|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
doi: 10.1242/10.1242/jcs.00208
Research Article |
1 Department of Biology, Faculty of Science, and Graduate School of Science and
Technology, Chiba University, Yayoicho, Inageku, Chiba, Chiba 263-8522,
Japan
2 Division of Biochemistry, Institute of Medical Science, University of Tokyo,
Shirokanedai, Minatoku, Tokyo 108-8639, Japan
3 Division of Cancer Genomics, Institute of Medical Science, University of
Tokyo, Shirokanedai, Minatoku, Tokyo 108-8639, Japan
4 CREST, Japan Science and Technology Corporation (JST), Japan
5 PRESTO, Japan Science and Technology Corporation (JST), Japan
* Author for correspondence (e-mail: t.endo{at}faculty.chiba-u.jp)
Accepted 7 October 2002
| Summary |
|---|
|
|
|---|
Key words: Tc10, RhoT, Cdc42, N-WASP, Neurite outgrowth, Neuronal differentiation
| Introduction |
|---|
|
|
|---|
Among them, RhoA, Rac1 and Cdc42 have been studied most intensively. In
fibroblasts, activation of RhoA by the extracellular ligand lysophosphatidic
acid (LPA) leads to the assembly of contractile actin stress fibers and
associated focal adhesions (Ridley and
Hall, 1992
). By contrast, exogenously expressed constitutively
active forms of RhoD, RhoE and Rnd1 disassemble these cytoskeletal structures
by antagonizing RhoA (Murphy et al.,
1996
; Guasch et al.,
1998
; Nobes et al.,
1998
; Tsubakimoto et al.,
1999
). Rac1 activated by platelet-derived growth factor or insulin
induces the assembly of an actin filament meshwork to generate membrane
ruffles (lamellipodia) and specific adhesion complexes
(Ridley et al., 1992
;
Nobes and Hall, 1995
). Cdc42
activated by bradykinin is responsible for the formation of
actin-filament-containing microspikes (filopodia) and associated adhesion
complexes (Kozma et al., 1995
;
Nobes and Hall, 1995
). In
addition, Cdc42 can activate Rac1 and consequently extension of filopodia is
accompanied by concerted lamellipodial spreading. Cdc42-related Tc10 produces
peripheral extensions longer than the filopodia formed by Cdc42
(Neudauer et al., 1998
).
In neuronal cells, these small GTPases also play important roles in neurite
extension or growth cone remodeling. Clostridium botulinum C3
exoenzyme, which inactivates RhoA by ADP-ribosylating its effector domain,
induces neurite outgrowth in PC12 pheochromocytoma cells and N1E-115
neuroblastoma cells (Nishiki et al.,
1990
; Kozma et al.,
1997
). On the other hand, microinjection of constitutively active
RhoA or its target protein ROCK/Rho-kinase/ROK in neurite-extending PC12 or
N1E-115 cells as well as the treatment of these cells with LPA causes neurite
retraction and growth cone collapse (Tigyi
and Miledi, 1992
; Jalink et
al., 1994
; Hirose et al.,
1998
; Katoh et al.,
1998
). Microinjection of Cdc42 and Rac1 facilitate the formation
of filopodia and lamellipodia, respectively, at the growth cones and along
neurites of N1E-115 cells (Kozma et al.,
1997
). The neuronal growth cone guides the extending neurite
towards its target by constantly protruding and retracting filopodia and
lamellipodia (Heidemann and Buxbaum,
1991
; Bentley and O'Connor,
1994
). Filopodia appear to serve as sensors in growth cone
guidance, whereas lamellipodia are implicated in neurite extension and
cellular movement via membrane extension. Dominant-negative Cdc42(T17N) or
Rac1(T17N) interferes with the neurite outgrowth induced by C3 exoenzyme or
nerve growth factor (NGF), and thus Cdc42 and Rac1 are required for the
neurite outgrowth through the formation of filopodia and lamellipodia,
respectively, at the growth cone (Kozma et
al., 1997
; Chen et al.,
1999
). Dominant-negative mutants of N-WASP, which is a target
protein of Cdc42 and plays essential roles in filopodium formation, prevent
neurite outgrowth in PC12 and hippocampal neurons
(Banzai et al., 2000
). Despite
their critical roles in neurite outgrowth, neither Cdc42 nor Rac1 is
sufficient by itself for activating the signaling pathway leading to the
neurite extension.
