|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 14 November 2002
doi: 10.1242/jcs.00156
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
1 McGill Cancer Centre, McGill University, Montréal, Québec,
Canada, H3G 1Y6
2 Department of Biochemistry, McGill University, Montréal, Québec,
Canada, H3G 1Y6
* Author for correspondence (e-mail: maria.zannis{at}mcgill.ca)
Accepted 9 September 2002
| Summary |
|---|
|
|
|---|
and
, Primase and Topoisomerase II
)
were comparable in both the xrs-5 mutant and CHO K1 wild-type cell
lines. In addition, the in vivo association of Ku with the DHFR
origin-containing sequence (oriß) was examined in both the CHO K1 and
xrs-5 cell lines by a chromatin immunoprecipitation (ChIP) assay.
Anti-Ku antibodies did not immunoprecipitate a detectable amount of Ku from
the xrs-5 cells in the origin-containing sequence, in contrast to the
CHO K1 cells, wherein Ku was found to be associated with the oriß origin.
The data implicate Ku antigen in in vivo and in vitro DNA replication and
suggest the existence of another protein with Ku-like functions in the
xrs-5 cells.
Key words: xrs-5 cells, Ku antigen, DNA replication, ChIp
| Introduction |
|---|
|
|
|---|
Ku (reviewed in Tuteja and Tuteja,
2000
) is a heterodimeric DNA-binding protein of 70 kDa and 86 kDa
subunits (Mimori et al.,
1986
). Ku binds avidly to DNA ends, whether blunt or with 5'
or 3' overhangs, as well as to other discontinuities in the DNA
structure (Mimori and Hardin,
1986
; Taghva et al.,
2002
; Arosio et al.,
2002
). Sequence-specific binding of Ku has also been demonstrated,
including binding to mammalian origins of DNA replication
(Giffin et al., 1996
;
Ruiz et al., 1999
;
Araujo et al., 1999
;
Novac et al., 2001
). Ku is
necessary for the processing of DNA DSBs that are induced by damaging agents
such as ionizing radiation or oxidative reactions, by endogenous recombination
processes and by certain chemotherapeutic drugs (reviewed in
Featherstone and Jackson,
1999
; Tuteja and Tuteja,
2000
; Doherty and Jackson,
2001
). An involvement of Ku has also been suggested in
transcription (Giffin et al.,
1996
; Finnie et al.,
1993
; Kuhn et al.,
1995
; Generesch et al., 1995;
Camara-Clayette et al., 1999
),
telomeric maintenance (Boulton and Jackson,
1996
; Porter et al.,
1996
; Polotnianka et al.,
1998
; Haber, 1999; Baumann and
Cech, 2000
), replicative senescence
(Woo et al., 1998
;
Lim et al., 2000
), suppression
of chromosomal aberrations, malignant transformation and tumour progression
(Difilippantonio et al., 2000
;
Pucci et al., 2001
), aging
(Vogel et al., 1999
;
Cooper et al., 2000
;
Li and Comai, 2001
) cell cycle
regulation (Munoz et al.,
2001
), multidrug resistance
(Um et al., 2001
) and DNA
replication (Ruiz et al.,
1999
; Novac et al.,
2001
).
A role for Ku in DNA replication and replication fork movement was proposed
a decade ago, on the basis of the observation that Ku bound to DNA ends during
S phase (Paillard and Strauss,
1991
). Since then, evidence for the involvement of Ku in DNA
replication has been accumulating. The HeLa cell DNA-dependent ATPase,
co-fractionating with a 21S multiprotein complex capable of supporting SV40 in
vitro DNA replication (Vishwanatha and
Baril, 1990
), is identical to Ku antigen
(Cao et al., 1994
). Ku binds
to viral and eukaryotic origins of DNA replication
(de Vries et al., 1989
;
Toth et al., 1993
;
Araujo et al., 1999
;
Ruiz et al., 1999
;
Novac et al., 2001
), to matrix
attachment regions (MARs), which serve as initiation sites for DNA replication
(Galande and Kohwi-Shigematsu,
1999
) and to Alu DNA, which provides cis-elements affecting
chromatin structure during DNA replication
(Tsuchiya et al., 1998
). Ku
also binds in vivo to genomic sequences comprising origins of DNA replication
in a cell-cycle-dependent manner, with fivefold higher binding at the G1/S
interphase by comparison to G0 (Novac et
al., 2001
). Recently, Ku was shown to interact with WRN
(Cooper et al., 2000
), a DNA
helicase with 3'-5' exonuclease activity that is part of the
replication complex (Lebel et al.,
1999
) and interacts with replication protein A (RPA)
(Brosh et al., 1999
).
Furthermore, OBF2, a Saccharomyces cerevisiae Ku homologue, supports
the formation of a stable multiprotein replication complex by binding to
essential replication sequences (Shakibai
et al., 1996
), whereas a Ku70 yeast mutant strain exhibits a high
DNA content during mitotic growth (Barnes
and Rio, 1997
). Finally, the phenotypes of the Ku knockout mice,
such as their small size, the failure of the cells to proliferate in culture,
their prolonged doubling time and their premature senescence may also suggest
a role of Ku in DNA replication
(Featherstone and Jackson,
1999
). Extracts prepared from Ku86-/- cells,
deficient in Ku protein, have approximately 70% lower in vitro DNA replication
activity compared with Ku86+/+ extracts
(Novac et al., 2001
).
We have previously shown that OBA (Ruiz
et al., 1995
), a HeLa cell activity whose DNA binding subunit has
been identified as Ku86, is involved in mammalian DNA replication
(Ruiz et al., 1999
). The
affinity-purified OBA (Ku) binds to mammalian origins of replication,
including A3/4, a 36 bp sequence that is common to mammalian origins of DNA
replication including the Chinese hamster DHFR origin-containing sequence
(oriß), the human c-myc, dmnt-1 and lamin B2 origins and the monkey
ors sequences, among others
(Araujo et al., 1999
;
Ruiz et al., 1999
). Depletion
of Ku, either by inclusion of an oligonucleotide comprising its binding site
(A3/4) or by antibodies directed against the Ku protein, inhibited DNA
replication to as low as 10-20% in a mammalian in vitro replication system
(Ruiz et al., 1999
).
