spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Barth, A. I. M.
Right arrow Articles by Nelson, W. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Barth, A. I. M.
Right arrow Articles by Nelson, W. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Journal of Cell Science 115, 1583-1590 (2002)
© 2002 The Company of Biologists Limited


Research Article

Dissecting interactions between EB1, microtubules and APC in cortical clusters at the plasma membrane

Angela I. M. Barth*, Kathleen A. Siemers and W. James Nelson

Department of Molecular and Cellular Physiology, Stanford University School of Medicine, Stanford, CA 94305-5435, USA

* Author for correspondence (e-mail: angelab{at}stanford.edu )

Accepted 13 January 2002


    Summary
 Top
 Summary
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
End-binding protein (EB) 1 binds to the C-terminus of adenomatous polyposis coli (APC) protein and to the plus ends of microtubules (MT) and has been implicated in the regulation of APC accumulation in cortical clusters at the tip of extending membranes. We investigated which APC domains are involved in cluster localization and whether binding to EB1 or MTs is essential for APC cluster localization. Armadillo repeats of APC that lack EB1- and MT-binding domains are necessary and sufficient for APC localization in cortical clusters; an APC fragment lacking the armadillo repeats, but containing MT- and EB1-binding domains, does not localize to the cortical clusters but instead co-aligns with MTs throughout the cell. Significantly, analysis of endogenous proteins reveals that EB1 does not accumulate in the APC clusters. However, overexpressed EB1 does accumulate in APC clusters; the APC-binding domain in EB1 is located in the C-terminal region of EB1 between amino acids 134 and 268. Overexpressed APC- or MT-binding domains of EB1 localize to APC cortical clusters and MT, respectively, without affecting APC cluster formation itself. These results show that localization of APC in cortical clusters is different from that of EB1 at MT plus ends and appears to be independent of EB1.

Key words: Adenomatous polyposis coli, End-binding protein 1, Microtubules


    Introduction
 Top
 Summary
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Adenomatous polyposis coli (APC) protein is the product of a tumor suppressor gene mutated in colorectal cancer (Groden et al., 1991Go) and is involved in downregulating ß-catenin signaling by mediating ß-catenin degradation (for a review, see Polakis, 1999Go). However, there is increasing evidence for another role of APC in organizing the MT cytoskeleton. The C-terminus of APC has a MT-binding site and, in vitro, APC stimulates MT assembly and bundling (Munemitsu et al., 1994Go). In epithelial cells, APC protein accumulates in cortical clusters at the tip of actively extending membranes (Näthke et al., 1996Go; Barth et al., 1997bGo), suggesting a role for APC in promoting cell extension and cell migration (Barth et al., 1997aGo; Näthke et al., 1997Go; Pollack et al., 1997Go).

Overexpression of APC or C-terminal APC fragments causes APC accumulation at the plus end of MTs, and this accumulation has been attributed to APC binding to EB1 (Askham et al., 2000Go; Mimori-Kiyosue et al., 2000aGo). EB1 (Su et al., 1995Go) binds to distal (plus) ends of interphase MTs (Berrueta et al., 1998Go; Morrison et al., 1998Go; Mimori-Kiyosue et al., 2000bGo) and in vitro can promote MT polymerization in the presence of the C-terminal-binding domain of APC (Nakamura et al., 2001Go).

The APC-EB1 complex may act as a MT capturing complex in interphase cells that directs MT plus ends to specific cortical sites at the tip of extending membranes. In yeast, the EB1 homologue Bim1p links MT plus ends to the cortical protein Kar9p, which is localized to a defined area at the bud tip (Korinek et al., 2000Go; Lee et al., 2000Go; Miller et al., 2000Go). Alternatively, an APC-EB1 complex at the plus ends of MT may link MT to a yet unknown anchoring complex at the cortex; in this context, Kar9p localization at the bud tip is independent of Bim1p (Miller et al., 1999Go; Miller et al., 2000Go).

Little is known about cortical APC cluster formation and the role of EB1 in determining APC localization in these clusters. Therefore, we have investigated which APC domains are involved in APC cluster localization and how this localization is affected by expression of EB1 mutant proteins. Our results show that the localization of APC in cortical clusters is different from that of EB1 at MT plus ends and further indicate that it is independent of EB1.


    Materials and Methods
 Top
 Summary
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Cell lines and cDNA constructs
Madin-Darby canine kidney (MDCK) type II/G cells and conditions for their growth have been described previously (Mays et al., 1995Go). MDCK cells were transiently transfected with fluorescent protein vectors described below using lipofectamine reagent as described by the manufacturer (Gibco BRL, Gaithersburg, MD).

For construction of different APC expression vectors, pCDNAI/APC0-87 (kindly provided by Paul Polakis, Onyx Pharmaceuticals) was used as a template. This vector encodes full-length human APC with a short additional amino-acid sequence domain, inserted between amino acids 470 and 471 and derived from exon 10A of the APC gene, which is found in some splice variants of APC (Sulekova and Ballhausen, 1995Go). For easier comparison, amino acid positions for human APC are given without the `exon 10A' domain. Vectors for fluorescent proteins were obtained from Clontech Laboratories, Inc. (Palo Alto, CA). Italic sequences in the primers correspond to the respective APC or EB1 sequences. Underlined sequences in the primers mark restriction sites used for cloning. All constructs were confirmed by sequencing. For schematic representations of the constructs, see Fig. 2.



