|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
Research Article |

Institute of Neurophysiology, University of Cologne, Cologne,
Germany
* Present address: National Centre For Cell Science, Pune University Campus,
Ganeshkhind, Pune 411007, Maharashtra, India
Author for correspondence (e-mail:
nibedital{at}yahoo.com
)
Accepted 13 January 2002
| Summary |
|---|
|
|
|---|
Key words: ES cells, Nestin, EGFP, Neural progenitor, Neurogenesis
| Introduction |
|---|
|
|
|---|
The intermediate filament protein, nestin, a well known marker for neural
stem cells, is expressed in the majority of mitotically active CNS and PNS
progenitors (Lendahl et al.,
1990
; Lendahl,
1997
; Cattaneo and McKay,
1990
; Mujtaba et al.,
1998
); it is downregulated upon differentiation
(Zimmerman et al., 1994
;
Lothian and Lendahl, 1997
) and
reported to reappear upon injury (Lendahl,
1997
; Krum and Rosenstein,
1999
; Namiki and Tator,
1999
; Pekny et al.,
1999
). Thus, the cells expressing nestin show all the
characteristic features of stem cells such as multipotency, self-renewal and
regeneration. Hence, nestin could serve as an efficient candidate marker gene
in order to unravel early neurogenic proceedings from ES cells in vitro.
Unlike T
1 tubulin, the unipotent neuronal progenitor marker whose
expression is confined only to the pre- and post-mitotic neurons
(Wang et al., 1998
;
Roy et al., 2000a
;
Roy et al., 2000b
), nestin
represents a more broad spectral, multipotent neural lineage marker expressing
not only in neurons but in glia as well
(Hockfield and McKay, 1985
;
Messam et al., 2000
). Thus,
the generation and demarcation of both neurons and glia would pave the way in
exploring the underlying mechanism(s) of neurogenesis as well as gliogenesis
in the ES-cell model system.
Previous studies on the nestin gene using transgenic mice demonstrated that
the second intron has the necessary cisacting enhancer motifs for driving the
reporter gene expression in a neuron-specific manner in the developing CNS
(Zimmerman et al., 1994
;
Lothian and Lendahl, 1997
;
Josephson et al., 1998
;
Lothian et al., 1999
;
Yaworsky and Kappen, 1999
).
Accordingly, the present investigation was carried out to identify, quantify
and functionally characterize the ES-cell-derived, development-dependent,
proliferating neuronal progenitors as well as the differentiating neurons
based on nestin intron-II-driven EGFP expression. This study provides clues to
the multifaceted and dynamic process of neurogenesis using the powerful model
of stem cell differentiation in vitro that would otherwise have been a
complicated task in vivo.
| Materials and Methods |
|---|
|
|
|---|
Cell culture and transfection
The ES cells of the line D3 were maintained as described before
(Wobus et al., 1991
). Briefly,
ES cells were grown on inactivated feeder cells in DMEM supplemented with 15%
fetal bovine serum (FBS), non-essential amino acids, 2 mM glutamine, 50
µg/ml Penn-Strep (all from Gibco BRL, Germany), 0.1 mM
ß-mercaptoethanol (Sigma, Germany), and 1000 U/ml recombinant murine
leukemia inhibitory factor (LIF, ESGRO, Gibco). In separate experiments,
following linearization using the HindIII restriction enzyme
5x106 cells were transfected independently by
electroporation using
30 µg of the h-Nestin-EGFP or tkEGFP reporter
constructs, respectively, following the standard protocol. The NeoR
clones were picked after 10-12 days of G418 selection and propagated using the
same medium. G418 selection was maintained throughout the propagation
period.
Neuronal differentiation
Differentiation of ES cells was initiated by cell aggregation following the
hanging drop method (Wobus et al.,
1991
) in DMEM supplemented with 10% FBS. All-trans-retinoic acid
(RA) was used as the inducing agent for neuronal differentiation as described
(Strubing et al., 1995
) with
slight modifications. The neural differentiation was also monitored using the
conditioned medium (Okabe et al.,
1996
). Since the time window (
7-10 days post-plating) for
optimal neural progenitor generation was similar irrespective of the medium
used, the data from RA-induced progenitors are presented here for convenience.
In brief, following trypsinization, the ES cells (500cells/20µl drop) were
exposed to RA (10-7 M) for 3 days during hanging drop followed by
suspension culture of embryoid bodies (EBs) for 4 days and plating without RA.
Alternatively, RA was added to the medium while plating the EBs and the medium
was replenished with fresh medium without RA on the fourth day post-plating
(i.e. d7+4).
RT-PCR
Total RNA was isolated from the undifferentiated EGFP-positive transgenic
nestin ES-cell clones and the wild-type ES-cell line D3, grown with or without
feeders, as well as from murine blastocysts using high pure RNA isolation kit
(Roche Molecular Biochemicals, Germany). To ascertain the presence of nestin
transcripts in these cells, the total RNA was subjected to
reverse-transcription-based PCR following the manufacturer's instructions
(Gibco-BRL). The nestin-specific primers (5' GGATACAGCTTTATTCAAGG
3' and 5' CAGCCGCTGAAGTTCACTCT 3'; GenBank, accession no.
C78523) were designed from the retrieved mouse cDNA sequence, which also
corresponded to the C-terminus of the latest reported full length mouse nestin
gene (GenBank accession no. AF076623) at positions 5959-5940 and 5481-5500,
respectively. The house-keeping HPRT (hypoxanthine phosphoribosyltransferase)
(Johansson and Wiles, 1995
)
and ß-actin primers were used as internal positive controls for PCR and
designed accordingly to decipher the genuineness of amplified products, based
on their size from cDNA, but not from contaminating genomic DNA. The RNA
samples without the reverse transcriptase served as the negative control, and
the PCR product from each sample was resolved on the agarose gel and observed
under a UV-transluminator.
FACS analysis
The EGFP expression of ES-cell-derived clones was analyzed at various
developmental stages using a FACSCaliburTM flow cytometer (Becton
Dickinson) equipped with a 488 nm argon-ion-laser (15 mW) as described
(Kolossov et al., 1998
). In
brief, about 10,000-50,000 viable cells were analyzed per sample after
isolation using trypsinization (0.1% trypsin and 0.01% EDTA) for 2-5 minutes
at 37°C. Subsequently, the cells were resuspended by gentle trituration
using PBS containing 1 mM Ca2+ and 0.5 mM Mg2+.
Untransfected D3 line ES cells were used as negative controls. The emitted
fluorescence of EGFP was measured in log scale at 530 nm (FITC band pass
filter) and analyses were performed using CellQuest® software (Becton
Dickinson).