To examine the differential roles of Cdc42 subfamily members in cellular process formation, we have cloned a Cdc42 subfamily protein, designated as RhoT, which is most closely related to Tc10. Although Cdc42 was ubiquitously expressed in a variety of tissues and cells, Tc10 and RhoT were differentially expressed in particular muscle types and brain and induced during myogenic or neuronal differentiation. A constitutively active mutant of RhoT formed even longer and thicker processes than those formed by Tc10 in fibroblasts. Remarkably, in neuronal cells both Tc10 and RhoT generated neurites, whereas Cdc42 formed mere filopodia. Tc10 and RhoT as well as Cdc42 bound to and activated N-WASP, and both the process and neurite formation induced by Tc10 and RhoT were mediated by N-WASP. Thus, although these three proteins share N-WASP as a common target protein, they are likely to exert distinct functions in process and neurite formation.
| Materials and Methods |
|---|
|
|
|---|
2x105 cells
(
20% confluency) were plated in the growth medium on a 100 mm dish and
maintained for 16-24 hours, and then the medium was replaced with DME medium
supplemented with 5% horse serum (HS) (differentiation medium). Myotubes
developed extensively by 96 hours after the shift to the differentiation
medium. Mouse Balb/3T3 (Aaronson and
Todaro, 1968
cDNA cloning and sequence analyses
Cytoplasmic RNA was prepared from mouse C2 myotubes as described previously
(Endo and Nadal-Ginard, 1987
),
and poly(A)+ RNA was isolated using Oligotex-dT30 Super (Roche).
The single-stranded cDNA pool was synthesized with SuperScript II RNase H(-)
reverse transcriptase (Invitrogen) from 2 µg of the template
poly(A)+ RNA primed with an oligo(dT) primer. Mouse Tc10
cDNA fragment was cloned from the cDNA pool by reverse transcription (RT)-PCR
using a sense (GTCTTCGACCACTACGCAGTCA) and an antisense
(GCTATGATAGCCTCATCAAAAAC) primer derived from the human Tc10 cDNA
sequence (Drivas et al., 1990
)
(DDBJ/EMBL/GenBank accession number M31470). The amplification reaction was
carried out on Zymoreactor II (Atto) with Taq DNA polymerase (Qiagen).
RhoT cDNA fragment was cloned similarly with a sense
(GTGCCTTATGTGCTCATCGG) and an antisense (CTGAATGTGACTCTGCATTC) primer derived
from a mouse expressed sequence tag (EST) clone (accession number AA920345).
The C2 myotube cDNA library constructed in
ZAPII
(Matsumoto et al., 1997
) was
screened with these cDNA fragments labeled with [
-32P]dCTP
(>111 TBq/mmol, ICN Biomedicals) by using the BcaBEST labeling kit (Takara
Shuzo). A 4.00 kb and a 1.85 kb cDNAs including the entire coding regions of
Tc10 and RhoT, respectively, were cloned. pBluescript SK(-) phagemids
containing cloned cDNAs were obtained by in vivo excision. The nucleotide
sequence of the cDNAs was determined with LI-COR 4000 automated DNA sequencing
system using a SequiTherm Long-Read Cycle Sequencing Kit-LC (Epicentre
Technologies). The nucleotide and amino-acid sequences were analyzed with
GENETYX-Mac softwares (Ver. 10.1, Software Development Co.).
Northern blotting and quantitative RT-PCR
Cytoplasmic RNAs of cultured cells were prepared as described previously
(Endo and Nadal-Ginard, 1987
).
Total RNAs of mouse tissues were prepared according to Chomczynski and Sacchi
(Chomczynski and Sacchi,
1987
). Northern blotting was carried out as stated elsewhere
(Endo and Nadal-Ginard, 1987
).
Quantitative RT-PCR was performed as described previously
(Kadota et al., 2000
). The
amplification reaction was conducted according to a step program (at 95°C
for 60 seconds, at 58°C for 15 seconds and at 72°C for 60 seconds).
The primers used for RhoT amplification were the same as those used for the
cloning. The primers for glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as a
control were as previously described
(Kadota et al., 2000
). After
50 and 17 cycles of amplification, respectively, these products were in the
linear range. The PCR produsts were analyzed by agarose gel
electrophoresis.
Epitope-tagging, EGFP-tagging and transfection
Point mutations to generate the constitutively active mutants of Tc10(G18V)
and RhoT(G30V) and the dominant-negative mutants of Tc10(T23K) and RhoT(T35N)
were introduced in the cDNAs using a Transformer site-directed mutagenesis kit
(Clontech Laboratories, Inc.). Coding sequences of the wild-type (wt) and the
mutated proteins were fused in-frame to the N-terminal Myc-tag in pEF-BOS/Myc
vector. They were also ligated to pEGFP-C1 vector (Clontech). These
recombinant plasmids were transfected to the cultured cells grown on glass
coverslips by the calcium-phosphate-mediated method as described previously
(Endo et al., 1996
). The
transiently transfected cells were processed for immunofluorescence microscopy
(Endo and Nadal-Ginard, 1998
).
The fixed and permeabilized cells were incubated with the monoclonal antibody
(mAb) Myc1-9E10 recognizing the Myc-tag
(Evan et al., 1985
) (American
Type Culture Collection) and then with fluorescein isothiocyanate
(FITC)-conjugated goat anti-mouse IgG (affinity-purified, Cappel). To detect
actin filaments, rhodamine-phalloidin (Molecular Probes, Inc.) was included in
the secondary antibody. The specimens were observed with a Zeiss Axioskop
microscope.