View larger version (46K):
[in this window]
[in a new window]
 
Fig. 2. The APC armadillo repeat domain localizes to cortical APC clusters. Basal sections of cells expressing different APC domains (shown schematically on left) fused to GFP (GFP: green) co-stained for endogenous full-length APC (APC: red) or for ß-tubulin (Tub: red). Note that the APC antiserum (anti-APC) does not recognize the deleted GFP-APC fusion proteins because they lack the epitope. (a-c) Full-length GFP-APC co-aligns along MTs (white arrowheads in a-c) and accumulates in cortical clusters at the tip of cell extensions distal to the MT ends (black arrowheads in a-c). (d-f) GFP-APCwoE1 co-aligns with MTs but does not colocalize with endogenous APC in clusters at the tip of cell extensions (black arrowheads in d-f). (g-n) GFP-APCE1X1 localizes to the cortical APC clusters (black arrowheads in g-i), but does not co-align with MTs (black arrowheads in k-n). (o-q) APCARM-GFP does not co-align with MTs but colocalizes with endogenous APC in the cortical clusters (black arrowheads in o-q). (r-t) APCARM-Rep.-GFP shows weak colocalization in some APC clusters (black arrowheads in r-t) but not others (white arrowheads in r-t).

 

GFP-APC (APC amino acids 1-2843): full-length APC was amplified by PCR with the 5' primer GATCGGAGCTCCAAGGATGGCTGCAGCTTCATATGATCAGTTG and the 3' primer GATCGGATCCAACAGATGTCACAAGGTAAGACCC and cloned SacI/BamHI into pEGFP-C1. GFP-APCwoE1 (GFP-APC without the internal EcoRI fragment; deletion of APC amino acids 221-2166): `in frame' ligation of the two internal EcoRI sites of the GFP-APC cDNA. GFP-APCE1X1 (APC amino acids 220-872): the APC internal 5' EcoRI/XmnI fragment was cloned into the EcoRI/SmaI sites of pEGFP-C3. APCARM-GFP (APC amino acids 461-777): part of the APC armadillo repeat domain was amplified by PCR with 5' primer AAGTCGACTCGAGGAATTCCCGCCACCATGGAGCATAGACATGCAATGAATGAACTAGGGGGACTACAGGCCATTGCAGAATTATTGCAAGTGG and 3' primer AAAGTCGACCTCTCGAGGGGATCCGTCTATATTGTCAAAAGTTTCTGATAAGTGCTGAGCATCTAATTCTGCTTC and cloned EcoRI/BamHI into pEGFP-N3. APCARM-Rep.-GFP (APC amino acids 504-77): a smaller part of the APC armadillo repeat domain was amplified by PCR with 5' primer AAGTCGACTCGAGGAATTCCCGCCACCATGGCTTTGACAAACTTGACTTTTGGAGATGTAGCCAACAAGGC and the same 3' primer as for APCARM-GFP and cloned EcoRI/BamHI into pEGFP-N3. GST-APCCT (APC amino acids 2672-2843): was amplified by PCR with 5' primer GAGCTCGTCGACGCCACCATGGGAAGATCTCCCACAGGTAATACTCCCCCGGTGATTG and 3' primer GAGCTCGCGGCCGCAGTCGACGGATCCAACAGATGTCACAAGGTAAGACCCAGAATGGCGCTTAGG and cloned SalI into pGEX-6P-3 (Amersham Pharmacia) for the expression of glutathione S-transferase (GST) fusion protein in bacteria.

EB1 cDNA's were obtained by PCR amplification from a HeLa cDNA library (Clontech) and cloned into pCR4BluntTOPO (Invitrogen, Carlsbad, CA) as described by the manufacturer. Full-length human EB1, encoding 268 amino acids, was amplified by PCR with 5' primer GGATCCGGTACCGTCGACGAATTCGCCACCATGGCAGTGAACGTATACTCAACGTCAGTGACCAGTG and 3' primer GTCGACGGTACCGGATCCTCTAGATTAATACTCTTCTTGCTCCTCCTGTGGGCCCCCTTCAT. EB1NT (amino acids 1-154) was amplified with the same 5 primer as full-length EB1 and 3' primer GTCGACGGTACCGGATCCTCTAGATTAAGTGAGAGGTTTCTTCGGTTTATTCAGAGCTGGAGCAAC. EB1 and EB1NT were cloned KpnI/BamHI into pDsRed-C1 for the expression of fluorescent fusion proteins in MDCK cells and were cloned BamHI/XbaI into pMAL (New England Biolabs) for the expression of Maltose-binding protein (MBP) fusion proteins in bacteria. EB1CT (amino acids 134-268) was amplified with 5' primer GGATCCGGTACCGTCGACGAATTCGCCACCATGGAAACTGCAGTGGCTCCTTCCCTTGTTGCTCCAG and the same 3'primer as full-length EB1. EB1CT was cloned SalI/BamHI into pDsRed-C1 and EcoRI /XbaI into pMal.

Antibodies
The following antibodies and dilutions were used: polyclonal rabbit antiserum to a central APC domain (Näthke et al., 1996Go) at a 1:200 dilution; mouse monoclonal antibody to EB1 (clone Ab-1; Oncogene Research Products) at 2 µg/ml (immunoblotting showed that the antibody recognizes EB1 and EB1CT, but not EB1NT (AB, unpublished result)); and, mouse monoclonal antibody to ß-tubulin (clone TUB2.1; Sigma) at 1:100. For immunoaffinity purification of GST fusion proteins, rabbit polyclonal antisera to the C-terminus of APC (clone C20; Santa Cruz Biotechnology, Inc.) and to glutathione S-transferase (clone GST Z-5; Santa Cruz Biotechnology, Inc.) were used.

