1994Go), the absence of ICa in unipolar as well as some bipolar neurons at d7+3/4 suggested that these differentiating, relatively young, neurons had not yet established connection with their neighbouring counterparts and hence lacked the functional expression of these ion channels. Pharmacological evaluation of subtypes of voltage-dependent Ca2+ currents in differentiated neurons revealed that these already expressed N- and P/Q-type Ca2+ currents that were expected to be found in neuronal and neuroendocrine cells (Scherubl et al., 1993Go). In addition, receptor-operated channels prevalently of the inhibitory type were detected in bipolar and multipolar neurons. Taken together, the expression of functional ion channels in the developing neurons from ES cells in vitro seems to be related not to the stage (day after plating) alone, as proposed earlier (Bain et al., 1995Go; Strubing et al., 1995Go), but primarily to the morphology. This demonstrates that ion channel expression parallels closely the cellular functional demands during neurogenesis.

Thus, the use of live reporter EGFP under the regulatory control of the neural-specific enhancer nestin has given us the means to investigate not only its expression, but also quantitative- and functional characteristics of neurogenesis during early stages of development. This system would help to increase the diversity of self-renewing and multipotent neural progenitors by using fluorescence activated cell sorting (FACS) and, consequently, allow their use in experimental transplantation purposes.


    Acknowledgments
 
We thank U. Lendahl (Karolinska Institute, Sweden) for kindly providing the nestin promoter construct, A. Wobus for D3 ES cells, H. Bohlen and O. Manzke (University of Cologne, Germany) for helping with flow-cytometry analysis, N. Smyth (University of Cologne, Germany) for providing the murine blastocysts, and S. Ullrich, E. Kolossov, C. Andressen, S. Arnhold and W. Bloch (University of Cologne) for critically reading the manuscript. This study was supported by a grant from BMBF (0311474/6) to J.H.


    Footnotes
 
Movies available on-line


    References
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

Arnhold, S., Andressen, C., Angelov, D. N., Vajna, R., Volsen, S. G., Hescheler, J. and Addicks, K. (2000). embryonic stem-cell derived neurones express a maturation dependent pattern of voltage-gated calcium channels and calcium-binding proteins. Int. J. Dev. Neurosci. 18,201 -212.[Medline]

Augustine, G. J., Charlton, M. P. and Smith, S. J. (1987). Calcium action in synaptic transmitter release. Annu. Rev. Neurosci. 10,633 -693.[Medline]

Bain, G., Kitchens, D., Yao, M., Huettner, J. E. and Gottlieb, D. I. (1995). Embryonic stem cells express neuronal properties in vitro. Dev. Biol. 168,342 -357.[Medline]

Barish, M. E. (1991). Voltage-gated calcium currents in cultured embryonic Xenopus spinal neurones. J. Physiol. 444,523 -543.[Abstract/Free Full Text]

Bjornson, C. R., Rietze, R. L., Reynolds, B. A., Magli, M. C. and Vescovi, A. L. (1999). Turning brain into blood: a hematopoietic fate adopted by adult neural stem cells in vivo. Science 283,534 -537.[Abstract/Free Full Text]

Cattaneo, E. and McKay, R. (1990). Proliferation and differentiation of neuronal stem cells regulated by nerve growth factor. Nature 347,762 -765.[Medline]

Doetsch, F., Caille, I., Lim, D. A., Garcia-Verdugo, J. M. and Alvarez-Buylla, A. (1999). Subventricular zone astrocytes are neural stem cells in the adult mammalian brain. Cell 97,703 -716.[Medline]

Gage, F. H. (2000). Mammalian neural stem cells. Science 287,1433 -1438.[Abstract/Free Full Text]

Gottmann, K., Dietzel, I. D., Lux, H. D., Huck, S. and Rohrer, H. (1988). Development of inward currents in chick sensory and autonomic neuronal precursor cells in culture. J. Neurosci. 8,3722 -3732.[Abstract]

Gottmann, K., Dietzel, I. D., Lux, H. D. and Ruedel, C. (1989). Protoninduced Na+ current develops prior to voltage-dependent Na+ and Ca2+ currents in neuronal precursor cells from chick dorsal root ganglion. Neurosci. Lett. 99,90 -94.[Medline]