The mammalian in vitro replication cell-free system used in this study
mimics nuclear, semi-conservative DNA replication in vivo
(Pearson et al., 1991
;
Pearson et al., 1994
;
Zannis-Hadjopoulos et al.,
1994
; Todd et al.,
1995
; Pelletier et al.,
1997
; Pelletier et al.,
1999
) and is comparable to other mammalian in vitro cell-free
systems (Krude, 2000
). It uses
a plasmid containing a mammalian origin of DNA replication and extracts from
HeLa cells (Pearson et al.,
1991
) and is based on the SV40 in vitro replication system, but it
does not require the viral T antigen. This system has been used to study the
effects on DNA replication of cancer chemotherapeutic drugs
(Diaz-Perez et al., 1996
;
Diaz-Perez et al., 1998
), of
various proteins including the Oct-1 transcription factor
(Matheos et al., 1998
), the
GATA-1 factor, Ku antigen and DNA polymerase
(Ruiz et al., 1999
;
Matheos et al., 2002
), a
mammalian polynucleotide kinase (Jilani et
al., 1999
), the cruciform binding 14-3-3 proteins
(Novac et al., 2002
) and the
replication competence of Ku86+/+ and
Ku86-/- mouse embryonic fibroblasts
(Novac et al., 2001
).
Since the xrs-5 mutant cells have severely reduced levels of Ku86
and Ku70 proteins, here we tested their potential for replication in vivo and
in an in vitro replication system. We found that the xrs-5 cells had
a reduced ability to support in vivo DNA replication upon transfection of
p186, a mammalian origin-containing plasmid. However, total and cytoplasmic
extracts from xrs-5 cells replicated the origin-containing plasmid in
vitro with the same efficiency as the wild-type CHO K1 cell extracts. By
contrast, xrs-5 nuclear cell extracts did not possess any detectable
in vitro replication activity, but addition of affinity-purified OBA/Ku
restored in vitro replication activity to wild-type levels; this is similar to
the way that Ku86 cDNA complements the defective repair and recombination
phenotypes (Smider et al.,
1994
). Also, the levels of other replication proteins such as
Orc2, PCNA, DNA polymerase
and
, Primase and Topoisomerase
II
were comparable in both the xrs-5 mutant and CHO KI
wild-type cell lines. Using a ChIP assay, we also found that in xrs-5
cells no Ku could be detected bound to the hamster DHFR oriß in vivo,
unlike the result in CHO K1 cells, in which Ku was bound to this origin.
Moreover, we identified a factor in the xrs-5 cytoplasmic cell
extracts that bound in a sequence-specific manner to the A3/4 origin sequence,
possibly accounting for the efficient replication of the xrs-5 total
and cytoplasmic cell extracts in vitro. The data suggest that Ku participates
in mammalian DNA replication in vivo and in vitro and that the factor present
in the cytoplasmic extracts can compensate for the lack of Ku in the nuclear
extracts.
| Materials and Methods |
|---|
|
|
|---|
Extract preparation
Cell extracts from log phase CHO K1 and xrs-5 cell monolayers were
prepared as previously described by Pearson et al.
(Pearson et al., 1991
).
Briefly, monolayers were washed twice with isotonic buffer (20 mM Tris-HCl pH
7.4, 137 mM NaCl, 5 mM KCl, 1 mM CaCl2, 0.5 mM MgCl2 and
250 mM glucose). The cells were collected and lysed in a Type B Dounce
homogenizer. Nuclei were removed by 5 minutes of centrifugation at 1200
g and were subsequently used to prepare the nuclear extract.
The supernatant was centrifuged for 1 hour at 100,000 g in a
Beckman type 50 Ti rotor, and the supernatant was used as the cytoplasmic
extract. The nuclear pellet was suspended in hypertonic buffer (hypotonic and
500 mM potassium acetate) in half the volume used for the cytoplasmic extract.
The mixture was incubated for 90 minutes on ice, spun in a Beckman SW50.1
rotor at 300,000 g for 1 hour and used as the nuclear
extract.
Preparation of template DNA for replication assay
Plasmid p186 consists of the minimal origin of ors8 (GenBank
accession number M26221). It contains the NdeI/RsaI
sub-fragment of ors8 cloned in the NruI site of pBR322
(Todd et al., 1995
). Plasmid
DNA was isolated using the QIAGEN-tip 500 column (QIAGEN, Mississauga,
Ontario, Canada).
In vivo DNA replication
In vivo DNA replication was performed as previously described
(Landry and Zannis-Hadjopoulos,
1991
; Pearson et al.,
1991
; Wu et al.,
1993
; Nielsen et al.,
1994
; Zannis-Hadjopoulos et
al., 1994
; Todd et al.,
1995
) with the following modification. HeLa cells, at a density of
3x105, were seeded and transfected with 10 µg plasmid DNA
(p186 or equimolar amounts of pBR322) using the calcium phosphate transfection
kit (Invitrogen). Cells were also transfected with the pcDNA6.0 HislacZ to
control for transfection efficiency. 72 hours post-transfection, cells were
lysed as previously described (Todd et
al., 1995
) and low molecular weight DNA was isolated and purified
using the QIAquick columns (QIAGEN). The DNA was then digested with 1 unit of
DpnI for 1 hour to digest unreplicated (bacterially methylated)
plasmid. The DpnI-digested and undigested DNAs were used to transform
TOP 10 E. coli cells (Invitrogen), as previously described
(Landry and Zannis-Hadjopoulos,
1991
). The in vivo relative DNA replication was determined by
counting the number of colonies obtained with the transformation using the
DpnI-digested plasmid and correcting it for the amount of total
plasmid DNA isolated as determined by counting the number of bacterial
colonies obtained with undigested plasmid DNA isolated by Hirt lysis. The
replication level of the xrs-5 cells is expressed as a percentage of
the wild-type CHO K1 cells.