Yeast two-hybrid interaction assay
The cDNAs encoding the wt, constitutively active and dominant-negative
mutants of Cdc42, Tc10, and RhoT were ligated to the Gal4 DNA-binding domain
of the pGBT9 vector (Clontech). A cDNA fragment encoding the N-terminal
portion (amino acids 1-275) of N-WASP
(Miki et al., 1996
;
Miki et al., 1998
) was fused
to the Gal4 activation domain of pACT2 vector (Clontech). The yeast strain
Y190 was sequentially transformed with the bait and prey plasmids. Double
transformants were selected on plates of minimal synthetic dropout medium
lacking leucine and tryptophan (SD/Leu/Trp). The activation of
lacZ reporter gene was analyzed using a ß-galactosidase
colony-lift filter assay.
Pull-down assay
Coding sequences of the wt small GTPases were ligated in-frame to
glutathione S-transferase (GST)-tag of pGEX-2T vector (Amersham
Biosciences). The GST-tagged recombinant proteins were expressed in E.
coli strain XL1-Blue and affinity-purified with glutathione-Sepharose 4B
(Amersham Biosciences). The cDNA encoding full-length N-WASP was fused
in-frame to the hemagglutinin (HA)3-tag of pEF-BOS/HA vector. This
recombinant plasmid was transfected into Balb/3T3 cells. 24 hours after the
transfection, the cells were lysed with RIPA buffer (150 mM NaCl, 50 mM
Tris-HCl, pH 8.0, 1% Nonidet P-40, 0.5% Na deoxycholate and 0.1% SDS)
containing 1 mM dithiothreitol, 0.1 mM phenylmethylsulfonyl fluoride and 4 mM
MgCl2 and then centrifuged at 16,000 g for 15
minutes. The supernantant was then recovered. The prepurified GST-tagged small
GTPases were loaded with either 1 mM GTP
S or GDP and reapplied to
glutathione-Sepharose 4B. The cell lysate was applied to the small
GTPase-coupled resin and extensively washed with RIPA buffer, and binding
proteins were eluted with 5 mM glutathione in 50 mM Tris-HCl (pH 8.0). The
eluted proteins were subjected to SDS-PAGE, and then HA-tagged N-WASP was
detected by immunoblotting with anti-HA-tag polyclonal antibody (pAb) (MBL),
horseradish-peroxidase-conjugated goat anti-rabbit IgG (Bio-Rad) as a
secondary antibody, and Renaissance western blot chemiluminescence reagent
Plus (NEN Life Science Products).
Actin polymerization assay
Actin, His-tagged N-WASP, GST-tagged VCA fragment of N-WASP and Arp2/3
complex were prepared as described previously
(Rohatgi et al., 1999
;
Fukuoka et al., 2001
). The
GST-tagged recombinant wt small GTPases were expressed by using pGEX-6P
vectors (Amersham Biosciences), and the GST-tag was removed by treating with
PreScission protease (Amersham Biosciences). Actin polymerization was analyzed
by monitoring the change in fluorescence intensity of pyrene-labeled actin as
described previously (Rohatgi et al.,
1999
; Fukuoka et al.,
2001
). The small GTPases were mixed with 10 times the amount of
GTP
S and incubated for 10 minutes at 30°C, and the reaction was
stopped by adding 10 mM MgCl2. Polymerization reaction mixtures
contained 2 µM unlabeled actin, 0.2 µM pyrene-labeled actin, 0.2 mM ATP
and appropriate proteins (100 nM His-N-WASP, 200 nM GST-VCA, 60 nM Arp2/3
complex and 400 nM small GTPases) in 80 µl of X buffer (10 mM HEPES, pH
7.6, 100 mM KCl, 1 mM MgCl2, 0.1 mM EDTA and 1 mM DTT) and were
preincubated for 5 minutes. The reaction was started by adding the mixture of
actin and pyrene-actin to the preincubated protein mixtures, and fluorescence
change was measured at 407 nm with excitation at 365 nm in the
spectrofluorometer FB-777W (JASCO). The kinetic analyses were performed with
software provided by the manufacturer.
| Results |
|---|
|
|
|---|
|
Recently, a novel Rho family protein TCL has been reported
(Vignal et al., 2000
). Except
for an N-terminal deletion of 10 amino acids (corresponding to Arg4-Cys13 of
RhoT), mouse TCL was identical to RhoT
(Fig. 1C). When the cDNA
sequences of RhoT and TCL were compared with the
corresponding mouse genomic sequence of chromosome 12, RhoT cDNA
sequence exactly matched the genomic exon sequence
(Fig. 1C). By contrast, the
cDNA sequence deleted in the TCL cDNA (corresponding to the
Arg4-Cys13 of RhoT) did not represent an intron because it did not coincide
with the consensus sequences for an intron. Thus, the deletion in TCL
is not generated by alternative splicing but seems to be generated either by
nucleotide polymorphism or artifactually. Cloning of the TCL cDNA by
RT-PCR (Vignal et al., 2000
)
and not by cDNA library screening, by which the RhoT cDNA was cloned,
may be responsible for the deletion.