Grantyn, R., Perouansky, M., Rodriguez-Tebar, A. and Lux, H. D. (1989). Expression of depolarizing vol. Brain Res. Dev. Brain Res. 49,150 -155.[Medline]

Hamill, O. P., Marty, A., Neher, E., Sakmann, B. and Sigworth, F. J. (1981). Improved patch-clamp techniques for high-resolution current recording from cells and cell-free membrane patches. Pflugers Arch. 391,85 -100.[Medline]

Hockfield, S. and McKay, R. D. (1985). Identification of major cell classes in the developing mammalian nervous system. J. Neurosci. 5,3310 -3328.[Abstract]

Johansson, B. M. and Wiles, M. V. (1995). Evidence for involvement of activin A and bone morphogenetic protein 4 in mammalian mesoderm and hematopoietic development. Mol. Cell. Biol. 15,141 -151.[Abstract]

Josephson, R., Muller, T., Pickel, J., Okabe, S., Reynolds, K., Turner, P. A., Zimmer, A. and McKay, R. D. (1998). POU transcription factors control expression of CNS stem cell-specific genes. Development 125,3087 -3100.[Abstract]

Kolossov, E., Fleischmann, B. K., Liu, Q., Bloch, W., Viatchenko-Karpinski, S., Manzke, O., Ji, G. J., Bohlen, H., Addicks, K. and Hescheler, J. (1998). Functional characteristics of ES cell-derived cardiac precursor cells identified by tissue-specific expression of the green fluorescent protein. J. Cell Biol. 143,2045 -2056.[Abstract/Free Full Text]

Krum, J. M. and Rosenstein, J. M. (1999). Transient coexpression of nestin, GFAP, and vascular endothelial growth factor in mature reactive astroglia following neural grafting or brain wounds. Exp. Neurol. 160,348 -360.[Medline]

Laywell, E. D., Dorries, U., Bartsch, U., Faissner, A., Schachner, M. and Steindler, D. A. (1992). Enhanced expression of the developmentally regulated extracellular matrix molecule tenascin following adult brain injury. Proc. Natl. Acad. Sci. USA 89,2634 -2638.[Abstract/Free Full Text]

Lee, S. H., Lumelsky, N., Studer, L., Auerbach, J. M. and McKay, R. D. (2000). Efficient generation of midbrain and hindbrain neurons from mouse embryonic stem cells. Nat. Biotech. 18,675 -679.[Medline]

Lendahl, U. (1997). Transgenic analysis of central nervous system development and regeneration. Acta Anaesthesiol. Scand. Suppl. 110,116 -118.[Medline]

Lendahl, U., Zimmerman, L. B. and McKay, R. D. (1990). CNS stem cells express a new class of intermediate filament protein. Cell 60,585 -595.[Medline]

Lothian, C. and Lendahl, U. (1997). An evolutionarily conserved region in the second intron of the human nestin gene directs gene expression to CNS progenitor cells and to early neural crest cells. Eur. J. Neurosci. 9, 452-462.[Medline]

Lothian, C., Prakash, N., Lendahl, U. and Wahlstrom, G. M. (1999). Identification of both general and region-specific embryonic CNS enhancer elements in the nestin promoter. Exp. Cell Res. 248,509 -519.[Medline]

Maltsev, V. A., Wobus, A. M., Rohwedel, J., Bader, M. and Hescheler, J. (1994). Cardiomyocytes differentiated in vitro from embryonic stem cells developmentally express cardiac-specific genes and ionic currents. Circ. Res. 75,233 -244.[Abstract/Free Full Text]

Messam, C. A., Hou, J. and Major, E. O. (2000). Coexpression of nestin in neural and glial cells in the developing human CNS defined by a human-specific anti-nestin antibody. Exp. Neurol. 161,585 -596.[Medline]

Mujtaba, T., Mayer-Proschel, M. and Rao, M. S. (1998). A common neural progenitor for the CNS and PNS. Dev. Biol. 200,1 -15.[Medline]

Namiki, J. and Tator, C. H. (1999). Cell proliferation and nestin expression in the ependyma of the adult rat spinal cord after injury. J. Neuropathol. Exp. Neurol. 58,489 -498.[Medline]

Okabe, S., Forsberg-Nilsson, K., Spiro, A. C., Segal, M. and McKay, R. D. (1996). Development of neuronal precursor cells and functional postmitotic neurons from embryonic stem cells in vitro. Mech. Dev. 59,89 -102.[Medline]