Immunocytochemistry
The specificity of the nestin expression was verified by
immunocytochemistry using antibodies against neurons and glia following the
standard protocol. In brief, the ES cells and EBs at various stages of
development grown on glass coverslips were washed with 0.1 M PBS, pH 7.4 and
fixed with 4% paraformaldehyde for 20 minutes. After washing again with PBS
the cells were permeabilized with solution containing 0.25% Triton X-100 and
0.5 M ammonium chloride in 0.25 M TBS, pH 7.4 for 10 minutes and blocked with
4% goat serum and 0.8% BSA for 1 hour. Subsequently, the cells were exposed to
either of the primary antibodies: anti-nestin (Rat-401, DSHB, University of
Iowa), anti-MAP2, anti-synaptophysin or anti-GFAP (all from Sigma chemicals)
for 3 hours at room temperature. After washing (0.25 M TBS, three times for 10
minutes each), the cells were treated with Cy3-conjugated secondary antibody
for 1 hour at 37°C for fluorescent labelling. Finally the cells were
washed three times with TBS and dehydrated with ethanol gradients, followed by
xylene treatment and mounting with entellan on glass slides. In each case the
negative control was performed with the substitution of respective primary
antibodies with goat pre-immune serum. The slides were observed under a
fluorescent microscope to detect EGFP as well as Cy3-labeling.
Dissociation of EBs and preparation of single cells
For isolation, 12-16 EBs were dissociated using collagenase B (Roche
Molecular Biochemicals, Germany) and re-plated on gelatin (0.1%)-coated glass
coverslips as described (Maltsev et al.,
1994
). In brief, EBs were dissected and rinsed with PBS followed
by collagenase B treatment (0.1% in PBS) for 30 minutes at 37°C.
Subsequently, collagenase was replaced with a medium containing: 85 mM KCl; 30
mM K2HPO4; 5 mM MgSO4-7H2O; 1 mM
EDTA; 5 mM Na2ATP; 5 mM Na-Pyruvate; 5 mM Creatin; 20 mM taurin and
20 mM glucose; pH 7.2). The cells were stirred slowly for 30 minutes,
suspended by gentle trituration in DMEM medium and plated onto gelatin-coated
glass coverslips. In initial experiments the central and peripheral regions of
the EBs were separated and dissociated individually. Since the pattern of
differentiation was similar in these two preparations, whole EBs were used for
dissociation. Single isolated cells were used for immunocytochemical
characterizations after 2-5 days of re-plating either with parallel cultures
or with the same, subsequent to electrophysiological investigations.
Estimation of EGFP intensity and electrophysiology
The semiquantitative estimation of EGFP intensity was performed as
described (Kolossov et al.,
1998
). For the analysis, the EGFP fluorescence intensity
comprising the whole area of the cell was integrated and average fluorescence
intensities determined in counts.
For patch clamp recordings, isolated neurons of different developmental
stages were investigated, using the whole-cell patch clamp technique
(Hamill et al., 1981
). The
cells were voltage-clamped using an EPC-9 amplifier (Heka, Germany), held at
-80 mV and depolarizing pulses or ramps were applied (for detail, see figure
legends). For the registration of inward currents ramp depolarizations were
performed and INa was inhibited by tetrodotoxin (TTX, 0.1 µM).
For estimation of voltage-dependent Ca2+ currents, the
extracellular solution was exchanged to a Na+-free solution
containing Ba2+ as charge carrier. The expression of the various
subtypes of voltage-dependent Ca2+ channels was tested using
selective antagonists [Isradipine,
-Conotoxin GVIA (
-CgTX),
-agatoxin IVA (
-AgaTX), Almone Labs, Israel], which were bath
added. For the recording of receptor-operated currents, substances were
applied (15 milliseconds) through a puffer pipette connected to a pressure
ejection system (General Valves, USA) placed into the vicinity of the cell of
interest (holding potential (HP) -80 mV). The receptor-operated currents were
characterized by applying competitive antagonists via the gravitational
perfusion system. The ionic nature of these currents was analyzed using
subtracted voltage ramps. Data were acquired at a sampling rate of 10 kHz,
filtered at 1 kHz, stored on hard disk and analyzed off-line using the
Pulse-Fit (Heka) software package. Averaged data are expressed as
means±s.e.m. Membrane capacity was determined on-line using the Pulse
acquisition software program (Heka). Statistical analysis was performed using
paired or unpaired Student's t-test, and a P value of
<0.05 was considered significant.
The glass coverslips containing the cells were placed into a
temperature-controlled (37°C) recording chamber and perfused continuously
with extracellular solution by gravity at a rate of 1 ml/minute. Substances
were applied by exchanging the solution in the chamber, a 90% volume exchange
was achieved within approximately 20 seconds. Patch pipettes (2-4 M
resistance) from borosilicate glass from Clark (Electromedical Instruments,
UK) were pulled using a Zeitz puller (DMZ, Germany). The solutions used had
the following composition. Standard external solution, 140 mM NaCl, 5.4 mM
KCl, 1.8 mM CaCl2, 1 mM MgCl2, 10 mM glucose and 10 mM
Hepes (pH 7.4, adjusted with NaOH). External solution for measurement of
IBa: 120 mM D(-)-N-methylglucamine, 10.8 mM BaCl2, 5.4
mM CsCl, 1 mM MgCl2, 10 mM glucose and 10 mM Hepes (pH 7.4,
adjusted with HCl). Normal intracellular solution: 50 mM KCl, 80 mM
K-Asparate, 1 mM MgCl2, 3 mM Mg2ATP, 10 mM EGTA and 10
mM Hepes (pH 7.2, adjusted with NaOH). Internal solution for recording of
inward currents: 120 mM CsCl, 1 mM MgCl2, 3 mM Mg2ATP,
10 mM Hepes and 10 mM EGTA (pH 7.2, adjusted with CsOH). All these chemicals
were purchased from Sigma (Germany). The toxins were aliquoted, diluted in
normal external solution and frozen at -22°C prior to use.
Online supplemental material (time-lapse microscopy)
For live monitoring of neurogenesis, one day after isolation (d7+7) the
cells were continuously observed for 3 days. An inverted microscope (Axiovert
100, Zeiss) equipped with a movable computer controlled state (Nikon,
Germany), an objective 20x (Plan-Neofluar, Zeiss) and a
temperature/CO2-controlled chamber (Nikon) were used. Cells were
monitored at 30 minute intervals using alternate transmission and fluorescent
excitation light with a conventional halogen lamp and a FITC filter set.