Mammalian in vitro DNA replication
Replication assays were performed as previously described
(Pearson et al., 1991
;
Matheos et al., 1998
;
Novac et al., 2002
), with
slight modifications. CHO K1 or xrs-5 nuclear cell extracts (16
µg), cytoplasmic cell extracts (45 µg) or nuclear and cytoplasmic cell
extracts together (8:15 ratio) were added to the replication mixture with 100
ng of input p186 plasmid DNA. Unmethylated pBluescript KS+ was also typically
included in each in vitro replication reaction as a control for DNA recovery
and DpnI resistance. A reaction of pBR322, a methylated,
non-replicating plasmid, was also performed for each in vitro replication
experiment to show that the observed DNA replication was origin dependent.
Experiments involving the addition of A3/4-affinity-purified Ku
(Ruiz et al., 1999
) were
performed by pre-incubating the nuclear cell extracts with 160 ng or 600 ng of
affinity-purified Ku on ice for 20 minutes, prior to the replication reaction.
Replication reactions were performed at 30°C for 1 hour. The in vitro
replication reaction products were purified using the QIAquick PCR
purification kit (QIAGEN). Reaction samples were digested with DpnI
(New England Biolabs, Mississauga, Ontario, Canada), as previously described
(Matheos et al., 1998
), and
resolved by electrophoresis on 1% agarose gel. Quantification was performed on
DpnI-digested products by densitometric measurements using a
phoshorimager analyzer (Fuji BAS2000, Stamford, CT), as described previously
(Diaz-Perez et al., 1996
;
Matheos et al., 1998
;
Novac et al., 2001
). The total
amount of DNA recovered from the in vitro replication reaction was determined
by quantitative analysis of the picture of the ethidium-bromide-stained
gel.
Immunoblotting assay
Nuclear or cytoplasmic extract proteins were resolved by 8% SDS-PAGE,
transferred to Immobilon-P (Millipore, Mississauga, Ontario, Canada), probed
with human anti-Ku70 (C-19), anti-Ku86 (C-20), anti-PCNA (Santa Cruz
Biotechnology, Inc., Santa Cruz, CA), anti-ORC2 (Medical and Biological
Laboratories CO, Ltd, Watertown, MA), anti-DNA Polymerase
(BD
Transduction Laboratories, Inc., Mississauga, Ontario), anti-DNA Polymerase
(Clone 93G1A), anti-DNA Primase (p49) (Neomarkers, Union City, CA) or
anti-Topoisimerase II
(Ki-S1) (Chemicon International, Inc., Temecula,
CA) followed by treatment with horseradish-peroxidase-conjugated donkey
anti-goat, anti-mouse or anti-rabbit IgG (Santa Cruz Biotechnology, Inc). The
blots were developed using the ECL western blotting detection kit
(Amersham-Pharmacia, Baie d'Urfé, Québec, Canada).
In vivo crosslinking
ChIP assays were performed as described previously
(Novac et al., 2001
). Briefly,
CHO K1 and xrs-5 cells were crosslinked with 1% formaldehyde (Sigma)
in serum-free medium at room temperature for 5 minutes. Cells were resuspended
in lysis buffer, and the DNA was fragmented by sonication to an average size
of 500-1000 bp in length. Sheared chromatin extracts were precleared with
protein G-agarose beads (Roche Molecular Biochemicals) at 4°C for 1 hour
and were then incubated with either 50 µl of preimmune goat serum (Santa
Cruz Biotechnology) or 10 µg of anti-Ku70 (M-19) or anti-Ku86 (C-20) goat
polyclonal antibodies (Santa Cruz Biotechnology) or anti-clone162 (against the
Ku70/86 heterodimer) mouse monoclonal antibody (NeoMarker). The protein-DNA
immune complexes were then precipitated with 50 µl of protein G-agarose
beads, washed thoroughly and eluted in 200 µl of extraction buffer (1% SDS
in TE). Crosslinks were reversed overnight at 65°C, then incubated at
37°C for 2 hours with proteinase K (Roche Molecular Biochemicals). The
extracted DNA was purified by QIAquick PCR purification columns (QIAGEN).
Real-time PCR quantification analysis of immunoprecipitated DNA
PCR reactions were carried out as described previously
(Novac et al., 2002
), using
the LightCycler Instrument (Roche Molecular Biochemicals), with some
modifications. The PCR reaction contained 1/20th of the
immunoprecipitated material, 3 mM Mg2+ and 1 µM of each primer
(oriß F: 5'-ATCCTCCTAGCTCGGAGTCA-3', 1534-1553 accession no.
X94372; oriß R: 5'-GGCTTATCTGCATCCTATTC-3', 1677-1696
accession no. X94372, AF028017F: 5'-GAGCAGGTATAAGGGCCTTGG-3',
138-158 accession no. AF028017; AF028017R:
5'-CGGTCTGGGTATGTTTAGCAAGAC-3', 362-392 accession no. AF028017)
using the LightCycler capillaries (Roche Molecular Biochemicals) and the
QuantiTect SYBR Green PCR reaction mix (QIAGEN). These two primer sets amplify
a 152 bp fragment from the DHFR oriß origin of DNA replication
(Kobayashi et al., 1998
)
(Fig. 5A) or a 255 bp fragment
17 kb downstream from the DHFR gene
(Kobayashi et al., 1998
).