RhoT contained the conserved motifs for GTPase activity and GTP/GDP-binding
(Fig. 1A). The switch I and II
regions undergo considerable conformational change depending on the binding of
GTP and GDP (Milburn et al.,
1990
). The sequence of the switch I region, which almost
corresponds to the effector domain, is relatively well conserved among each
subfamily. The switch I region sequences were identical in Tc10 and RhoT.
Although the sequence of the switch II region is highly conserved among Rho
family proteins, RhoT contained uncharged amino acids (NQ) instead of charged
amino acids (DR) in this region. The Rho insert region with 13 amino acids is
specific for Rho family proteins and has been shown to be involved in the
binding of effector proteins and RhoGDI
(Freeman et al., 1996
;
McCallum et al., 1996
;
Wu et al., 1997
). Although the
sequences of this region are quite distantly related, those of Tc10 and RhoT
were closely related to each other. However, two amino acids ND in this region
of Tc10 were replaced by unrelated amino acids LY in that of RhoT. The
C-terminal CaaX motif (C, cysteine; a, aliphatic amino acid; X, any amino
acid), which is a signal for three types of post-translational modifications,
that is, isoprenylation, proteolysis and methylation
(Glomset and Farnsworth, 1994
;
Zhang and Casey, 1996
), was
conserved in RhoT as well as in the other Rho family proteins. Tc10 as well as
H-Ras and RhoB has a CXXC sequence immediately upstream of the CaaX motif.
These two Cys residues are palmitoylated and serve as membrane-targeting sites
(Hancock et al., 1989
;
Adamson et al., 1992
;
Michaelson et al., 2001
).
Instead of the CXXC, RhoT had a CXXCXXC sequence, which seems to be a site for
triple palmitoylation, and another membrane-targeting polybasic region
upstream of the CXXCXXC sequence. In addition, RhoT had a long unique
N-terminal extension as do RhoD, RhoE and Rnd1.
Tc10 and RhoT are differentially expressed in muscles and brain and
induced during myogenic and neuronal differentiation
The expression levels of the Cdc42 subfamily members in tissues and cells
were examined by northern blotting (Fig.
2Aa). A 2.2 kb Cdc42 mRNA was ubiquitously present in a variety of
mouse tissues examined, whereas a 1.8 kb mRNA was specifically expressed in
the brain. The amount of the 2.2 kb mRNA was almost constant throughout
differentiation of C2 skeletal muscle cells and in 10T1/2 fibroblasts. In
addition, a 1.0 kb mRNA was detected particularly in these cultured cells. The
amount of 2.2 kb mRNA was downregulated during neuronal differentiation of rat
pheochromocytoma PC12 cells induced with NGF or dbcAMP and during
differentiation of mouse N1E-115 neuroblastoma cells induced by serum
starvation. By contrast, it was almost unchanged during differentiation of
N1E-115 cells induced with DMSO.
|
Tc10 mRNAs (4.4 and 3.4 kb) were highly expressed in three types of muscle tissues, that is, leg skeletal muscle, heart (cardiac muscle) and uterus (smooth muscle) (Fig. 2Ab). The mRNAs were also present in brain, and their amounts were higher in adults than in newborns. They existed at a moderate level in undifferentiated C2 myoblasts but were remarkably induced by 48 hours after the induction of differentiation and remained at a high level in terminally differentiated myotubes. Further, the mRNAs were gradually induced during differentiation of PC12 cells stimulated with NGF or with dbcAMP and accumulated at a high level by 96 hours. They were also upregulated in N1E-115 cells according to the progression of differentiation by serum starvation or by DMSO treatment.
By contrast, RhoT mRNA (2.5 kb) was predominantly present in the uterus and heart (Fig. 2Ac). It also existed in skeletal muscle and brain to lesser extents. Its expression level was almost constant during C2 cell differentiation and higher in 10T1/2 fibroblasts than in C2 cells. The mRNA was hardly detected by northern blotting in PC12 and N1E-115 cells regardless of their differentiated state. However, quantitative RT-PCR analyses detected RhoT mRNA in N1E-115 cells, comparable to the level in the brain, after the differentiation induced with DMSO but not by serum starvation (Fig. 2B). Although the mRNA was not detected in PC12 cells even by the PCR analyses, this was possibly due to the inability of the used PCR primers to anneal to RhoT cDNA because the primers were designed on the basis of the mouse RhoT sequence.