Images were acquired using a colour video camera (Sony, DXC 950P, AVT Horn,
Germany) controlled by the Lucia software (Nikon) and digitized on-line via a
video frame grabber card (Matrox Corona, Nikon). For fluorescence pictures,
the integration mode of the camera (10 single pictures) and a video-based
buffer device (Sony MPU-F100P, AVT Horn) were employed. Movies 1 and 2 depict
Fig. 5A and B, respectively,
showing the neuro- and gliogenesis from neural progenitors. The cells
subsequent to the monitoring were subjected to immonocytochemical verification
and neural specification using neuronal and glial specific antibodies (see
http://jcs.biologists.org/supplemental
).
|
| Results |
|---|
|
|
|---|
|
Validation of early onset of endogenous nestin and concomitant EGFP
expression
To correlate nestin-driven EGFP expression in undifferentiated ES cells
with endogenous nestin expression, both, RT-PCR and immunostaining were
performed. As shown in Fig. 2,
by RT-PCR with total RNA isolated from undifferentiated ES cells from one of
the EGFP-positive transgenic clones (clone-1) as well as from untransfected D3
cells grown in presence or absence of feeders using sequence specific nestin
primers, a PCR product of the expected 478 bp size was amplified.
Interestingly, the nestin product was detectable in the murine blastocyst RNA
(Fig. 2, lower panel, lane 14),
but with a comparatively low intensity. This is probably caused by either a
low transcript level or low initial RNA content in the RT reaction containing
the blastocyst sample because, by using two housekeeping primers (HPRT and
ß-actin), the respective apparent product intensities with the blastocyst
sample were low compared with that of other samples. Hence, we took double the
quantity of reverse transcribed first strand from the blastocyst sample in
order (1.5 times loading sample volume on gel) to scale up the visible
intensity of the product during PCR (Fig.
2, lower panel, lane 8). We further corroborated this finding by
immunostaining using a monoclonal antibody against nestin. All the
EGFP-positive cells were nestin positive in the feeder-free cultured transgene
ES cell clone-1 (Fig. 1G,H).
Immunostaining with a monoclonal antibody against nestin in the feeder-free
cultured transgenic ES cell clone-1 indicated that all EGFP-positive cells
were nestin positive (Fig.
1G,H). In addition, preliminary studies indicate that the inner
cell mass (ICM) of murine blastocysts is nestin positive (data not shown),
confirming the observation in ES cells. Unlike earlier reports on nestin
expression (Okabe et al.,
1996
; Lee et al.,
2000
) our findings imply that its onset occurs much earlier than
neural plate induction at E7.5.
|
Nestin intron-II-driven EGFP expression profile during neural
differentiation and neurogenic progression
The transition from uncommitted ES cells to a neural lineagedefined state
was brought about by RA exposure of EBs. To rule out clonal diversity several
(n=6) of the clones were analyzed to examine the nestin
intron-II-driven EGFP expression profile and specificity in ES-cell-derived
neurons during differentiation. During cell aggregation and commencement of
differentiation, localized expression of EGFP in EBs marked the transition.
Moreover, under no time points studied was there ever complete absence of
EGFP-expressing cells in the EBs. After 1 or 2 days post-plating (d7+1/2), the
EBs showed a few intense bright shining areas
(Fig. 3A,B). By d7+2/3, the
cells at the periphery exhibited an epithelial phenotype implicating the
differentiation into ectodermal lineage. Starting from d7+4, outgrowths from
the central part of the EB with areas of intense EGFP expression were detected
(Fig. 3C,D). This further
signified the presence of neuroepithelial cells as confirmed by immunostaining
with the nestin antibody (Fig.
3J,K).
|
By d4-6 of plating, few EGFP-positive uni-/bi-/multipolar neurons were
observed at the periphery of the differentiating EBs along with the glial
cells, most probably the radial glia (Rat 401 positive)
(Hockfield and McKay, 1985
).
However, the number of neurons with distinct neurite outgrowths significantly
increased with time after plating, associated with weakening of EGFP
expression (Fig. 3D). By d8-15,
bundles of neurons forming extensive networks were observed
(Fig. 3E-H). As would be
expected, progressive neurogenesis was accompanied by an increase in the
number and the length of neurite outgrowths.
(Fig. 3, compare E with F-H).
Most of the terminally differentiated neurons lost EGFP, thus mimicking the
endogenous nestin expression pattern as well as reporter gene expression in
vivo (Zimmerman et al., 1994
;
Lothian and Lendahl, 1997
).
Nevertheless, in many differentiating neurons with distinct neurite outgrowths
weak EGFP expression was preserved; this was probably due to accumulation
because of its slow metabolic rate (Fig.
3F-H). No significant differences were noticed in the neural
differentiation pattern, irrespective of the application of RA, during hanging
drop preparation or plating in contradiction to an earlier report
(Rohwedel et al., 1999
).
Neural specificity of EGFP expression during differentiation
Immunocytochemical studies on whole EBs
(Fig. 3J-M) confirmed neural
specific confinement of nestin enhancer-driven EGFP expression at different
developmental stages (d7+4 to d7+12). A similar neural differentiation pattern
was observed in isolated cells (Fig.
4A-K). All EGFP-positive cells stained with the antibody directed
against nestin, proving the neural-specific expression of EGFP. These
EGFP+/nestin+ cells
(Fig. 3J,K;
Fig. 4C-D) were thought to be
neural progenitors because of their proliferation (BrDU+ or
Ki67+; data not shown) (Fig.
5; time-lapse observation) and differentiation potential, giving
rise to neurons with uni-, bi- and multipolar morphologies as well as glia; as
discerned by immunostaining with both neuron (synaptophysin, MAP2) and glial
(GFAP) specific antibodies, respectively
(Fig. 3L,M;
Fig. 4E-K). The differentiated
bi- and multipolar neurons with longer processes were either weak or negative
for EGFP (Fig. 4A,B), but
stained positively with MAP2, a marker for post-mitotic neurons
(Fig. 3L,M;
Fig. 4J,K). These cells
maintained synaptic connections as evident from synaptophysin staining
(Fig. 4G,H) and appeared to
form networks with adjacent neurons and glia. More often differentiating
neurons grew on top of or adjacent to a monolayer of flat glial cells
establishing extensive connections with each other
(Fig. 4J,K). These observations
further confirmed that the EGFP/nestin positive neural progenitors retained
the ability of multipotentiality since they were able to generate
MAP2-positive neurons and GFAP-positive glial cells upon differentiation.