Pekny, M., Johansson, C. B., Eliasson, C., Stakeberg, J., Wallen, A., Perlmann, T., Lendahl, U., Betsholtz, C., Berthold, C. H. and Frisen, J. (1999). Abnormal reaction to central nervous system injury in mice lacking glial fibrillary acidic protein and vimentin. J. Cell Biol. 145,503 -514.[Abstract/Free Full Text]

Reynolds, B. A. and Weiss, S. (1992). Generation of neurons and astrocytes from isolated cells of the adult mammalian central nervous system. Science 255,1707 -1710.[Abstract/Free Full Text]

Rohwedel, J., Guan, K. and Wobus, A. M. (1999). Induction of cellular differentiation by retinoic acid in vitro. Cells Tissues Organs 165,190 -202.[Medline]

Rossi, F., Bravin, M., Buffo, A., Fronte, M., Savio, T. and Strata, P. (1997). Intrinsic properties and environmental factors in the regeneration of adult cerebellar axons. Prog. Brain Res. 114,283 -296.[Medline]

Roy, N. S., Benraiss, A., Wang, S., Fraser, R. A., Goodman, R., Couldwell, W. T., Nedergaard, M., Kawaguchi, A., Okano, H. and Goldman, S. A. (2000a) Promoter-targeted selection and isolation of neural progenitor cells from the adult human ventricular zone. J. Neurosci. Res. 59,321 -331.[Medline]

Roy, N. S., Wang, S., Jiang, L., Kang, J., Benraiss, A., Harrison-Restelli, C., Fraser, R. A., Couldwell, W. T., Kawaguchi, A., Okano, H. et al. (2000b) In vitro neurogenesis by progenitor cells isolated from the adult human hippocampus. Nat. Med. 6, 271-277.[Medline]

Scherubl, H., Kleppisch, T., Zink, A., Raue, F., Krautwurst, D. and Hescheler, J. (1993). Major role of dihydropyridine-sensitive Ca2+ channels in Ca2+-induced calcitonin secretion. Am. J. Physiol. 264,E354 -E360.[Abstract/Free Full Text]

Spitzer, N. C., Gu, X. and Olson, E. (1994). Action potentials, calcium transients and the control of differentiation of excitable cells. Curr. Opin. Neurobiol. 4, 70-77.[Medline]

Streit, A., Berliner, A. J., Papanayotou, C., Sirulnik, A. and Stern, C. D. (2000). Initiation of neural induction by FGF signalling before gastrulation. Nature 406, 74-78.[Medline]

Strubing, C., Ahnert-Hilger, G., Shan, J., Wiedenmann, B., Hescheler, J. and Wobus, A. M. (1995). Differentiation of pluripotent embryonic stem cells into the neuronal lineage in vitro gives rise to mature inhibitory and excitatory neurons. Mech. Dev. 53,275 -287.[Medline]

Takahashi, K. and Okamura, Y. (1998). Ion channels and early development of neural cells. Physiol. Rev. 78,307 -337.[Abstract/Free Full Text]

Tamada, Y., Tanaka, M., Munekawa, K., Hayashi, S., Okamura, H., Kubo, T., Hisa, Y. and Ibata, Y. (1998). Neuron-glia interaction in the suprachiasmatic nucleus: a double labeling light and electron microscopic immunocytochemical study in the rat. Brain Res. Bull. 45,281 -287.[Medline]

van der Kooy, D. and Weiss, S. (2000). Why stem cells? Science 287,1439 -1441.[Abstract/Free Full Text]

Vernadakis, A. (1996). Glia-neuron intercommunications and synaptic plasticity. Prog. Neurobiol. 49,185 -214.[Medline]

Wang, S., Wu, H., Jiang, J., Delohery, T. M., Isdell, F. and Goldman, S. A. (1998). Isolation of neuronal precursors by sorting embryonic forebrain transfected with GFP regulated by the T alpha 1 tubulin promoter. Nat. Biotechnol. 16,196 -201.[Medline]

Wobus, A. M., Wallukat, G. and Hescheler, J. (1991). Pluripotent mouse embryonic stem cells are able to differentiate into cardiomyocytes expressing chronotropic responses to a