Immunofluorescence microscopy
2x105 MDCK cells were seeded onto 22x22 mm collagen-coated coverslips in 35 mm tissue culture dishes and fixed 12 to 16 hours later. Cells were rinsed once in PBS pH 7.4 (2.7 mM KCl, 1.5.mM KH2PO4, 1.5 mM MgCl2, 1 mM EGTA, 137 mM NaCl and 8.1 mM NaHPO4), fixed for 5 minutes in -20°C methanol and then rinsed once in PBS with 0.1% Triton-X-100. Cells were washed three times in PBS and blocked for 20 minutes at room temperature in PBS with 1% BSA and 2% goat serum. Cells were labeled for immunofluorescence as described elsewhere (Barth et al., 1997bGo) and analyzed with a Delta VisionTM full-spectrum optical sectioning microscope system (Applied Precision, Inc., Seattle, WA; Beckman Center Cell Sciences Imaging Facility). The percentage of cortical APC clusters that had total or partial overlap with EB1 was determined in basal sections of 10 MDCK cells, which had a total of 15 cluster areas immunolabelled for endogenous APC and EB1.

Protein-binding assay
Bacterial cultures were resuspended in 50 mM Tris pH 8, 2 mM EDTA, 0.1% Triton-X-100, 1mM DTT and complete protease inhibitor cocktail (Roche Molecular Biochemicals), then lysed with a French press (ThermoSpectronic, Rochester, NY). GST or MBP fusion proteins were purified with glutathione-sepharose (Sigma) or amylose-resin (New England Biolabs) according to the manufacturer's instructions. GST-APCCT was further purified by immunoprecipitation with anti-APC C20 (Santa Cruz Biotechnology, Inc) bound to protein A-sepharose (Amersham Pharmacia), and GST was further purified by immunoprecipitation with anti-GST Z-5 (Santa Cruz Biotechnology, Inc). Equivalent amounts of GST-APCCT or GST bound to the respective immunoaffinity resins and, as a control, the immunoaffinity resins alone were incubated for 2 hours at 4°C with 20 µg MBP as a control or with 7 µg MBP-EB1 or MBP-EB 1CT in 10 mM phosphate buffer pH 7.4, 2.7 mM KCl, 137 mM NaCl, 10 mM maltose, 1% Triton-X-100, 1 mM DTT and then washed four times with 30 volumes of the same buffer. Proteins bound to the immunoaffinity resins were analyzed by SDS-PAGE as described previously (Barth et al., 1997bGo). Polyacrylamide gels were stained with with Coomassie Brillant Blue R-250 and scanned with a ScanJet IIc (Hewlett-Packard Co., Palo Alto, CA).

MT pelleting assay
Purified bovine brain tubulin (kindly provided by Eugenio de Hostos, University of California, San Francisco) was polymerized in PEM (80 mM Pipes/Dipotassium Salt pH 6.9, 1 mM MgCl2, 1 mM EGTA), 0.2 mM GTP at a concentration of 5.5 µg/µl for 10 minutes at 37°C. Tubulin was diluted to 1.1 µg/µl with PEM, 20 µM Taxol and incubated for another 10 minutes at 37°C. MBP fusion proteins in 10 mM phosphate buffer pH 7.4, 2.7 mM KCl, 137 mM NaCl, 10 mM maltose were pre-cleared by a 30 minute centrifugation at 4°C and 200,000 g in a TL100 Ultracentrifuge (Beckman). Taxol and MgCl2 were added to the fusion proteins to a final concentration of 20 µM and 5 mM, respectively. 100 µl of polymerized tubulin at a concentration of 1.1 µg/µl was mixed with 100 µl of MBP, MBP-EB1 or MBP-EB1CT fusion protein, respectively, and incubated for 10 minutes at RT. Equivalent amounts of MBP-EB1 and MBP-EB1CT (~50 µg) were used in the assay. MBP fusion proteins bound to polymerized tubulin were precipitated by centrifugation through a 30% glycerol cushion in PEM, 5 µM Taxol, 1 mM Pefabloc (Roche Molecular Biochemicals) for 30 minutes, at RT at 160,000 g in a SW60 rotor (Beckman). After centrifugation, the supernatant with the remaining tubulin-MBP fusion protein solution and half of the cushion was removed and the centrifugation tubes were washed twice with dH2O before complete removal of the residual cushion. Pellets were resuspended in SDS-PAGE loading buffer and analyzed by SDS-PAGE (Barth et al., 1997bGo). Polyacrylamide gels were stained with Coomassie Brilliant Blue R-250 and scanned with a ScanJet IIc (Hewlett-Packard Co., Palo Alto, CA).


    Results and Discussion
 Top
 Summary
 Introduction
 Materials and Methods
 Results and Discussion
 References
 
Endogenous APC and EB1 do not colocalize
Distributions of endogenous APC and EB1 in normal Madin-Darby canine kidney (MDCK) epithelial cells were compared by double immunofluorescence (Fig. 1). EB1 accumulates throughout the cell periphery in small granules (Fig. 1a-e) that have been previously shown to be at the distal (plus) ends of MTs (Berrueta et al., 1998Go; Morrison et al., 1998Go; Mimori-Kiyosue et al., 2000bGo) (Fig. 4a-c). In contrast, endogenous APC localizes in cortical clusters at the tip of cell extensions (Fig. 1a'-e'; arrowheads) and in a filamentous distribution throughout the cytoplasm along MTs (Fig. 1a'-e'; Fig. 2a-c). We note that EB1 does not accumulate in cortical APC clusters (Fig. 1; black arrowheads) but it is often found in close proximity to these clusters (Fig. 1; white arrowheads). 22% of the cortical APC clusters show some overlap with EB1. In general, EB1 granules are located throughout the cell cortex, whereas APC clusters are restricted to the basal surface and to the tip of cell extensions (Fig. 1; arrowheads) (data not shown).