Notably, at every developmental stage investigated there was a representative
population from proliferating (BrDU+; Ki67+;
nestin+) and differentiating cells (MAP2+;
GFAP+), indicating an asynchronous profile in neural
differentiation.
|
Monitoring of neural differentiation with time-lapse microscopy
A clearer picture of neurogenic progression emerged in time-lapse
experiments. As seen in Fig.
5A, a single EGFP-positive progenitor was observed to divide into
two and then into three cells. The triplet underwent positional changes
between 6 and 10 hours after the inception of monitoring (see movie;
http://jcs.biologists.org/supplemental
). Subsequently, one of these cells underwent morphogenic change and showed
neurite outgrowth to become uni- and then bipolar. At subsequent time periods
the extension of a neurite in association with migration and interaction with
other cells became evident from this observation
(Fig. 5A). One of the other two
cells exhibited further divisions at 23 hours (data not shown) and 36.5 hours,
indicating the probable occurrence of self-renewing asymmetric division and
retention of stem/progenitor potential. Many of the bipolar neurons did
undergo a further morphogenic change into multipolar ones, depending on their
interaction with neighbouring neurons or glia (data not shown), whereas some
remained bipolar until the end of monitoring
(Fig. 5A). These changes
indicate the co-existence of a diverse phenotypic population of mature neurons
and neural progenitors at any given time during neuronal differentiation from
ES cells in vitro. Similarly, the generation of cells with glial phenotype
with subsequent division (Fig.
5B; 55 hours and 58.5 hours), migration and interaction with each
other could be clearly depicted from EGFP-positive progenitors
(Fig. 5B; 55-66.5 hours). The
noteworthy feature was both symmetric and asymmetric division of progenitor
and, unlike the neuronal cells, the glial cells underwent further division
after undergoing transformation from a flat
(Fig. 5B; 54 hours) to a round
phenotype (Fig. 5B; 54.5 hours)
like the progenitor. However, in both cases weakening of EGFP remained
associated with progressive morphogenesis into neuron and glia.
Flow-cytometric quantification of neurogenesis from ES cells in
vitro
The qualitative aspect of neurogenesis in vitro was complemented by a
quantitative assessment performing flow-cytometry at different stages of
development. In several of the EGFP-positive clones analyzed (n=4),
the undifferentiated ES cells exhibited about 40-50% of bright and weak EGFP
fluorescence each when compared with D3 wild-type ES cells
(Fig. 6A). Upon differentiation
by cell aggregation, RA treatment and prior to plating
(Fig. 6A; left panel, 7+0),
there was a clear leftward shift in the EGFP peak (28% weak: 20-100 intensity
range; and 2% bright: 100-1000 range) with the majority (70%) of cells being
EGFP negative (1-20 range). In the post-plating EBs, EGFP fluorescence further
intensified in line with the microscopic observation pattern reported above.
About 1-6% of the total bright shining population of cells from the RA-treated
group (clone-1) was very intense after plating, with EGFP intensity levels
beyond the 1000 range (Fig.
6A). This population was observed even up to 24 days after
plating. As seen in Fig. 6A,
there was a rightward shift in the EGFP-positive peak in the 4 day post-plated
EBs (70% EGFP+: 20-10,000 range; 30% EGFP-: 1-20 range)
indicating a biphasic distribution pattern that remained almost the same in
the 10-12 day post-plated EBs (52-57% EGFP+ and 43-48%
EGFP-) and gradually decreased with the course of time from 12 to
24 days post-plating (20% EGFP+ and 80% EGFP-). This
clearly complied with an increase in the number of post-mitotic
differentiating neurons during the course of differentiation as directly
monitored with time-lapse microscopy. The time course of the neurogenic
development indicated that the percentage of the brightest EGFP-positive
(EGFP+++: 1000-10,000 intensity range) progenitor population in the
plated EBs remained stable between d7+4 (7.2±2.0%) and d7+10/12
(6.0±1.3%) of plating and declined to 2.5±1.0% after 24 days of
plating (Fig. 6B). Similarly,
the proportion of cells belonging to the bright EGFP-positive
(EGFP++: 100-1000 range) group showed gradual decline in EGFP
intensity (from 27.9±3.3% to 10.9±5.0%), implying the loss of
residual EGFP in these differentiating neural populations during a longer
plating period. By contrast, the proportion of weak EGFP-positive cells
(EGFP+: 20-100 range) remained unchanged (24±11.3% to
28.7±2.3%) and an almost exponential rise in the EGFP-negative cells
from 36.1±2.0% to 62.6±17.3% could be observed between day 4 and
day 24 after plating (Fig. 6B).
Taken together, these data suggested an asynchronous neural differentiation
profile and that the maximum number of neural progenitors was generated from
ES cells in vitro between 4 and 12 days after EB plating. A similar profile
was observed in EBs treated with RA during plating (data not shown).
|
In contrast to the RA-treated groups, cells without RA exposure displayed intensities hardly beyond the 103 log and the majority (71-90%) of post-plated EBs were EGFP negative (Fig. 6A, right panel). Additionally, the percentage of EGFP-positive cells increased from 9% (d7+4) to 28% (d7+24) after two to three weeks of plating. This clearly indicated the effect of RA on early onset neural specification and neurogenesis that was otherwise delayed in the untreated ones. It was further corroborated by immunocytochemical findings where the RA-untreated EBs displayed low percentage of MAP2 immunoreactivity after 2-3 weeks of plating (data not shown).
Functional features of transgenic nestin ES-cell-derived neurons
It is well known that ion channels determine development as well as
function of neurons. Therefore, we have focused on the development-dependent
expression of ion channels, in particular voltage-activated inward currents.
In fact, the live labelling of ES-cell-derived neurons enabled for the first
time the investigation of ion channel expression in isolated neurons at very
early stages of neurogenesis. Since the differentiation of ES-cell-derived
neurons was found to be asynchronous, cells undergoing functional
characterization were classified according to the following criteria: (1) time
after plating; and (2) morphological characteristics and semi-quantitative
assessment of EGFP expression. Isolated neurons from d3-19 after plating were
investigated using the classic whole cell patch-clamp technique combined with
single cell fluorescence imaging to estimate EGFP intensity. In line with our
previous observations, neural progenitors (1804±223, n=25) and
unipolar neurons (1585±457, n=25) were characterized by
significantly higher EGFP intensities than more differentiated neurons
(bipolar neurons, 545±86, n=66; multipolar neurons,
482±77, n=56). Many of the multipolar neurons, probably of a
more advanced state of differentiation, were without detectable fluorescence
(n=8).
When the expression pattern of ion channels was characterized in the four
population of neurons, no voltage-dependent ion currents were detected in
neural progenitors/apolar cells during the entire developmental stage
(Fig. 7A, n=25).