RhoT induces remarkably long and thick processes
Microinjection or transfection of constitutively active Cdc42 to
fibroblastic cells results in the reorganization of the actin cytoskeleton and
the formation of filopodia (Kozma et al.,
1995
; Nobes and Hall,
1995
; Dutartre et al.,
1996
). Transfection of constitutively active Tc10 causes the
disassembly of stress fibers and the formation of peripheral extensions longer
than those induced by Cdc42 (Neudauer et
al., 1998
; Murphy et al.,
1999
). We examined the effects of RhoT on actin cytoskeleton and
cell morphology in comparison with those of Cdc42 and Tc10. Transfection of
Myc-tagged constitutively active Cdc42(G12V) or Tc10(G18V) to Balb/3T3 and
10T1/2 fibroblasts caused loss of thick stress fibers and induced round cell
shape and peripheral processes in both these cell types
(Fig. 3A,Ba,c). The processes
formed by Tc10 were 10-20 µm long and longer than those by Cdc42 (
10
µm long). They contained actin filaments as detected by
rhodamine-phalloidin staining (Fig.
3A,Bb,d). When Myc-tagged constitutively active RhoT(G30V) was
expressed in these cells, remarkably long (up to 40 µm) and thick processes
containing actin filaments were generated
(Fig. 3A,Be,f). The tips of the
processes were often swollen, distinct from those formed by Cdc42 or Tc10.
Loss of stress fibers and round cell shape were also evident in these
cells.
|
Tc10 and RhoT but not Cdc42 induce neurite outgrowth
Since Tc10 and RhoT caused the formation of long processes and their mRNAs
were induced during neuronal differentiation of PC12 or N1E-115 cells, we next
examined whether Tc10 and RhoT were responsible for the neurite outgrowth in
these cells. If Cdc42(G12V) were transfected into PC12 cells, filopodia were
formed but neurites were barely detected
(Fig. 4Ab,C). Wild-type (wt)
Cdc42 rarely generated even such filopodia
(Fig. 4Aa). On the other hand,
Cdc42(wt) but not Cdc42(G12V) formed filopodia in N1E-115 cells
(Fig. 4Ba,b). Cdc42(G12V)
brought about spread or flattened forms of the cells, and neither Cdc42(wt)
nor Cdc42(G12V) generated neurites in N1E-115 cells
(Fig. 4Ba,b,D).
|
On the one hand, both Tc10(G18V) and RhoT(G30V) induced neurites in PC12 cells, whereas their wt forms did not (Fig. 4Ac-f,C). Tc10(wt) and RhoT(wt) generated long (>four times longer than the cell body) neurites in N1E-115 cells (Fig. 4Bc-e,D). The neurites induced by RhoT were generally longer than those induced by Tc10. On the other hand, Tc10(G18V) and RhoT(G30V) were less effective in giving rise to the neurites (Fig. 4Bd,f,D). Immunofluorescence microscopy showed that these neurites included microtubules containing tubulin and MAP2 as in the neurites formed in NGF-treated PC12 cells and in serum-starved N1E-115 cells (data not shown). Dominant-negative mutants of Tc10(T23K) and RhoT(T35N) were incapable of forming neurites (data not shown).
Tc10 and RhoT bind to and activate N-WASP to induce
Arp2/3-complex-mediated actin polymerization
Cdc42 generates filopodia through binding to the CRIB motif
(Burbelo et al., 1995
) of its
target protein N-WASP, which activates Arp2/3-complex- and profilin-mediated
actin polymerization (Miki et al.,
1996
; Miki et al.,
1998
; Rohatgi et al.,
1999
). To address whether Tc10 and RhoT also bound to N-WASP, we
exploited the yeast two-hybrid interaction assay. The ß-galactosidase
colony-lift filter assay showed that both the wt and constitutively active
forms of Tc10 and RhoT as well as those of Cdc42 bound to the
CRIB-motif-containing N-terminal portion of N-WASP
(Fig. 5A). By contrast, their
dominant-negative forms and constitutively active RhoA(G14V) as a negative
control did not bind to N-WASP.
|
Next, we assessed the binding of these Cdc42 subfamily proteins to N-WASP
by pull-down assay. GST-tagged Cdc42, Tc10 RhoT loaded with GTP
S bound
HA-tagged N-WASP expressed in Balb/3T3 cells
(Fig. 5B). But the GDP-loaded
Cdc42 subfamily proteins as well as GTP
S- or GDP-loaded RhoA were
unable to bind N-WASP. Taken together, these results imply that not only Cdc42
but also Tc10 and RhoT bind to N-WASP in a GTP-dependent manner.
To further examine whether the binding of Tc10 and RhoT to N-WASP actually
leads to the activation of N-WASP to induce Arp2/3-complex-mediated actin
polymerization, we conducted fluorometric actin polymerization assay with
pyrene-actin. The VCA (verprolin homology-cofilin homology-acidic domain)
fragment of N-WASP with the Arp2/3 complex extremely efficiently activated
actin polymerization as described (Rohatgi
et al., 1999
), whereas N-WASP and Arp2/3 complex did not
efficiently activate actin polymerization in the absence of the Cdc42
subfamily proteins (Fig. 5C).