View larger version (66K):
[in this window]
[in a new window]
 
Fig. 1. Subcellular distribution of endogenous APC and EB1 in MDCK cells. Basal sections of MDCK cells co-stained for EB1 (green in a-e and a''-e'') and APC (red in a'-e' and a''-e''). Arrowheads, cortical APC clusters at the tip of cell extensions; black arrowheads, APC clusters without EB1; white arrowheads, APC clusters partially overlapping with EB1. Bars, 10 µm. Insets, higher magnification of the upper left cell extension in a-a" co-stained for EB1 (green) and APC (red). Bar, 2.5 µm.

 


View larger version (121K):
[in this window]
[in a new window]
 
Fig. 4. Subcellular localization of DsRed-EB1, DsRed-EB1CT and DsRedEB1NT in MDCK cells. (a-f) Basal sections of cells expressing full-length DsRed-EB1 (a-c) or DsRed-EB1CT (d-f) and co-stained with a mouse monoclonal antibody to ß-tubulin (green). (a-c) DsRed-EB1 predominantly localizes to the distal (plus) ends of MTs (arrows in a-c). (d-f) DsRed-EB1CT is enriched in cortical clusters at the tip of the cell extension (arrowheads in d-f) and occasionally localizes to the plus end of MTs (arrows in d-f). (g-i) Basal sections of cell extensions of a MDCK cell expressing DsRed-EB1NT (red, marked with `+') and an untransfected MDCK cell marked as `-'. Cells were costained with a mouse monoclonal antibody to EB1 (green) that does not recognize DsRed-EB1NT (see Material and Methods). DsRed-EB1NT co-aligns along MTs including their distal (plus) ends, which are marked by endogenous EB1 (green) but is not as well restricted to the distal (plus) ends of MTs as endogenous EB1 (arrows in g-i). Bar, 10 µm.

 

The N-terminal Armadillo repeat domain of APC is necessary and sufficient for APC localization in cortical clusters
To define the APC domain required for APC localization in cortical clusters, full-length APC and different domains of APC fused to GFP were expressed in MDCK cells (Fig. 2). Full-length GFP-APC localized in cortical clusters into which MTs terminated (Fig. 2a-c; black arrowheads) and along MTs (Fig. 2a-c; white arrowheads). An APC mutant lacking a large central part of the protein (GFP-APCwoE1) did not colocalize in cortical clusters containing endogenous APC (Fig. 2d-f) even though GFP-APCwoE1 retains the N-terminal APC-APC dimerization domain (Joslyn et al., 1993Go). However, GFP-APCwoE1 did localize along MTs (Fig. 2d-f) probably through its C-terminal MT- and/or EB1-binding domains.

Next, we examined the distribution of APC mutants lacking C-terminal MT- and EB 1-binding domains. We made GFP-APC E1X1, which contains the highly conserved APC domain and armadillo repeats 1-9 of 10 APC armadillo repeats as defined by Huber and Weis (Huber and Weis, 2001Go) including the `exon 10A' domain and APCARM-GFP, which contains armadillo repeats 3-9. Both mutant proteins prominently colocalize with endogenous cortical APC clusters, but neither protein localizes along MTs (Fig. 2g-q). Expression of APCARM-1.Rep-GFP, which contains armadillo repeats 4-9, strongly diminished, but did not completely eliminate mutant protein localization to cortical clusters of endogenous APC (Fig. 2r-t).

In summary, armadillo repeats 3-9 are necessary and sufficient to mediate localization of APC to cortical clusters. In this context, it is interesting to note that the cortical localization of Drosophila APC2 (E-APC) is disrupted by a single point mutation in its armadillo region (Townsley and Bienz, 2000Go). At present, we do not know whether these armadillo repeats are sufficient for de novo assembly of cortical clusters of APC. Armadillo repeat domains in other proteins have been shown to mediate protein-protein interactions between diverse binding partners and, generally, more than one repeat is involved in mediating a particular interaction (Hülsken et al., 1994Go; Huber and Weis, 2001Go). Accordingly, a binding partner to the APC armadillo repeat domain may specify a cortical targeting site for APC. As the armadillo repeat domain of APC is sufficient to localize to APC clusters, it is possible that an unknown binding partner of this domain is involved in APC cluster formation. One possibility is the APC-stimulated Rac-specific guanine nucleotide exchange factor (Asef), which is a binding partner for the APC armadillo repeat domain (Kawasaki et al., 2000Go). However, overexpression of Asef causes dissociation of the cortical APC clusters in MDCK cells (Kawasaki et al., 2000Go), perhaps by competing with another endogenous binding partner and thereby disrupting APC cluster formation.

The C-terminal half of EB1 binds APC but not MTs
Although endogenous EB1 does not accumulate in cortical APC clusters and we did not observe a concentration of endogenous APC at distal MTs ends (Fig. 1), EB1 could facilitate APC transport to cortical sites. In that case, expression of an EB1 mutant protein that can bind to APC but is unable to bind to MTs should inhibit APC cluster formation. The N-terminal half of EB1 is highly conserved and contains the MT-binding site defined in the EB1 homologue RP1 (Juwana et al., 1999Go). The APC-binding domain in EB1 has not been defined, but Kar9p binding to the yeast EB1 homologue Bim 1p is mediated by the C-terminal half of Bim 1p (Miller et al., 2000Go).