Indeed, at this stage ramp depolarizations as well as single voltage steps
(data not shown) did not yield macroscopic currents. EGFP-positive neural
progenitors were carefully selected (morphological criteria) in order to avoid
contamination by other cell types. The unipolar EGFP-positive neurons
(Fig. 7B) expressed
voltage-dependent outward rectifying currents (n=7), whereas no
voltage-activated inward currents, neither INa nor IBa,
could be detected in the large majority of cells (22 out of 24). The outward
rectifying currents recorded in the bipolar as well as multipolar neurons were
identified as K+ currents based on their sensitivity towards the
K+ channel blocker, 4-aminopyridine (4-AP). 4-AP (2 mM) inhibited
73.69±8.2% of the aggregate outward current (HP -80 mV, step potential
+50 mV) (n=6, data not shown). Interestingly, at the early
developmental stage (EDS, d7+3/4), INa but not IBa
(Fig. 7E) was detected in 86%
of bipolar neurons (n=7), whereas almost all (80%) the multipolar
neurons (n=5) expressed both INa and IBa. At
subsequent stages (LDS, d7-19) all the bipolar and multipolar neurons
functionally expressed both currents. INa was further characterized
using the Na+ channel selective antagonist TTX which, as expected
for neuronal Na+ channels, blocked INa completely at a
concentration of 0.1 µM (Fig.
7C,D). INa densities in bipolar neurons increased
significantly with plating time (Fig.
7F) from 48.1±8.3 to 106.4±10.1 pA/pF
(n=60) and in multipolar neurons (data not shown) from
40.4±10.9 to 80.7±7.0 pA/pF (n=50), respectively.
INa density in the bipolar neurons was higher than that in the
multipolar neurons (Fig. 7G).
To further envisage whether there were qualitative and/or quantitative
differences in the expression pattern of IBa subtypes during
development, we investigated both bipolar and multipolar neurons by applying
selective antagonists. In four typical experiments of bipolar neurons we found
that the L-type Ca2+ channel antagonist Isradipine (3 µM)
suppressed 22.7±3.6% of the aggregate IBa, the N-type
specific Ca2+ channel blocker
-CgTX (3 µM) suppressed
14.2±3.7% and the P/Q type channel blocker
-AgaTX (0.1 µM)
suppressed 8.5±1.6%, respectively
(Fig. 8B,C). The remaining
Cd2+- sensitive (50 µM CdCl2) component amounted to
54.6±8.2% of control IBa. Similarly, in four typical
multipolar neurons the fraction of different Ca2+ channel subtypes
amounted to: L-type, 27.3±1.9%; N-type, 9.1±3.2%; P/Q type,
16.2±3.7%; and othertypes, 47.4±5.6%, respectively
(Fig. 8D).
|
|
Since receptor-operated ion channels are known to play an essential role
not only in carrying out fast synaptic transmission but also in the mediation
of trophic signals, and migration and synaptic arrangement during neuronal
development, we tested their functional expression at different time points
during neurogenesis. The neural progenitors (n=3) and unipolar
neurons (n=4) did not respond to
-aminobutyric (GABA),
glycine, kainate and NMDA. Clear agonist responses to GABA (1 mM) and glycine
(1 mM) were detected (Fig.
9A,B) in bipolar (n=8, current density 52.1±22.0
pA/pF) and multipolar neurons (n=8, current density 119.1±51.1
pA/pF). Moreover, as expected, the receptor-operated currents were blocked by
the competitive antagonists bicuculline (100 nM, n=8) and strychnine
(30 µM, n=8), respectively (HP -80 mV;
Fig. 9A,B). To further confirm
the ionic nature of the GABA and glycine-evoked currents, voltage ramps in the
presence of the agonist were substracted from control ramps. As can be seen in
the inset of Fig. 9A, the
subtracted voltage ramps for GABA yielded a reversal potential of
-28.3±1.1 mV (n=5), a value close to the calculated
Cl- equilibrium potential of -28.3 mV at 35°C. We could also
observe kainate responses in bipolar (n=8) as well as multipolar
cells (n=7), however current amplitude was low with slow activation
kinetics (data not shown).
|
| Discussion |
|---|
|
|
|---|
Neural ontogeny and nestin expression
Nestin expression in transgenic mice was reported to occur as early as
stage E7.5 (Zimmerman et al.,
1994
; Lothian and Lendahl,
1997
; Josephson et al.,
1998
; Lothian et al.,
1999
; Yaworsky and Kappen,
1999
), although it remains unclear whether or not it was
investigated at earlier stages. In the transgenic ES-cell model and in murine
blastocysts we demonstrated that nestin was expressed before lineage
specification. The reported cDNA sequence in the GenBank database from 3.5 dpc
murine blastocyst (accession no. C78523) having sequence similarity to mouse,
rat, and human nestin genes corroborated our findings on the presence of
nestin transcript in vivo. Similar observations on early expression of other
tissue-specific cytoskeletal proteins have also been described
(Bain et al., 1995
). Recently,
Streit et al. reported that neural induction in chick embryo occurred before
gastrulation, indirectly implicating that nestin, being a neural stem cell
marker, is probably evolutionarily conserved and might express prior to
gastrulation (Streit et al.,
2000
). However, the role of nestin, a cytoskeletal protein
belonging to the intermediate filament family, prior to the onset of
neurulation remains to be determined. It is possible that nestin, being one of
the earliest expressing cytoskeletal proteins, is required for laying a strong
cytoarchitectural foundation during early embryonic development.
Promoter/enhancer targeted neural specification
Previous studies from our group had already demonstrated the efficacy of
promoter-mediated targeting in the ES-cell system for a better understanding
of cardiomyogenesis (Kolossov et al.,
1998
). The current investigation allowed us to explore details of
in vitro neurogenesis. Previously, Steven Goldman's group used a
promoter-targeted and EGFP-reporter-based transient expression system in
primary cultures for neural cell type selection and isolation
(Wang et al., 1998
;
Roy et al., 2000a
;
Roy et al., 2000b
). However,
here we took advantage of the versatility of transgenic nestin ES-cell clones
combined with stable EGFP expression. The immunocytochemical,
electrophysiological and time-lapse observations provided direct proof of the
neural lineage confinement of nestin intron-II-driven EGFP expression in our
pluripotent transgenic ES-cell clones. The absence of EGFP expression in the
spontaneously beating clusters (data not shown) generated from the
differentiating EBs following the cardiac differentiation protocol
(Kolossov et al., 1998
) in
fact supported this. Additionally, the flow-cytometry-assisted quantification
of stably expressed nestin-driven EGFP provided insight to demarcating the
time and development-dependent neural progenitor population induction.