Conversely, none of the small GTPases activated actin polymerization without
the addition of N-WASP. When N-WASP and Arp2/3 complex were present, however,
both GTP
S-loaded Tc10 and RhoT as well as Cdc42 efficiently activated
actin polymerization (Fig. 5C).
Thus, Tc10 and RhoT are also concerned with actin polymerization by activating
N-WASP as their target protein.
Tc10 and RhoT require N-WASP for process formation and neurite
outgrowth
As Tc10 and RhoT bound to N-WASP to induce actin polymerization, it is
important to determine whether binding and actin polymerization are essential
for the functions of Tc10 and RhoT. The substitution of Asp for His208 (H208D)
in the CRIB motif of N-WASP abolishes the binding of Cdc42 to N-WASP
(Miki et al., 1998
). The
cofilin-homology domain of N-WASP in combination with the adjacent acidic
domain is involved in the binding of Arp2/3 complex to polymerize actin
(Rohatgi et al., 1999
;
Takenawa and Miki, 2001
). The
four amino-acid deletion in this domain (
cof) abrogates the ability to
activate Arp2/3 complex (Rohatgi et al.,
1999
; Banzai et al.,
2000
). Because both these mutants not only interfere with
Cdc42-induced filopodium formation (Miki
et al., 1998
; Banzai et al.,
2000
) but also did not affect Rac1-induced lamellipodium formation
or RhoA-induced stress fiber formation (data not shown), they actually serve
as dominant-negative mutants of N-WASP. Thus, we utilized them to examine the
involvement of N-WASP in process formation and neurite outgrowth by Tc10 and
RhoT.
When N-WASP(H208D) or N-WASP
cof was coexpressed with Cdc42(G12V) in
Balb/3T3 cells, filopodium formation was prevented
(Fig. 6A,Ba,b). These results
are consistent with the previous observations using COS-7 cells
(Miki et al., 1998
).
Coexpression of either of these N-WASP mutants with Tc10(G18V) also suppressed
the process formation by Tc10 (Fig.
6A,Bc,d). Each of these N-WASP mutants coexpressed with RhoT(G30V)
interfered with the RhoT-induced long and thick process formation as well
(Fig. 6A,Be,f). Similar results
were obtained with 10T1/2 cells (data not shown). These results indicate that
N-WASP is required for the Tc10- and RhoT-mediated process formation as well
as for the filopodium formation induced by Cdc42.
|
Coexpression of N-WASP(H208D) or N-WASP
cof with Cdc42(G12V) in PC12
cells also resulted in the abrogation of filopodium formation
(Fig. 7A,Ba,b). Furthermore,
Tc10(G18V)-induced neurite outgrowth was hindered by the coexpression of
N-WASP(H208D) or N-WASP
cof (Fig.
7A,Bc,d,C). Similarly, RhoT(G30V)-induced neurite outgrowth was
retarded by the coexpression of the dominant-negative mutants of N-WASP
(Fig. 7A,Be,f,C). These
dominant-negative mutants of N-WASP also interfered with the neurite outgrowth
in N1E-115 cells induced by Tc10 or RhoT (data not shown). Thus, N-WASP plays
essential roles in the neurite extension caused by Tc10 or RhoT as well as in
the process formation in fibroblasts.
|
Tc10 and RhoT are essential for neuronal differentiation of PC12 and
N1E-115 cells
Next, we investigated whether the Cdc42 subfamily proteins were required
for the neuronal differentiation in PC12 and N1E-115 cells represented by
neurite extension. PC12 cells were induced to differentiate by the stimulation
with dbcAMP (see Fig.
8Aa,c,e,g). Expression of dominant-negative Cdc42(T17N) in
dbcAMP-stimulated PC12 cells prevented the neurite outgrowth
(Fig. 8Ac,d,C), whereas mock
transfection of the empty vector had no effect on the neurite extension
(Fig. 8Aa,b). Moreover, the
expression of dominant-negative Tc10(T23K) or RhoT(T35N) impeded the neurite
outgrowth as well (Fig.
8Ae-h,C).
|
N1E-115 cells were induced to differentiate by serum starvation (see Fig. 8Ba,c,e,g). The dominant-negative Cdc42(T17N) expressed in serum-starved N1E-115 cells prevented the neurite outgrowth (Fig. 8Bc,d,D), although mock transfection of the empty vector did not affect neurite extension (Fig. 8Ba,b). Furthermore, the expression of dominant-negative Tc10(T23K) or RhoT(T35N) hindered the neurite outgrowth as well (Fig. 8Be-h,D). These results, together with those of transfection of the wt or constitutively active mutants, imply that Tc10 and RhoT are required for neurite extension in both PC12 and N1E-115 cells.