To identify a domain in EB1 that binds to APC but not MTs, the C-terminal half of EB1 (MBP-EB1CT) and, as a control, full-length EB1 (MBP-EB1) were purified as MBP fusion proteins from bacteria (Fig. 3a; lanes 1-3; Fig. 3b; lanes 13-15). Another EB1 mutant fusion protein containing the N-terminal half of EB1 (MBP-EB1NT) was also expressed but it could not be purified from bacteria. MBP-EB1 co-pelleted with polymerized bovine brain tubulin; only trace amounts of MBP-EB1CT and MBP were detected in the pellet (Fig. 3a, lanes 4-6).



View larger version (47K):
[in this window]
[in a new window]
 
Fig. 3. Binding of EB1 and the C-terminal EB1 domain to MTs or APC in vitro. (a) MT pelleting assay. Lanes 1-3 show 1/20 of the respective MBP fusion proteins after preclearance by centrifugation and before incubation with polymerized tubulin. Lanes 4-6 show 2/3 of the MT pellets after incubation with the respective MBP fusion proteins and centrifugation through a glycerol cushion. Lane 7, 2.5 µg purified bovine brain tubulin. (b) Binding of MBP-EB1 fusion proteins to the EB1-binding domain in GST-APCCT. Precipitation of the respective MBP fusion proteins by GST-APCCT bound to APC AB/Protein A (APC AB+GST-APCCT) (lane 7-9). GST-APCCT appears as a double band of which the faster migrating one is probably caused by partial degradation. In control assays, MBP fusion proteins were incubated with anti-GST antibody (GST AB) bound to Protein A (lane 1-3); with GST bound to GST AB/Protein A (GST AB+GST) (lane 4-6) and with anti-APC antibody (APC AB) bound to Protein A (lane 10-12). Approximately 1/15 of the total MBP fusion proteins used for each binding assay are shown in lane 13-15. M, Molecular weight standards.

 

To analyze internations of MBP-EB1 and MBP-EB1CT with APC, a C-terminal domain of APC containing the EB1-binding region (Askham et al., 2000Go) was purified as a glutathione S-transferase (GST) fusion protein from bacteria and further purified by immunoaffinity precipitation with an antiserum to the C-terminus of APC (Fig. 3b; lanes 7-9; GST-APCCT). Both MBP-EB1 and MBP-EB1CT, but not MBP, co-pelleted with GST-APCCT (Fig. 3b; lanes 7-9). The MBP fusion proteins did not co-pellet with GST (Fig. 3b; lanes 4-6) or with the respective immunoaffinity resins alone (Fig. 3b; lanes 1-3 and 10-12). In summary, amino acids 134 to 268 in EB1CT bind to APC but not MTs. This region in EB1 contains a domain with homology to the Kar9-binding site in the yeast EB1 homologue Bim1p (Miller et al., 2000Go).

Subcellular localization of EB1 mutant proteins in MDCK cells
Full-length EB1 and EB1 mutant proteins were expressed in MDCK cells as fusions to DsRed fluorescent protein (Figs 4,5). Similar to endogenous EB1, DsRed-EB1 localized to MT distal (plus) ends (arrows in Fig. 4a-c). However, unlike endogenous EB1, DsRed-EB1 accumulated in cortical APC clusters (Fig. 5a-c; white arrowheads), probably because of an excess of EB1, which can then interact with additional binding sites. In 44% of cells transiently transfected with DsRed-EB1, all cortical APC clusters contained DsRed-EB1; in 19% of those cells some APC clusters contained DsRed-EB1 and others did not; in 37% of those cells DsRed-EB1 did not co-localize with cortical APC clusters (number of cells analyzed n=111).



View larger version (63K):
[in this window]
[in a new window]
 
Fig. 5. Colocalization of DsRed-EB1 and DsRed-EB1CT but not of DsRed-EB1NT in cortical APC clusters. (a-i) Basal sections of cell extensions of cells expressing full-length DsRed-EB1 (a-c), DsRed-EB1NT (d-f) or DsRed-EB1CT (g-i). Cells were co-stained with APC antiserum (green). DsRed-EB1 predominantly localizes to the distal (plus) ends of MTs (arrows in b, c). (Fig. 4a-c) and colocalizes with APC in cortical clusters at the tip of the extension (white arrowheads in a-c). DsRed-EB1NT shows filamentous staining at MT distal (plus) ends and along MTs (arrows in e, f) (Fig. 4g-i) but does not colocalize with APC in cortical clusters (black arrowheads in d-f). DsRed-EB1CT colocalizes with APC at the tip of the extension (white arrowheads in g-i). Bar, 10 µm.

 

DsRed-EB1CT, which contains the APC-binding domain (Fig. 3), dominantly colocalized with endogenous APC in cortical clusters (Fig. 4d-f; Fig. 5g-i; white arrowheads). In all cells transiently transfected with DsRed-EB1CT, all cortical APC clusters contained DsRed-EB1CT (number of cells analyzed n=109). Note that expression of DsRed-EB1CT does not appear to disrupt APC cluster formation. Furthermore, DsRed-EB1CT had a diffuse cytoplasmic distribution and coaligned only occasionally with a few MT plus ends (Fig. 4d-f; compare DsRed-EB1 in 4b with DsRed-EB1CT in 4e), consistent with the lack of EB1CT binding to MTs in vitro (Fig. 3a). The weak residual localization of DsRed-EB1CT at MT plus ends may be caused by low amounts of APC in these areas (Fig. 4d-f; arrows).