|
Quantification of the PCR products was assessed by the LightCycler instrument (Roche Molecular Diagnostics) using SYBR Green I dye as detection format and LightCycler software version 3.5. An initial denaturation of 15 minutes at 95°C was followed by 40 cycles with denaturation for 15 seconds at 95°C, annealing at 55°C for 10 seconds and polymerization for 20 seconds at 72°C. Genomic CHO K1 DNA (24 ng, 28 ng, 72 ng and 96 ng) was used to build the standard curve necessary for the quantification of the PCR products (Fig. 4A). A melting curve analysis was also performed at the end of the PCR amplification to asses the specificity of the amplified product (Fig. 4B). The melting curve analysis cycle was composed of three segments: 95°C for 0 seconds (temperature transition rate of 20°C/second), 55°C for 30 seconds (temperature transition rate of 20°C/second) and a final segment at 95°C for 0 seconds (temperature transition rate of 0.2°C/second). The specificity of the 152 bp and 255 bp PCR products was also assessed by agarose gel electrophoresis and visualized with ethidium bromide (Fig. 4C,D).
|
Electrophoretic mobility-shift assay (EMSA)
Nuclear or cytoplasmic cell extracts (10 µg) were incubated with 0.5 ng
of 32P-end-labeled A3/4 probe (5'
CCTCAAATGGTCTCCAATTTTCCTTTGGCAAATTCC 3') for 30 minutes on ice in the
presence of 1 µg poly dI-dC (Amersham-Pharmacia), used as non-specific
competitor, in a final volume of 20 µl including binding buffer (10 mM
Tris-HCl pH 7.5, 80 mM NaCl, 1 mM EDTA, 10 mM 2-mercaptoethanol, 0.1% Triton
X-100, 4% glycerol). The mixtures were electrophoresed on a 6% PAGE gel at 180
Volts in TBE (45 mM Tris-HCl pH 8.0, 45 mM Boric Acid, 1 mM EDTA), and the gel
was dried and subjected to autoradiography.
For electrophoretic mobility-shift competition assays, 0.5 ng of 32P-labeled A3/4 was mixed with increasing molar excess amounts of A3/4 or non-specific (5' TTCCGAATACCGCAAG 3') cold competitor oligonucleotides. A 10 µg extract protein was then added, and the reaction was left to proceed as described above.
Electrophoretic mobility-supershift assay
Electrophoretic mobility shift mixtures were prepared as described above,
and after the standard 30 minutes incubation, 1.5 µg of clone 162 antibody
(Neomarkers, Union City, CA) or control goat IgG (Sigma, St Louis, MO) was
added and further incubated for an additional 3 hours on ice. The samples were
then applied to native 6% PAGE and electrophoresed, as described above.
| Results |
|---|
|
|
|---|
and
(Pearson
et al., 1991
Supercoiled plasmid DNA from either p186 or pBR322 was transfected into
either xrs-5 or CHO K1 cells, and the ability of the plasmids to
undergo autonomous replication was assayed by the DpnI-resistance
assay, to distinguish between input plasmid and plasmid replicated in the
eukaryotic cells (Frappier and
Zannis-Hadjopoulos, 1987
;
Landry and Zannis-Hadjopoulos,
1991
). p186 DNA was isolated at 72 hours post-transfection from
both CHO K1 and xrs-5 cells and was digested with DpnI; the
plasmids recovered from the xrs-5 cells yielded
DpnI-resistant DNA, which transformed E. coli with an
efficiency that was 45% lower than that DNA recovered from the CHO K1 cells
(Fig. 1). No bacterial colonies
were obtained with DpnI-digested DNA recovered from either the
xrs-5 or CHO K1 cells that had been transfected with pBR322 (data not
shown) as expected, since this plasmid does not contain a mammalian origin of
DNA replication and thus is fully digested by DpnI. To verify that
the decreased recovery of replicated plasmids in the xrs-5 cells was
not due to the introduction of breaks during transfection and the requirement
of NHEJ to repair those breaks prior to replication, undigested DNA from p186
and pBR322 recovered from xrs-5 and CHO K1 cells was also used to
transform bacteria. No difference in total DNA recovered was found (data not
shown), indicating that the observed effect with DpnI digestion
(Fig. 1) is due to a
replication effect.
|
Absence of Ku protein from xrs-5 mutant cells
To examine whether any residual Ku protein could be detected in
xrs-5 cell extracts that might account for their observed in vitro
DNA replication activity when using the total or cytoplasmic extracts, western
immunoblot analyses were performed using anti-Ku antibodies
(Fig. 2). An anti-human Ku86
antibody (C-20; Santa Cruz) was used that was able to recognize the hamster
Ku86 protein, reacting with both the CHO K1 nuclear (K1 N) and cytoplasmic (K1
C) cell extracts (Fig. 2A,
lanes 2 and 3). No material crossreacting with this antibody was detectable
either in the cytoplasmic (xrs-5 C) or nuclear (xrs-5 N)
cell extracts derived from the xrs-5 cells
(Fig. 2A, lanes 4 and 5), which
is in agreement with previous reports stating that xrs-5 cells lack
Ku86 protein, shown by western blotting, and Ku86 RNA transcript, shown by
northern blotting (Rathmell and Chu,
1994
; Singleton et al.,
1997
). However, the Ku86 transcript was detected in the
xrs-5 mutants when the more sensitive technique of RT-PCR was used
(Singleton et al., 1997
). Each
subunit of the Ku heterodimer is required to stabilize the other, and the
absence of Ku86 in xrs-5 has been shown to result also in the loss of
the Ku70 subunit (Taccioli et al.,
1994
; Smider et al.,
1994
; Singleton et al.,
1997
). To examine the levels of Ku70 in the xrs-5 cell
extracts, the same membrane was probed with an anti-human Ku70 antibody (C-19;
Santa Cruz) recognizing the Ku70 protein in the CHO K1 nuclear and cytoplasmic
cell extracts (Fig. 2B, lanes 2
and 3). By contrast, xrs-5 showed dramatically decreased levels of
Ku70 (Fig. 2B, lanes 4 and 5).