Neural differentiation and neurogenic quantification
Based on the qualitative microscopic observation, time-lapse monitoring and
concurrent quantitative FACS, two distinct temporal nestin induction patterns
(lineage- and lineage+), as discerned by EGFP
expression, were revealed. The biphasic EGFP expression pattern indeed
indicated the decrease in uncommitted ES cells upon differentiation by LIF
withdrawal and cell aggregation and concomitant increase in lineage-specified
neural progenitors. This indicates that a critical time window exists during
this one week regimen for the neural cell fate decision. Hence, selecting
these population of nestin-driven, EGFP-expressing ES cells and EB-derived
cells through FACS, and conditioning them to a selective lineage such as
neurons, astrocytes and oligodendrocytes would further provide us with useful
information regarding the guiding cues prior to lineage commitment and
specification. Indeed, the time-lapse monitoring of whole EBs (data not shown)
as well as of isolated cells unequivocally demonstrated the proliferation,
migration and differentiation of EGFP-positive neural progenitors into neurons
and glia. Thus, further study in this regard could answer the critical
question whether neurons and glia are generated from a common progenitor and
the existing crosstalk between these two cell types, as proposed in a number
of studies (Tamada et al.,
1998
; Vernadakis,
1996
).
The time course in neurogenic progression revealed that the maximum number
of neural progenitors was generated between 4 and 12 days after EB plating.
Accordingly, we could subdivide the transgenic EB-derived cells broadly into
three groups. The brightest shining, EGFP-positive cells on plated EBs were
categorized into group I, which included the sub-population of mitotically
active neural progenitors as revealed by nestin immunostaining and
semi-quantitative fluorescence detection in isolated cells. Group II, with
medium and low EGFP, included the population of weak shining bi- and
multipolar neurons as well as glia. EGFP-negative cells were categorized under
group III, which included the more differentiated neurons and glia along with
other non-neural cell types. Hence, the overall heterogeneity in the full
length human nestin intron-II-enhancer-driven EGFP expression in ES cells upon
differentiation reflects clearly the endogenous nestin expression as reported
(Yaworsky and Kappen, 1999
)
and the asynchrony in neural progenitor generation. Although the significance
of this heterogeneity is not well understood, the temporal- and
region-dependent differential expression of specific transcription factors
leading to neural stem cell heterogeneity might be the causal basis
(Yaworsky and Kappen,
1999
).
Ion channel expression during neural development
Voltage-dependent ion channels were acclaimed to be cellular fingerprints
for the properties and patterns of neuronal cells during differentiation
(Takahashi and Okamura, 1998
).
In earlier studies on the whole EB
(Strubing et al., 1995
;
Arnhold et al., 2000
), only
cells with distinct neuronal morphology located at the periphery could be
characterized. We have taken advantage of single cell isolation and EGFP
labelling for the identification and functional characterization; this allowed
easy detection of neural progenitors and unipolar neurons that were otherwise
almost impossible to discern from non-neural cell types. Based on morphology
and EGFP intensity we could distinguish four populations of neuronal cells
with different electrophysiological characteristics. The undifferentiated
neural progenitors did not display voltage-dependent ion channels, whereas
unipolar neurons were found to express voltage-dependent 4-AP sensitive
K+ channels. By contrast, differentiated neurons such as bipolar
and multipolar neurons expressed voltage-dependent K+ and
Ca2+, as well as TTX-sensitive neuronal Na+ channels.
Earlier reports (Barish, 1991
;
Grantyn et al., 1989
;
Gottmann et al., 1989
) in
cultured neuronal precursors suggested the expression of low-voltage-activated
Ca2+ currents prior to the appearance of voltage-dependent
Na+- and Ca2+ currents. However, in line with our
findings, Bain et al. reported that, within the first four days of plating,
there was a small number of ES-cell-derived neuron-like cells that lacked
voltage-activated inward currents, although their differentiation state was
not defined (Bain et al.,
1995
).
The cell-type-specific ion channel expression might serve specific
functions during neuronal maturation. It is possible that neurite outgrowth in
conjunction with inter-synaptic connections determine the expression of
voltage-activated inward currents or vice versa. Neuronal Na+
channels were detected prior to the onset of voltage-dependent Ca2+
channels in differentiating neurons indirectly suggesting the possible
existence of two diverse (lagging and leading in terms of ion channel
expression), ES-cell-derived bipolar neuronal subtypes. Similar differences in
the inception of ICa expression between cultured chick sensory and
autonomic neuronal precursors have been reported earlier
(Gottmann et al., 1988
). Since
the Ca2+ entry into neuronal cells through voltage-gated
Ca2+ channels influences neuronal excitability as well as synaptic
transmission (Augustine et al.,
1987
; Spitzer et al.,
1994
), the absence of ICa in unipolar as well as some
bipolar neurons at d7+3/4 suggested that these differentiating, relatively
young, neurons had not yet established connection with their neighbouring
counterparts and hence lacked the functional expression of these ion channels.
Pharmacological evaluation of subtypes of voltage-dependent Ca2+
currents in differentiated neurons revealed that these already expressed N-
and P/Q-type Ca2+ currents that were expected to be found in
neuronal and neuroendocrine cells
(Scherubl et al., 1993
). In
addition, receptor-operated channels prevalently of the inhibitory type were
detected in bipolar and multipolar neurons. Taken together, the expression of
functional ion channels in the developing neurons from ES cells in vitro seems
to be related not to the stage (day after plating) alone, as proposed earlier
(Bain et al., 1995
;
Strubing et al., 1995
), but
primarily to the morphology. This demonstrates that ion channel expression
parallels closely the cellular functional demands during neurogenesis.
Thus, the use of live reporter EGFP under the regulatory control of the neural-specific enhancer nestin has given us the means to investigate not only its expression, but also quantitative- and functional characteristics of neurogenesis during early stages of development. This system would help to increase the diversity of self-renewing and multipotent neural progenitors by using fluorescence activated cell sorting (FACS) and, consequently, allow their use in experimental transplantation purposes.
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Arnhold, S., Andressen, C., Angelov, D. N., Vajna, R., Volsen, S. G., Hescheler, J. and Addicks, K. (2000). embryonic stem-cell derived neurones express a maturation dependent pattern of voltage-gated calcium channels and calcium-binding proteins. Int. J. Dev. Neurosci. 18,201 -212.[Medline]
Augustine, G. J., Charlton, M. P. and Smith, S. J. (1987). Calcium action in synaptic transmitter release. Annu. Rev. Neurosci. 10,633 -693.[Medline]
Bain, G., Kitchens, D., Yao, M., Huettner, J. E. and Gottlieb, D. I. (1995). Embryonic stem cells express neuronal properties in vitro. Dev. Biol. 168,342 -357.[Medline]
Barish, M. E. (1991). Voltage-gated calcium
currents in cultured embryonic Xenopus spinal neurones. J.