DsRed-EB1NT, which contains the MT-binding domain, localized to MTs but was not as restricted to MT distal (plus) ends as endogenous EB1 (arrows in Fig. 4g-i) or DsRed-EB1 in cells expressing approximately the same levels of these fusion proteins (compare Fig. 4h with 4b) (data not shown). Significantly, DsRed-EB1NT did not colocalize with endogenous APC in cortical clusters (Fig. 5d-f; black arrowheads). The transfection efficiency for DsRed-EB1NT was lower than that of other EB1 proteins; only one third of the cells transfected with DsRed-EB1NT showed extensive filamentous DsRed-EB1NT localization that overlapped with MT plus ends marked by EB1 (Fig. 4g-i), whereas in two thirds of the transfected cells, DsRed-EB1NT distributed more diffusely throughout the cytoplasm. Therefore, this EB1 fragment may be less stable or less efficient in its binding properties than full-length EB1. However, DsRed-EB1NT did not localize to cortical APC clusters in any of the transfected cells (number of cells analyzed n=80; 29 of these cells showed filamentous DsRedEB1-NT distribution).

Since overexpression of EB1 mutant proteins did not have a disruptive (dominant-negative) effect on the localization of endogenous APC to cortical clusters, binding to EB1 does not appear to be essential for assembly of APC into cortical clusters. The subcellular distributions of EB1-CT and -NT mutants reflected their binding properties to APC and MTs, respectively. These results show that cortical APC clusters and cortical EB1-containing MT plus ends are spatially different structures (see also Fig. 1 for endogenous APC and EB1). Note, however, that we show in Fig. 1 and 2 that the APC clusters are closely associated with EB1-containing MT plus ends and that we have previously demonstrated that these clusters dissociate after nocodazole-induced disassembly of MTs (Näthke et al., 1996Go). Although the existence of cortical APC clusters is ultimately dependent on an intact MT cytoskeleton (Näthke et al., 1996Go), the results shown here emphasize that these clusters are not identical to a bundle of free cortical MT plus ends, but they seem to contain additional organizing components that assemble them at particular sites of the cortex. This is consistent with previously published results from Mimori-Kiyosue et al. (Mimori-Kiyosue et al., 2000aGo), which show that after disruption of MTs, cortical APC clusters do not disassemble immediately but redistribute along actin stress fibers at the basal plasma membrane (Mimori-Kiyosue et al., 2000aGo).

Cortical APC clusters at the tip of cell extensions have been correlated with a role of APC in promoting cell extension and directed cell migration by affecting MT dynamics in these areas (Barth et al., 1997aGo; Näthke et al., 1997Go; Pollack et al., 1997Go). Similar to the Kar9p-EB1 complex in mitotic yeast cells, the APC-EB1 complex may act as a MT-capturing complex that redirects MT plus ends to specific sites at the tip of extending membranes. However, the order of assembly of the APC-EB1 complex is different from previous predictions (Askham et al., 2000Go; Mimori-Kiyosue et al., 2000) and has similarity to the process in budding yeast. In yeast, Kar9p assembly at the bud tip is independent of EB1 (Miller et al., 1999Go; Miller et al., 2000Go). Similarly, our results indicate that APC assembly into cortical clusters is independent of EB1; our data indicate a role of the APC armadillo domain in targeting APC to cortical clusters. Thus, EB1-containing MT plus ends may be captured by preexisting cortical APC clusters, thereby causing the reorientation of a subset of MTs towards that region of the membrane and the formation/stabilization of a polarized membrane extension.


    Acknowledgments
 
We are very thankful to Eugenio de Hostos and Amy Reilein for technical support and helpful discussion. This work was support by a grant from the NIH to W.J.N.


    References
 Top
 Summary
 Introduction
 Materials and Methods
 Results and Discussion
 References
 

Askham, J. M., Moncur, P., Markham, A. F. and Morrison, E. E. (2000). Regulation and function of the interaction between the APC tumour suppressor protein and EB 1. Oncogene 19,1950 -1958.[Medline]

Barth, A. I., Nathke, I. S. and Nelson, W. J. (1997a). Cadherins, catenins and APC protein: interplay between cytoskeletal complexes and signaling pathways. Curr. Opin. Cell Biol. 9,683 -690.[Medline]

Barth, A. I., Pollack, A. L., Altschuler, Y., Mostov, K. E. and Nelson, W. J. (1997b). NH2-terminal deletion of beta-catenin results in stable colocalization of mutant beta-catenin with adenomatous polyposis coli protein and altered MDCK cell adhesion. J. Cell Biol. 136,693 -706.[Abstract/Free Full Text]

Berrueta, L., Kraeft, S. K., Tirnauer, J. S., Schuyler, S. C., Chen, L. B., Hill, D. E., Pellman, D. and Bierer, B. E. (1998). The adenomatous polyposis coli-binding protein EB 1 is associated with cytoplasmic and spindle microtubules. Proc. Natl. Acad. Sci. USA 95,10596 -10601.[Abstract/Free Full Text]

Groden, J., Thliveris, A., Samowitz, W., Carlson, M., Gelbert, L., Albertsen, H., Joslyn, G., Stevens, J., Spirio, L., Robertson, M. et al. (1991). Identification and characterization of the familial adenomatous polyposis coli gene. Cell 66,589 -600.[Medline]

Huber, A. H. and Weis, W. I. (2001). The structure of the beta-catenin/E-cadherin complex and the molecular basis of diverse ligand recognition by beta-catenin. Cell 105,391 -402.[Medline]