Upon longer exposures, a faint band crossreacting with the anti-Ku70 antibody
was detected in the xrs-5 cytoplasmic cell extracts.
|
Examination of the levels of replication protein in xrs-5 vs
CHO K1
Western blot analyses were also performed to verify the level of other
replication proteins in the mutant cell line and to compare it to the
wild-type cells. Nuclear extracts from either CHO K1 or xrs-5 cells
showed equivalent amounts of ORC2, PCNA, DNA polymerase
, DNA polymerase
, Primase or Topoisomerase II
proteins in both the mutant and
wild-type cell lines (Fig.
3A-F).
|
Ku associates in vivo with the DHFR oriß in CHO K1
cells but not in xrs-5 cells
To analyze whether the Ku protein associates with replication origins in
Chinese hamster cells, as it was found to do in monkey (CV-1) cells
(Novac et al., 2001
), its
interaction with the DHFR replication origin, oriß
(Fig. 5A), was analyzed in
wild-type CHO K1 cells and compared to that in the Ku86 mutant cells
(xrs-5) using a ChIP assay, as previously described
(Novac et al., 2001
). Genomic
CHO K1 DNA was used to build the standard curve necessary for the
quantification of the immunoprecipitated DNA using the LightCycler instrument
(Fig. 4A). The LightCycler
allows the quantification of the PCR products (considered background level)
that are undetectable by agarose gel electrophoresis stained with ethidium
bromide (Fig. 4C,D). To verify
the specificity of the PCR products, a melting curve analysis was performed at
the end of the amplification cycle, and no primer-dimers interfered with the
quantification (Fig. 4B). In
addition, PCR products were also separated on a 2% agarose gel to verify their
size (Fig. 4C,D).
Anti-Ku70, anti-Ku86 and anti-clone 162 (directed against the Ku70/86
heterodimer) antibodies were used to immunoprecipitate in vivo protein-DNA
complexes that had been crosslinked by treatment of the cells with
formaldehyde (Novac et al.,
2001
). The isolated DNA was analyzed for an
origin-containing-sequence using the quantitative real-time PCR approach
(Novac et al., 2001
;
Novac et al., 2002
;
Ladenburger et al., 2002
). In
agreement with other ChIP analyses
(Alexandrow et al., 2002
;
Ladenburger et al., 2002
;
Novac et al., 2001
;
Novac et al., 2002
), the
formaldehyde crosslinking approach used to study protein-DNA interactions in
vivo largely prevents covalent binding of non-specific proteins to chromatin.
With the CHO K1 cells, when preimmune goat serum (NGS) was used, the
quantified DNA abundance in the origin-containing-sequence corresponded to
background levels (3x103 molecules/2x108
cells) (Fig. 5B). This is
considered to be the non-specific DNA pulled down when performing the ChIP
assay. Similarly, the DNA immunoprecipitated non-specifically with
anti-clone162 antibody in non-crosslinked CHO K1 and xrs-5 cells was
also quantified and corresponded to background levels
(Fig. 5B). In addition, a
primer set amplifying a fragment outside of the DHFR initiation zone (17 kb
downstream from the DHFR gene) was also used as an additional control for
non-specific DNA binding (Fig.
4A,B,D; Fig. 5B).
The DNA immunoprecipitated from that region with anti-clone162, anti-Ku86 or
anti-Ku70 antibodies from crosslinked CHO K1 cells was comparable to
background levels (Fig. 5B).
When the immunoprecipitation was performed with anti-Ku70, anti-Ku86 or
anti-Ku70/86 antibodies in CHO K1 formaldehyde-crosslinked cells, the DNA
abundance in the oriß was approximately 13-fold, seven-fold or sixfold
higher than background level, respectively
(Fig. 5B). By contrast,
anti-Ku70, anti-Ku86 or anti-Ku70/86 antibodies precipitated the oriß DNA
in the xrs-5 cells at the background level
(Fig. 5B), as expected. Thus,
Ku associates with the origin of DNA replication in vivo in CHO K1 cells but
not in the xrs-5 mutant cells, where it is mutated.
A3/4 binding activity in CHO K1 and xrs-5 cell extracts
Electrophoretic mobility shift and super-shift assays were performed to
examine whether there was an A3/4-specific binding activity present in the
wild-type and mutant CHO cell extracts
(Fig. 6A,B) that might account
for the in vitro replication results. First, titration of the amount of
protein and oligonucleotide allowed us to determine the optimum amounts to use
in order to avoid multiple bindings of Ku molecules, producing a ladder
effect. When HeLa cell extracts were reacted with radiolabeled A3/4, two main
complexes arose (Fig. 6A, lane
B). The slower migrating complex (*) results from the interaction
of A3/4 with the Ku heterodimer, Ku70/Ku86, whereas the faster migrating
complex (**) arises from its interaction with the truncated Ku,
Ku70/Ku69. Ku69 is a truncated form of Ku86 that results from site-specific
proteolytic cleavage by a leupeptin-sensitive protease
(Quinn et al., 1993
;
Han et al., 1996
;
Jeng et al., 1999
). The levels
of the truncated complex vary depending on the leupeptin concentration; at
concentrations above 5 µM the truncated complex is not formed
(Jeng et al., 1999
) (D.M.,
O.N., G.B.P. and M.Z.-H., unpublished). This complex is not obtained with the
CHO K1 or xrs-5 extracts owing to the higher leupeptin concentrations.
However, a band immediately below the ** band was obtained, which
is probably due to non-specific binding since this complex is also present
with the control antibody. The migration of these complexes was further
retarded by clone 162 antibody (Fig.
6A, lane C, ***), which recognizes the Ku70-Ku86
heterodimer, but not by the control antibody
(Fig. 6A, lane D). The reaction
of radiolabeled A3/4 oligonucleotide with the CHO K1 nuclear cell extracts
yielded a complex of similar migration
(Fig. 6A, lane E) to that
obtained from its reaction with the HeLa cell extracts (compare with
Fig. 6A, lane B). The complexes
obtained with the CHO extracts were consistently fainter. This might be due to
the CHO extracts having lower levels of Ku
(Fig. 2) or because total HeLa
extracts were used as opposed to either nuclear or cytoplasmic extracts used
for the CHO extracts. This complex was also supershifted by the clone 162
antibody (Fig. 6A, lane F) but
not by the control antibody (Fig.