| Discussion |
|---|
|
|
|---|
Cdc42 was ubiquitously expressed in a variety of tissues and cells. By
contrast, Tc10 and RhoT exhibited tissue-specific expression patterns. Tc10
was highly expressed in skeletal muscle, the heart and uterus, and its mRNAs
were remarkably induced during C2 skeletal muscle cell differentiation. On the
other hand, RhoT was predominantly expressed in the uterus and heart. These
results suggest that Tc10 and RhoT play some roles in these muscular tissues
or cells. Indeed, recent studies have shown that Tc10 and its target N-WASP
are essential for insulin-stimulated glucose transporter 4 (GLUT4)
translocation (Chiang et al.,
2001
; Jiang et al.,
2002
), which is required for glucose transport, in skeletal muscle
and adipose tissue. GLUT4 is also expressed in heart and smooth muscle
(Gould and Holman, 1993
) as
well as in cultured skeletal muscle cells
(Ralston and Ploug, 1996
).
Accordingly, one of the roles of Tc10 in the muscular tissues and in cultured
myocytes is the regulation of glucose transport. Tc10 is located to
caveolin-enriched lipid raft microdomains. This location determined by the
C-terminal sequence of Tc10, including the double palmitoylatable Cys
residues, is indispensible for GLUT4 translocation
(Watson et al., 2001
). Thus,
it is important to examine whether RhoT with triple palmitoylatable Cys
residues is also associated with lipid raft microdomains and involved in GLUT4
translocation in smooth muscle and heart.
Tc10 and RhoT were also expressed in the brain, and their mRNAs were
induced during differentiation of PC12 or N1E-115 cells. These results seem to
imply that Tc10 and RhoT play substantial roles in neuronal differentiation or
brain functions. RhoT mRNA was induced by DMSO treatment but not by serum
starvation in N1E-115 cells. In this regard, it should be noted that DMSO
treatment induces not only neurite extension but also electrophysiological
differentiation in N1E-115 cells (Kloog et
al., 1983
). By contrast, serum starvation also causes neurite
outgrowth but does not enhance electrical excitability. This fact may
substantiate the roles of RhoT in functional differentiation of neurons.
Exogenous expression of the constitutively active Tc10(G18V) in fibroblasts
generated peripheral processes containing actin filaments and longer than the
filopodia formed by Cdc42(G12V). RhoT(G30V) formed extremely long and thick
processes. Notably, the tips of the processes were usually swollen, different
from those formed by Cdc42 or Tc10. These long and thick processes with
swollen tips are reminiscent of pseudopods of certain types of cultured cells
or neurites with growth cones. Recently reported TCL
(Vignal et al., 2000
) is
identical to RhoT except for the N-terminal deletion of 10 amino acids
(corresponding to Arg4-Cys13 of RhoT). However, TCL has not been shown to form
the peripheral processes or neurites. Instead, EGFP-tagged constitutively
active TCL produces actin-rich ruffles on the dorsal cell membrane. The
discrepancy between the cellular functions of RhoT and those of TCL is
probably due to the artifactual side-effect of the long EGFP-tag for the TCL
action because EGFP-tagged RhoT were unable to generate processes any more
(data not shown). Alternatively, the inconsistency is ascribed to the
N-terminal deletion in TCL because the N-terminal sequence may have crucial
functions as discussed above.
Although wt or constitutively active mutants of Cdc42 generate filopodia
and successive lamellipodia at the growth cone of N1E-115 cells
(Kozma et al., 1997
), they
scarcely produced neurites in PC12 or N1E-115 cells, consistent with the
previous reports (Kozma et al.,
1997
; Katoh et al.,
2000
). By contrast, exogenous expression of Tc10 or RhoT induced
neurite formation in PC12 and N1E-115 cells. Constitutively active forms but
not wt of these proteins induced neurites in PC12 cells, whereas in N1E-115
cells the wt proteins much more effectively generated neurites than did the
constitutively active forms. This may imply that activation of these proteins
is essential for the neurite extension in PC12 cells; it may also imply that a
regulated activation and inactivation cycle for these proteins favors the
neurite extension in N1E-115 cells. RhoT generated neurites longer than those
formed by Tc10. These results and those of distinctive process formation in
fibroblasts suggest that Tc10 and RhoT possess specific target proteins even
if they share several target proteins. Although PC12 and N1E-115 cells are
induced to differentiate by different stimulations, the mechanisms for neurite
extension with regard to cytoskeletal regulation are likely to be identical or
very similar because Tc10 and RhoT induce neurite extension in both these
cells.
Expression of each dominant-negative mutant of Tc10 and RhoT prevented the
neurite outgrowth in PC12 cells induced by dbcAMP and that of N1E-115 cells
induced by serum starvation. Accordingly, neurite extension by Tc10 and RhoT
is not merely an artifactual effect of overexpression but indeed a
physiological one. Although the exogenous expression of Cdc42 itself did not
result in neurite outgrowth, its dominant-negative mutant also interfered with
the neurite extension as previously reported
(Kozma et al., 1997
). This is
probably because Cdc42 is essential for filopodium and lamellipodium formation
at the growth cone, which is required for neurite extension
(Kozma et al., 1997
;
Gallo and Letourneau, 1998
).