Hülsken, J., Birchmeier, W. and Behrens, J. (1994). E-cadherin and APC compete for the interaction with beta-catenin and the cytoskeleton. J. Cell Biol. 127,2061 -2069.[Abstract/Free Full Text]

Joslyn, G., Richardson, D. S., White, R. and Alber, T. (1993). Dimer formation by an N-terminal coiled coil in the APC protein. Proc. Natl. Acad. Sci. USA 90,11109 -11113.[Abstract/Free Full Text]

Juwana, J. P., Henderikx, P., Mischo, A., Wadle, A., Fadle, N., Gerlach, K., Arends, J. W., Hoogenboom, H., Pfreundschuh, M. and Renner, C. (1999). EB/RP gene family encodes tubulin binding proteins. Int. J. Cancer 81,275 -284.[Medline]

Kawasaki, Y., Senda, T., Ishidate, T., Koyama, R., Morishita, T., Iwayama, Y., Higuchi, O. and Akiyama, T. (2000). Asef, a link between the tumor suppressor APC and G-protein signaling. Science 289,1194 -1197.[Abstract/Free Full Text]

Korinek, W. S., Copeland, M. J., Chaudhuri, A. and Chant, J. (2000). Molecular linkage underlying microtubule orientation toward cortical sites in yeast. Science 287,2257 -2259.[Abstract/Free Full Text]

Lee, L., Tirnauer, J. S., Li, J., Schuyler, S. C., Liu, J. Y. and Pellman, D. (2000). Positioning of the mitotic spindle by a cortical-microtubule capture mechanism. Science 287,2260 -2262.[Abstract/Free Full Text]

Mays, R. W., Siemers, K. A., Fritz, B. A., Lowe, A. W., van Meer, G. and Nelson, W. J. (1995). Hierarchy of mechanisms involved in generating Na/K-ATPase polarity in MDCK epithelial cells. J. Cell Biol. 130,1105 -1115.[Abstract/Free Full Text]

Miller, R. K., Cheng, S. C. and Rose, M. D. (2000). Bim1p/Yeb1p mediates the Kar9p-dependent cortical attachment of cytoplasmic microtubules. Mol. Biol. Cell 11,2949 -2959.[Abstract/Free Full Text]

Miller, R. K., Matheos, D. and Rose, M. D. (1999). The cortical localization of the microtubule orientation protein, Kar9p, is dependent upon actin and proteins required for polarization. J. Cell Biol. 144,963 -975.[Abstract/Free Full Text]

Mimori-Kiyosue, Y., Shiina, N. and Tsukita, S. (2000a). Adenomatous polyposis coli (APC) protein moves along microtubules and concentrates at their growing ends in epithelial cells. J. Cell Biol. 148,505 -518.[Abstract/Free Full Text]

Mimori-Kiyosue, Y., Shiina, N. and Tsukita, S. (2000b). The dynamic behavior of the APC-binding protein EB 1 on the distal ends of microtubules. Curr. Biol. 10,865 -868.[Medline]

Morrison, E. E., Wardleworth, B. N., Askham, J. M., Markham, A. F. and Meredith, D. M. (1998). EB 1, a protein which interacts with the APC tumour suppressor, is associated with the microtubule cytoskeleton throughout the cell cycle. Oncogene 17,3471 -3477.[Medline]

Munemitsu, S., Souza, B., Muller, O., Albert, I., Rubinfeld, B. and Polakis, P. (1994). The APC gene product associates with microtubules in vivo and promotes their assembly in vitro. Cancer Res. 54,3676 -3681.[Abstract/Free Full Text]

Nakamura, M., Zhou, X. Z. and Lu, K. P. (2001). Critical role for the EB 1 and APC interaction in the regulation of microtubule polymerization. Curr. Biol. 11,1062 -1067.[Medline]

Näthke, I. S., Adams, C. L., Polakis, P., Sellin, J. H. and Nelson, W. J. (1996). The adenomatous polyposis coli tumor suppressor protein localizes to plasma membrane sites involved in active cell migration. J. Cell Biol. 134,165 -179.[Abstract/Free Full Text]

Näthke, I. S., Barth, A. I. M. and Nelson, W. J. (1997). Role for the tumor suppressor adenomatous polyposis coli protein in epithelial migration and adhesion: a hypothesis. In Cytoskeletal-Membrane Interactions and Signal Transduction, 1st edn (ed. P. Cowin and M. W. Klymkowsky), pp.103 -110. New York: Chapman and Hall.

Polakis, P. (1999). The oncogenic activation of beta-catenin. Curr. Opin. Genet. Dev. 9, 15-21.[Medline]

Pollack, A. L., Barth, A. I. M., Altschuler, Y., Nelson, W. J. and Mostov, K. E. (1997). Dynamics of ß-catenin interactions with APC protein regulate epithelial tubulogenesis. J. Cell Biol. 137,1651 -1662.[Abstract/Free Full Text]

Su, L. K., Burrell, M., Hill, D. E., Gyuris, J., Brent, R., Wiltshire, R., Trent, J., Vogelstein, B. and Kinzler, K. W. (1995). APC binds to the novel protein EB 1. Cancer Res. 55,2972 -2977.[Abstract/Free Full Text]

Sulekova, Z. and Ballhausen, W. G. (1995). A novel coding exon of the human adenomatous polyposis coli gene. Hum. Genet. 96,469 -471.[Medline]