6A, lane G). The EMSA reaction of radiolabeled A3/4
oligonucleotide with the xrs-5 nuclear cell extracts did not result
in a Ku-A3/4 complex (Fig. 6A,
lanes H, J), consistent with the results obtained by the western blot
analysis, in which neither Ku70 nor Ku86 were detected (see
Fig. 3). The EMSA reaction with
xrs-5 cytoplasmic cell extracts
(Fig. 6B) also resulted in a
complex with similar migration to the HeLa
(Fig. 6A, lane B) and CHO K1
nuclear (Fig. 6A, lane E) and
CHO K1 cytoplasmic (Fig. 6B,
lane A) cell extracts. This complex, however, was not supershifted by the
clone 162 antibody (Fig. 6B,
lane E), unlike the complex generated with the CHO K1 cytoplasmic cell
extracts (Fig. 6B, lane B; not
visible), suggesting that the epitope that is normally recognized by this
antibody is either not present in the xrs-5 cytoplasmic extracts or
it is not accessible. Faster migrating complexes, probably due to degradation,
were also detected.
|
An A3/4-specific binding protein is present in CHO K1 and
xrs-5 cytoplasmic cell extracts
The binding specificity for the A3/4 oligonucleotide in the complexes
formed with the xrs-5 cytoplasmic cell extracts was tested by
competition bandshift assays, using increasing molar excess of cold A3/4
(Fig. 7, lanes 3, 4, 8, 9) as a
specific competitor and cold pBR322-derived oligonucleotide
(Fig. 7, lanes 5, 6, 10, 11),
which was used as non-specific competitor. The A3/4-Ku complex formed with
both the CHO K1 (Fig. 7, lane
7) and xrs-5 (Fig. 7,
lane 2) cytoplasmic cell extracts was specifically competed with increasing
concentrations of cold A3/4 but not with cold non-specific competitor,
indicating that the complex formed with these extracts represents a specific
protein interaction with A3/4. Again some faster migrating complexes were also
detected, which were probably attributable to degradation products.
|
In vitro replication activity of CHO K1 and xrs-5 cell
extracts
Since the in vivo autonomous replication assay showed that the
xrs-5 cells were impaired in DNA replication, we tested their
replication activity in the mammalian in vitro replication system, which
allows the dissection and study of the proteins required for DNA replication
(Diaz-Perez et al., 1996
;
Diaz-Perez et al., 1998
;
Matheos et al., 1998
;
Ruiz et al., 1999
;
Jilani et al., 1999
;
Novac et al., 2001
;
Novac et al., 2002
;
Matheos et al., 2002
). The CHO
cell extracts, both wild-type (K1) and mutant (xrs-5), yielded
similar in vitro replication products (Fig.
8A) to those routinely obtained with the HeLa cell extracts
(Pearson et al., 1991
;
Zannis-Hadjopoulos et al.,
1994
; Matheos et al.,
1998
), namely, relaxed circular (form II), linear (form III) and
supercoiled (form I). However, in vitro replication of p186 DNA using the CHO
cell extracts was consistently less efficient (approximately nine times) than
with the HeLa cell extracts (data not shown). This is consistent with our
previous findings and those of other laboratories, suggesting that HeLa cell
extracts may be producing higher concentrations of initiator proteins,
resulting in more efficient replication than that observed with CV-1 or COS-7
cell extracts (Pearson et al.,
1991
; Stillman and Gluzman,
1985
; Wobbe et al.,
1985
; Li and Kelly,
1984
; Guo et al.,
1989
). Other laboratories have also reported differences in in
vitro replication activities of cell extracts, depending on their source
(Krude, 2000
;
Stoeber et al., 1998
).
|
We next performed in vitro DNA replication assays, using either cytoplasmic
or nuclear extracts separately, or the two together, from either CHO K1 or
xrs-5 cells (Fig.
8A,B). The CHO K1 cytoplasmic cell extracts
(Fig. 8A, lanes 3 and 4)
replicated the p186 DNA as efficiently as the CHO K1 total cell extracts
(Fig. 8A, lanes 1 and 2),
whereas the nuclear cell extracts alone
(Fig. 8A, lanes 5 and 6) were
approximately sixfold less efficient. The profiles obtained for both the total
incorporation of radioactive precursor nucleotide (data not shown), indicating
total incorporation owing to both replication and repair synthesis, and
DpnI-resistance (Fig.
8A), indicating incorporation owing to replication alone, were
similar for the two types of cell extracts. Furthermore, the quantification
profiles of the DpnI-resistant bands, generated by the two reactions
and corresponding to DNA forms II and III, were virtually the same
(Fig. 8A). The xrs-5
cytoplasmic cell extracts (Fig.
8A, lanes 9 and 10) also showed comparable replication activity to
the xrs-5 total (Fig.
8A, lanes 7 and 8) and the CHO K1 total
(Fig. 8A, lanes 1 and 2) and
cytoplasmic (Fig. 8A, lanes 3
and 4) cell extracts. By contrast, the xrs-5 nuclear cell extracts
did not support the in vitro replication of the p186 DNA, as indicated by the
failure to incorporate any radioactive precursor
(Fig. 8A, lanes 11 and 12).
When pBR322 was used as template DNA for the in vitro replication reaction, no
DpnI-resistant products were obtained, although some incorporation of
radionucleotides into the DNA with both the CHO K1 extracts (nuclear and
cytoplamic) and the xrs-5 cytoplasmic extracts was seen (data not
shown), owing to DNA repair, as also observed previously
(Pearson et al., 1991
).