Physiol. 444,523
-543.
Bjornson, C. R., Rietze, R. L., Reynolds, B. A., Magli, M. C.
and Vescovi, A. L. (1999). Turning brain into blood: a
hematopoietic fate adopted by adult neural stem cells in vivo.
Science 283,534
-537.
Cattaneo, E. and McKay, R. (1990). Proliferation and differentiation of neuronal stem cells regulated by nerve growth factor. Nature 347,762 -765.[Medline]
Doetsch, F., Caille, I., Lim, D. A., Garcia-Verdugo, J. M. and Alvarez-Buylla, A. (1999). Subventricular zone astrocytes are neural stem cells in the adult mammalian brain. Cell 97,703 -716.[Medline]
Gage, F. H. (2000). Mammalian neural stem
cells. Science 287,1433
-1438.
Gottmann, K., Dietzel, I. D., Lux, H. D., Huck, S. and Rohrer, H. (1988). Development of inward currents in chick sensory and autonomic neuronal precursor cells in culture. J. Neurosci. 8,3722 -3732.[Abstract]
Gottmann, K., Dietzel, I. D., Lux, H. D. and Ruedel, C. (1989). Protoninduced Na+ current develops prior to voltage-dependent Na+ and Ca2+ currents in neuronal precursor cells from chick dorsal root ganglion. Neurosci. Lett. 99,90 -94.[Medline]
Grantyn, R., Perouansky, M., Rodriguez-Tebar, A. and Lux, H. D. (1989). Expression of depolarizing vol. Brain Res. Dev. Brain Res. 49,150 -155.[Medline]
Hamill, O. P., Marty, A., Neher, E., Sakmann, B. and Sigworth, F. J. (1981). Improved patch-clamp techniques for high-resolution current recording from cells and cell-free membrane patches. Pflugers Arch. 391,85 -100.[Medline]
Hockfield, S. and McKay, R. D. (1985). Identification of major cell classes in the developing mammalian nervous system. J. Neurosci. 5,3310 -3328.[Abstract]
Johansson, B. M. and Wiles, M. V. (1995). Evidence for involvement of activin A and bone morphogenetic protein 4 in mammalian mesoderm and hematopoietic development. Mol. Cell. Biol. 15,141 -151.[Abstract]
Josephson, R., Muller, T., Pickel, J., Okabe, S., Reynolds, K., Turner, P. A., Zimmer, A. and McKay, R. D. (1998). POU transcription factors control expression of CNS stem cell-specific genes. Development 125,3087 -3100.[Abstract]
Kolossov, E., Fleischmann, B. K., Liu, Q., Bloch, W.,
Viatchenko-Karpinski, S., Manzke, O., Ji, G. J., Bohlen, H., Addicks, K. and
Hescheler, J. (1998). Functional characteristics of ES
cell-derived cardiac precursor cells identified by tissue-specific expression
of the green fluorescent protein. J. Cell Biol.
143,2045
-2056.
Krum, J. M. and Rosenstein, J. M. (1999). Transient coexpression of nestin, GFAP, and vascular endothelial growth factor in mature reactive astroglia following neural grafting or brain wounds. Exp. Neurol. 160,348 -360.[Medline]
Laywell, E. D., Dorries, U., Bartsch, U., Faissner, A.,
Schachner, M. and Steindler, D. A. (1992). Enhanced
expression of the developmentally regulated extracellular matrix molecule
tenascin following adult brain injury. Proc. Natl. Acad. Sci.
USA 89,2634
-2638.
Lee, S. H., Lumelsky, N., Studer, L., Auerbach, J. M. and McKay, R. D. (2000). Efficient generation of midbrain and hindbrain neurons from mouse embryonic stem cells. Nat. Biotech. 18,675 -679.[Medline]
Lendahl, U. (1997). Transgenic analysis of central nervous system development and regeneration. Acta Anaesthesiol. Scand. Suppl. 110,116 -118.[Medline]
Lendahl, U., Zimmerman, L. B. and McKay, R. D. (1990). CNS stem cells express a new class of intermediate filament protein. Cell 60,585 -595.[Medline]
Lothian, C. and Lendahl, U. (1997). An evolutionarily conserved region in the second intron of the human nestin gene directs gene expression to CNS progenitor cells and to early neural crest cells. Eur. J. Neurosci. 9, 452-462.[Medline]
Lothian, C., Prakash, N., Lendahl, U. and Wahlstrom, G. M. (1999). Identification of both general and region-specific embryonic CNS enhancer elements in the nestin promoter. Exp. Cell Res. 248,509 -519.[Medline]
Maltsev, V. A., Wobus, A. M., Rohwedel, J., Bader, M. and
Hescheler, J. (1994). Cardiomyocytes differentiated in vitro
from embryonic stem cells developmentally express cardiac-specific genes and
ionic currents. Circ. Res.
75,233
-244.
Messam, C. A., Hou, J. and Major, E. O. (2000). Coexpression of nestin in neural and glial cells in the developing human CNS defined by a human-specific anti-nestin antibody. Exp. Neurol. 161,585 -596.[Medline]
Mujtaba, T., Mayer-Proschel, M. and Rao, M. S. (1998). A common neural progenitor for the CNS and PNS. Dev. Biol. 200,1 -15.[Medline]
Namiki, J. and Tator, C. H. (1999). Cell proliferation and nestin expression in the ependyma of the adult rat spinal cord after injury. J. Neuropathol. Exp. Neurol. 58,489 -498.[Medline]
Okabe, S., Forsberg-Nilsson, K., Spiro, A. C., Segal, M. and McKay, R. D. (1996). Development of neuronal precursor cells and functional postmitotic neurons from embryonic stem cells in vitro. Mech. Dev. 59,89 -102.[Medline]
Pekny, M., Johansson, C. B., Eliasson, C., Stakeberg, J.,
Wallen, A., Perlmann, T., Lendahl, U., Betsholtz, C., Berthold, C. H. and
Frisen, J. (1999). Abnormal reaction to central nervous
system injury in mice lacking glial fibrillary acidic protein and vimentin.
J. Cell Biol. 145,503
-514.
Reynolds, B. A. and Weiss, S. (1992).
Generation of neurons and astrocytes from isolated cells of the adult
mammalian central nervous system. Science
255,1707
-1710.