Townsley, F. M. and Bienz, M. (2000). Actin-dependent membrane association of a Drosophila epithelial APC protein and its effect on junctional Armadillo. Curr. Biol. 10,1339 -1348.[Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Plant Physiol.Home page
K. Brandner, A. Sambade, E. Boutant, P. Didier, Y. Mely, C. Ritzenthaler, and M. Heinlein
Tobacco Mosaic Virus Movement Protein Interacts with Green Fluorescent Protein-Tagged Microtubule End-Binding Protein 1
Plant Physiology, June 1, 2008; 147(2): 611 - 623.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
A. Grohmann, K. Tanneberger, A. Alzner, J. Schneikert, and J. Behrens
AMER1 regulates the distribution of the tumor suppressor APC between microtubules and the plasma membrane
J. Cell Sci., November 1, 2007; 120(21): 3738 - 3747.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
A. N. Hume, D. S. Ushakov, A. K. Tarafder, M. A. Ferenczi, and M. C. Seabra
Rab27a and MyoVa are the primary Mlph interactors regulating melanosome transport in melanocytes
J. Cell Sci., September 1, 2007; 120(17): 3111 - 3122.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. B. Moseley, F. Bartolini, K. Okada, Y. Wen, G. G. Gundersen, and B. L. Goode
Regulated Binding of Adenomatous Polyposis Coli Protein to Actin
J. Biol. Chem., April 27, 2007; 282(17): 12661 - 12668.
[Abstract] [Full Text] [PDF]


Home page
GENES CELLSHome page
Y. Mimori-Kiyosue, C. Matsui, H. Sasaki, and S. Tsukita
Adenomatous polyposis coli (APC) protein regulates epithelial cell migration and morphogenesis via PDZ domain-based interactions with plasma membranes.
Genes Cells, February 1, 2007; 12(2): 219 - 233.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Sharma, L. Leung, M. Brocardo, J. Henderson, C. Flegg, and B. R. Henderson
Membrane Localization of Adenomatous Polyposis Coli Protein at Cellular Protrusions: TARGETING SEQUENCES AND REGULATION BY beta-CATENIN
J. Biol. Chem., June 23, 2006; 281(25): 17140 - 17149.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
K. Kita, T. Wittmann, I. S. Nathke, and C. M. Waterman-Storer
Adenomatous Polyposis Coli on Microtubule Plus Ends in Cell Extensions Can Promote Microtubule Net Growth with or without EB1
Mol. Biol. Cell, May 1, 2006; 17(5): 2331 - 2345.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
R. A. Green, R. Wollman, and K. B. Kaplan
APC and EB1 Function Together in Mitosis to Regulate Spindle Dynamics and Chromosome Alignment
Mol. Biol. Cell, October 1, 2005; 16(10): 4609 - 4622.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
S. Etienne-Manneville, J.-B. Manneville, S. Nicholls, M. A. Ferenczi, and A. Hall
Cdc42 and Par6-PKC{zeta} regulate the spatially localized association of Dlg1 and APC to control cell polarization
J. Cell Biol., September 12, 2005; 170(6): 895 - 901.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
J. Noritake, T. Watanabe, K. Sato, S. Wang, and K. Kaibuchi
IQGAP1: a key regulator of adhesion and migration
J. Cell Sci., May 15, 2005; 118(10): 2085 - 2092.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
K. C. Slep, S. L. Rogers, S. L. Elliott, H. Ohkura, P. A. Kolodziej, and R. D. Vale
Structural determinants for EB1-mediated recruitment of APC and spectraplakins to the microtubule plus end
J. Cell Biol., February 14, 2005; 168(4): 587 - 598.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
A. Kodama, T. Lechler, and E. Fuchs
Coordinating cytoskeletal tracks to polarize cellular movements
J. Cell Biol., October 25, 2004; 167(2): 203 - 207.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
I. Nathke
APC at a glance
J. Cell Sci., October 1, 2004; 117(21): 4873 - 4875.
[Full Text] [PDF]


Home page
J. Neurosci.Home page
M. K. Temburni, M. M. Rosenberg, N. Pathak, R. McConnell, and M. H. Jacob
Neuronal Nicotinic Synapse Assembly Requires the Adenomatous Polyposis Coli Tumor Suppressor Protein
J. Neurosci., July 28, 2004; 24(30): 6776 - 6784.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
A. L. Miller, Y. Wang, M. S. Mooseker, and A. J. Koleske
The Abl-related gene (Arg) requires its F-actin-microtubule cross-linking activity to regulate lamellipodial dynamics during fibroblast adhesion
J. Cell Biol., May 10, 2004; 165(3): 407 - 419.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
R. K. Louie, S. Bahmanyar, K. A. Siemers, V. Votin, P. Chang, T. Stearns, W. J. Nelson, and A. I. M. Barth
Adenomatous polyposis coli and EB1 localize in close proximity of the mother centriole and EB1 is a functional component of centrosomes
J. Cell Sci., March 1, 2004; 117(7): 1117 - 1128.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. Hayashi and M. Ikura
Crystal Structure of the Amino-terminal Microtubule-binding Domain of End-binding Protein 1 (EB1)
J. Biol. Chem., September 19, 2003; 278(38): 36430 - 36434.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
J. M. Askham, K. T. Vaughan, H. V. Goodson, and E. E. Morrison
Evidence That an Interaction between EB1 and p150Glued Is Required for the Formation and Maintenance of a Radial Microtubule Array Anchored at the Centrosome
Mol. Biol. Cell, October 1, 2002; 13(10): 3627 - 3645.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Barth, A. I. M.
Right arrow Articles by Nelson, W. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Barth, A. I. M.
Right arrow Articles by Nelson, W. J.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?