OBA/Ku restores replication activity of xrs-5 nuclear cell
extracts
To determine whether Ku could restore replication activity in the
xrs-5 nuclear cell extracts, additional assays were performed where
affinity-purified OBA/Ku was added to the in vitro replication reaction
(Fig. 8C,D). The exogenous
addition of affinity-purified OBA/Ku increased replication of the
xrs-5 nuclear cell extracts from 0% to approximately 60%, relative to
the replication activity of the CHO K1 nuclear extract
(Fig. 8D). Hence, Ku was able
to complement the lack of replication activity in the xrs-5 nuclear
extract, which is similar to the way that Ku86 cDNA complements the defective
repair and recombination phenotypes
(Smider et al., 1994
). No
significant effect was observed when affinity-purified OBA/Ku was added to the
CHO K1 nuclear cell extracts in the in vitro replication reaction
(Fig. 2D, lanes 2 and 3;
Fig. 2E).
| Discussion |
|---|
|
|
|---|
Upon examination of the Ku protein levels in the xrs-5 cell
extracts by western blot analyses, it was found that xrs-5
cytoplasmic or nuclear cell extracts did not have any detectable levels of
Ku70 or Ku86 proteins (Fig.
2A,B). This is in agreement with previous studies in which neither
Ku86 protein nor Ku86 transcript were detected in xrs-5 cells or
other cell lines of the XRCC5 group, by western and northern analyses,
respectively (Rathmell and Chu,
1994
; Singleton et al.,
1997
; Errami et al.,
1998
). Since both Ku subunits are required for protein stability
(Errami et al., 1996
;
Singleton et al., 1997
) and
since Ku86 probably regulates Ku70 levels post-transcriptionally
(Chen et al., 1996
), it is not
surprising to find reduced Ku70 levels as a result of reduced Ku86 levels.
However, studies with Ku knockout mice have demonstrated that inactivation of
Ku70 resulted in a phenotype that was distinct from that obtained with
Ku86-knockout mice, suggesting that Ku70 and Ku86 have functions that are
independent of each other (Nussenzweig et
al., 1996
; Gu et al.,
1997
; Li et al.,
1998
) and that the remaining protein functions as a monomer or a
homodimer (reviewed in Featherstone and
Jackson, 1999
). Low levels of wild-type Ku86 transcripts, however,
have been detected in the xrs-5 cells by the more sensitive technique
of RT-PCR (Singleton et al.,
1997
). The low level of wild-type transcript could be either due
to the presence of some revertants in the xrs-5 cell population or to
a low level of transcription in each cell. By contrast, Yasui et al. have
recently reported the presence of both Ku70 and Ku86 proteins in the
xrs-5 cells, albeit at low concentrations, using western blot and 2D
gel electrophoresis analyses (Yasui et
al., 1999
). Furthermore, by indirect immunofluorescence, Ku70 and
Ku86 were found distributed over both the cytoplasm and nuclei of CHO K1 and
xrs-5 cells, with enhanced perinuclear localization of Ku86 in the
xrs-5 cells (Yasui et al.,
1999
). The subcellular localization of Ku has been controversial,
as discussed in Koike et al. (Koike et
al., 1999
). Reports of purely nuclear
(Koike et al., 1999
;
Bakalkin et al., 1998
),
membrane (Dalziel et al.,
1992
), cytoplasmic (Bakalkin et
al., 1998
) and both nuclear and cytoplasmic
(Fewell and Kuff, 1996
)
localization of Ku have been published (reviewed in
Koike et al., 1999
). The
discrepancy is probably due to differences in the detection methods used or to
a change in Ku's subcellular localization during the cell cycle. Ku has been
shown to be present in the cytoplasm of mitotic cells and at the periphery of
condensed chromosomes (Koike et al.,
1999
). The same investigators found Ku70 and Ku86 associated as a
heterodimer throughout the cell cycle. However, recent evidence suggests that
Ku70 and Ku86 may not always be dimerized, since the nuclear translocation of
Ku70 precedes that of Ku86 at the late telophase/early G1 phase during the
cell cycle (Koike et al.,
1999
). Although an enhanced perinuclear localization of only Ku86
in xrs-5 cells (Yasui et al.,
1999
) is surprising, the localization observed may be that of the
truncated form of Ku86, which is stable when not complexed to Ku70
(Singleton et al., 1997
).
Unlike the wild-type protein, truncated stable forms of Ku86 have been more
frequently detected without Ku70, perhaps because of protein conformational
changes or loss of degradation signal sequences
(Singleton et al., 1997
).
Yasui et al. postulate that the concentration of Ku86 at the nuclear periphery
of xrs-5 cells keeps the Ku complex sequestered, thereby preventing
it from accessing the DNA (Yasui et al.,
1999
). In terms of DNA repair, this might prevent the Ku protein
complex from accessing DNA DSBs. Recently, it was shown that each Ku subunit
can translocate to the nucleus independently of its own NLS and that this
translocation is dependent on its interaction with the other subunit
(Koike et al., 2001
).
Furthermore, irradiation of cells resulted in an upregulation of the cellular
level of Ku70 but not Ku86 (Brown et al.,
2000
). The inability of the xrs-5 cells to replicate the
DNA efficiently in vivo and of the xrs-5 nuclear cell extracts to
replicate DNA in vitro may be due to either a lack of or the presence of very
low levels of Ku86. Alternatively, Ku86 might be localized in the nuclear
periphery and thus be unavailable for interaction with the DNA and the
replication complex. The replication of the xrs-5 cytoplasmic extract
activity might be due to the presence of another protein with some affinity
for the replication origin. Such a protein may also account for the observed
in vivo replication activity of xrs-5 cells of 55%
(Fig. 1). It is surprising that
this protein is found in the cytoplasm, but this may reflect a more dynamic
situation in the cells, as seen in the in vitro replication reaction. That is,
this protein may translocate to the nucleus and bind to the origin at G1/S
only and then dissociate and exit from the nucleus. Since the extracts used
for the in vitro replication reaction are prepared from log phase cells, the
majority of this protein would be present in the cytoplasm, with undetectable
levels in the nucleus (Figs 6,
7 and
8). This would also explain why
the in vivo association of Ku with the DHFR oriß origin of DNA
replication, in logarithmically growing xrs-5 cells, was comparable
to background levels, whereas its association with the same origin of DNA
replication was approximately ninefold higher in CHO K1 cells
(Fig. 5B).