Rohwedel, J., Guan, K. and Wobus, A. M. (1999). Induction of cellular differentiation by retinoic acid in vitro. Cells Tissues Organs 165,190 -202.[Medline]
Rossi, F., Bravin, M., Buffo, A., Fronte, M., Savio, T. and Strata, P. (1997). Intrinsic properties and environmental factors in the regeneration of adult cerebellar axons. Prog. Brain Res. 114,283 -296.[Medline]
Roy, N. S., Benraiss, A., Wang, S., Fraser, R. A., Goodman, R., Couldwell, W. T., Nedergaard, M., Kawaguchi, A., Okano, H. and Goldman, S. A. (2000a) Promoter-targeted selection and isolation of neural progenitor cells from the adult human ventricular zone. J. Neurosci. Res. 59,321 -331.[Medline]
Roy, N. S., Wang, S., Jiang, L., Kang, J., Benraiss, A., Harrison-Restelli, C., Fraser, R. A., Couldwell, W. T., Kawaguchi, A., Okano, H. et al. (2000b) In vitro neurogenesis by progenitor cells isolated from the adult human hippocampus. Nat. Med. 6, 271-277.[Medline]
Scherubl, H., Kleppisch, T., Zink, A., Raue, F., Krautwurst, D.
and Hescheler, J. (1993). Major role of
dihydropyridine-sensitive Ca2+ channels in Ca2+-induced
calcitonin secretion. Am. J. Physiol.
264,E354
-E360.
Spitzer, N. C., Gu, X. and Olson, E. (1994). Action potentials, calcium transients and the control of differentiation of excitable cells. Curr. Opin. Neurobiol. 4, 70-77.[Medline]
Streit, A., Berliner, A. J., Papanayotou, C., Sirulnik, A. and Stern, C. D. (2000). Initiation of neural induction by FGF signalling before gastrulation. Nature 406, 74-78.[Medline]
Strubing, C., Ahnert-Hilger, G., Shan, J., Wiedenmann, B., Hescheler, J. and Wobus, A. M. (1995). Differentiation of pluripotent embryonic stem cells into the neuronal lineage in vitro gives rise to mature inhibitory and excitatory neurons. Mech. Dev. 53,275 -287.[Medline]
Takahashi, K. and Okamura, Y. (1998). Ion
channels and early development of neural cells. Physiol.
Rev. 78,307
-337.
Tamada, Y., Tanaka, M., Munekawa, K., Hayashi, S., Okamura, H., Kubo, T., Hisa, Y. and Ibata, Y. (1998). Neuron-glia interaction in the suprachiasmatic nucleus: a double labeling light and electron microscopic immunocytochemical study in the rat. Brain Res. Bull. 45,281 -287.[Medline]
van der Kooy, D. and Weiss, S. (2000). Why stem
cells? Science 287,1439
-1441.
Vernadakis, A. (1996). Glia-neuron intercommunications and synaptic plasticity. Prog. Neurobiol. 49,185 -214.[Medline]
Wang, S., Wu, H., Jiang, J., Delohery, T. M., Isdell, F. and Goldman, S. A. (1998). Isolation of neuronal precursors by sorting embryonic forebrain transfected with GFP regulated by the T alpha 1 tubulin promoter. Nat. Biotechnol. 16,196 -201.[Medline]
Wobus, A. M., Wallukat, G. and Hescheler, J. (1991). Pluripotent mouse embryonic stem cells are able to differentiate into cardiomyocytes expressing chronotropic responses to adrenergic and cholinergic agents and Ca2+ channel blockers. Differentiation 48,173 -182.[Medline]
Yaworsky, P. J. and Kappen, C. (1999). Heterogeneity of neural progenitor cells revealed by enhancers in the nestin gene. Dev. Biol. 205,309 -321.[Medline]
Zimmerman, L., Parr, B., Lendahl, U., Cunningham, M., McKay, R., Gavin, B., Mann, J., Vassileva, G. and McMahon, A. (1994). Independent regulatory elements in the nestin gene direct transgene expression to neural stem cells or muscle precursors. Neuron 12, 11-24.[Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
Z. Jin, L. Liu, W. Bian, Y. Chen, G. Xu, L. Cheng, and N. Jing Different Transcription Factors Regulate nestin Gene Expression during P19 Cell Neural Differentiation and Central Nervous System Development J. Biol. Chem., March 20, 2009; 284(12): 8160 - 8173. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Jomary and S. E. Jones Induction of Functional Photoreceptor Phenotype by Exogenous Crx Expression in Mouse Retinal Stem Cells Invest. Ophthalmol. Vis. Sci., January 1, 2008; 49(1): 429 - 437. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Wiese, A. Rolletschek, G. Kania, A. Navarrete-Santos, S. V. Anisimov, B. Steinfarz, K. V. Tarasov, S. A. Brugh, I. Zahanich, C. Ruschenschmidt, et al. Signals from Embryonic Fibroblasts Induce Adult Intestinal Epithelial Cells to Form Nestin-Positive Cells with Proliferation and Multilineage Differentiation Capacity In Vitro Stem Cells, September 1, 2006; 24(9): 2085 - 2097. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Fukuda, J. Takahashi, K. Watanabe, H. Hayashi, A. Morizane, M. Koyanagi, Y. Sasai, and N. Hashimoto Fluorescence-Activated Cell Sorting-Based Purification of Embryonic Stem Cell-Derived Neural Precursors Averts Tumor Formation after Transplantation Stem Cells, March 1, 2006; 24(3): 763 - 771. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. S. O'Shea Self-renewal vs. Differentiation of Mouse Embryonic Stem Cells Biol Reprod, December 1, 2004; 71(6): 1755 - 1765. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Zeng, J. Chen, J. F. Sanchez, M. Coggiano, O. Dillon-Carter, J. Petersen, and W. J. Freed Stable Expression of hrGFP by Mouse Embryonic Stem Cells: Promoter Activity in the Undifferentiated State and During Dopaminergic Neural Differentiation Stem Cells, November 1, 2003; 21(6): 647 - 653. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. K. Humphrey, N. Bucay, G. M. Beattie, A. Lopez, C. A. Messam, V. Cirulli, and A. Hayek Characterization and Isolation of Promoter-Defined Nestin-Positive Cells from the Human Fetal Pancreas Diabetes, October 1, 2003; 52(10): 2519 - 2525. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Chen, R. P. Revoltella, S. Papini, M. Michelini, W. Fitzgerald, J. Zimmerberg, and L. Margolis Multilineage Differentiation of Rhesus Monkey Embryonic Stem Cells in Three-Dimensional Culture Systems Stem Cells, May 1, 2003; 21(3): 281 - 295. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||