The lack of in vitro replication activity of the xrs-5 nuclear extracts was restored upon addition of affinity-purified OBA/Ku (Fig. 8C,D). The ability of affinity-purified OBA/Ku to rescue replication activity in the xrs-5 nuclear cell extracts further demonstrates that it plays a role in mammalian DNA replication. Addition of OBA/Ku to the CHO K1 nuclear cell extracts had no effect on replication (Fig. 8D,E), suggesting that the level of Ku in CHO K1 extracts was sufficient for optimum replication.
Reaction of the xrs-5 cytoplasmic cell extracts with radiolabeled A3/4 produced a protein-DNA complex with a similar migration to the Ku-A3/4 complex produced by the HeLa and CHO K1 cell extract (Fig. 6). Furthermore, this complex was specific, as determined by competition with cold A3/4 DNA (Fig. 7). However, the xrs-5 cytoplasmic cell extracts A3/4 complex was not recognized by the anti-Ku (clone 162) antibody, which recognizes a conformational epitope of the Ku70-Ku86 heterodimer (Fig. 6B) or by the individual anti-Ku70 or anti-Ku86 antibodies (data not shown), suggesting that this epitope is not present. This implies that the cytoplasmic protein that recognizes A3/4 is another origin-specific binding protein with similar affinities for A3/4, or a modified form of Ku86 that is able to complex with Ku70, albeit in a manner that is not recognized by the clone 162 antibody. Further studies are underway to address the nature of this protein.
Absence of the Ku86 protein, either in Ku86-/- mice or
cells, results in hypersensitivity to ionizing radiation, defective DSB-repair
pathways and lymphocyte development and early onset of an age-related
phenotype including osteopenia, hepatocellular degeneration and shortened life
span (Vogel et al., 1999
;
Nussenzweig et al., 1996
;
Gu et al., 1997
). Furthermore,
Ku86 knockout mice are half the size of their heterozygous littermates, their
cells have prolonged doubling times in culture, owing to rapid loss of
proliferating cells, and they exhibit replicative senescence
(Nussenzweig et al., 1996
;
Gu et al., 1997
). In vitro DNA
replication using extracts prepared from Ku86-/- cells
showed a 70% decrease in the replication level, compared to the control
(Novac et al., 2001
).
Depletion of Ku from HeLa cells also resulted in inhibition of DNA replication
to a level that was 10-20% of normal in vitro replication
(Ruiz et al., 1999
). The fact
that the knockout mice are viable and DNA replication is not completely
abolished when Ku is absent suggests that other mechanisms may take over in
the absence of Ku. We are presently investigating these mechanisms in the
xrs-5 and the Ku86-/- cells with the aim of
further understanding the involvement of Ku antigen in DNA replication.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Alexandrow, M. G., Ritzi, M., Pemov, A. and Hamlin, J.
(2002). A potential Role for mini-chromosome maintenance (MCM)
proteins in initiation at the dihydrofolate reductase replication origin.
J. Biol. Chem. 277,2702
-2708.
Araujo, F. D., Knox, J. D., Ramchandani, S., Pelletier, R.,
Bigey, P., Price, G., Szyf, M. and Zannis-Hadjopoulos, M.
(1999). Identification of initiation sites for DNA replication in
the human dnmt1 (DNA-methyltransferase) locus. J. Biol.
Chem. 274,9335
-9341.
Arosio, D., Cui, S., Ortega, C., Chovanec, M., di Marco, S.,
Baldini, G., Falaschi, A. and Vindigni, A. (2002). Studies on
the mode of Ku interactions with DNA. J. Biol. Chem.
277,9741
-9748.
Bakalkin, G., Yakovleva, T., Hurd, Y. L., Nussenzweig, A., Li, G. C. and Terenius, L. (1998). Autoantigen Ku in the brain. Developmentally regulated expression and subcellular localization. Neuroreport 9,2147 -2151.[Medline]
Barnes, G. and Rio, D. (1997). DNA
double-strand-break sensitivity, DNA replication, and cell cycle arrest
phenotypes of Ku-deficient Saccharomyces cerevisiae. Proc. Natl.
Acad. Sci. USA 94,867
-872.
Baumann, P. and Cech, T. R. (2000). Protection
of telomeres by the Ku protein in fission yeast. Mol. Biol.
Cell 11,3265
-3275.
Boulton, S. J. and Jackson, S. P. (1996).
Identification of a Saccharomyces cerevisiae Ku80 homologue: roles in
DNA double strand break rejoining and in telomeric maintenance.
Nucleic Acids Res. 24,4639
-4648.
Brosh, R. M., Jr, Orren, D. K., Nehlin, J. O., Ravn, P. H.,
Kenny, M. K., Machwe, A. and Bohr, V. A. (1999). Functional
and physical interaction between WRN helicase and human replication protein A.
J. Biol. Chem. 274,18341
-18350.
Brown, K. D., Lataxes, T. A., Shangary, S., Mannino, J. L.,
Giadina, J. F., Chen, J. and Baskaran, R. (2000). Ionizing
radiation exposure results in up-regulation of Ku70 via a
p53/Ataxia-Telangiectasia-mutated protein-dependent mechanism J.
Biol. Chem. 275,6651
-6656.
Camara-Clayette, V., Thomas, D., Rahuel, C., Barbey, R.,
Cartron, J. P. and Bertrand, O. (1999). The repressor which
binds the -75 GATA motif of the GPB promoter contains Ku70 as the DNA binding
subunit. Nucleic Acids Res.
27,1656
-1663.