But formation of these structures on the growth cone may not be sufficient for
the induction of neurite outgrowth. Tc10 and RhoT may participate in the
elongation of a `stalk' portion of neurites as well as sequential activation
of Cdc42 at the growth cone leading to filopodium formation. Indeed, filopodia
and lamellipodia were formed at the growth cone of neurites induced by Tc10 or
RhoT. As a consequence, exogenously expressed Tc10 or RhoT seems able to
generate neurites by itself.
Cdc42 exerts its functions through a variety of effector proteins
(Aspenström, 1999a
;
Aspenström, 1999b
). Tc10
shares with Cdc42 some of these target proteins including IQGAP1, PAK, MRCK,
MLK, Borg, Par6 and N-WASP (Neudauer et
al., 1998
; Joberty et al.,
1999
; Joberty et al.,
2000
), whereas Tc10 has a specific target protein PIST (Neudauer,
2001). Here we showed that Tc10 and RhoT as well as Cdc42 bound to the
CRIB-motif-containing N-terminal portion of N-WASP in a GTP-dependent manner
and consequently induced Arp2/3-complex-mediated actin polymerization. Cdc42
generates filopodia through binding to the CRIB motif of N-WASP, which
activates Arp2/3-complex-mediated actin polymerization
(Miki et al., 1996
;
Miki et al., 1998
;
Rohatgi et al., 1999
;
Takenawa and Miki, 2001
). Tc10
and RhoT also utilized N-WASP for the formation of the specific processes
distinct from the Cdc42-induced filopodia. This implies that N-WASP mediates
the formation of actin filament bundles that are much longer and thicker than
those in the filopodia. Furthermore, the neurite outgrowth by Tc10 or RhoT in
both PC12 and N1E-115 cells necessitate N-WASP-mediated actin polymerization.
Neurite outgrowth induced with NGF or dbcAMP in PC12 cells and that in
hippocampal neurons also require active N-WASP
(Banzai et al., 2000
). In these
cells, N-WASP activated by Tc10 or RhoT is likely to be responsible for
neurite outgrowth per se and that activated by Cdc42 is responsible for
filopodium and lamellipodium formation at the growth cone, because exogenously
expressed Tc10 or RhoT but not Cdc42 generates neurites by itself. As stated
above, N-WASP activated by Tc10, and possibly by RhoT, is required for
GLUT4-mediated glucose uptake in adipocytes and myocytes
(Chiang et al., 2001
;
Jiang et al., 2002
). Cdc42 is
not involved in this process. Thus, N-WASP activated by Tc10 or RhoT has a
variety of physiological functions, which are not mediated by Cdc42. The
differential physiological functions among these three members of Cdc42
subfamily seem to be ascribed to their tissue specificity, developmental or
differentiation stage specificity and subcellular localization determined by
their C-terminal membrane-targeting signals and interaction with target
proteins or modulator proteins.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Aaronson, S. A. and Todaro, G. J. (1968). Development of 3T3-like lines from Balb/c mouse embryo cultures: transformation susceptibility to SV40. J. Cell. Physiol. 72,141 -148.[CrossRef][Medline]
Adamson, P., Marshall, C. J., Hall, A. and Tilbrook, P. A.
(1992). Post-translational modifications of p21rho proteins.
J. Biol. Chem. 267,20033
-20038.
Amano, T., Richelson, E. and Nirenberg, M.
(1972). Neurotransmitter synthesis by neuroblastoma clones.
Proc. Natl. Acad. Sci. USA
69,258
-263.
Aspenström, P. (1999a). Effects for the Rho GTPases. Curr. Opin. Cell Biol. 11, 95-102.[CrossRef][Medline]
Aspenström, P. (1999b). The Rho GTPases have multiple effects on the actin cytoskeleton. Exp. Cell Res. 246,20 -25.[CrossRef][Medline]
Banzai, Y., Miki, H., Yamaguchi, H. and Takenawa, T.
(2000). Essential role of neural Wiskott-Aldrich syndrome protein
in neurite extension in PC12 cells and rat hippocampal primary culture cells.
J. Biol. Chem. 275,11987
-11992.
Bentley, D. and O'Connor, T. P. (1994). Cytoskeletal events in growth cone steering. Curr. Opin. Neurobiol. 4,43 -48.[CrossRef][Medline]
Burbelo, P. D., Drechsel, D. and Hall, A.
(1995). A conserved binding motif defines numerous candidate
target proteins for both Cdc42 and Rac GTPases. J. Biol.
Chem. 270,29071
-29074.
Chen, X.-Q., Tan, I., Leung, T. and Lim, L.
(1999). The myotonic dystrophy kinase-related Cdc42-binding
kinase is involved in the regulation of neurite outgrowth in PC12 cells.
J. Biol. Chem. 274,19901
-19905.
Chiang, S.-H., Baumann, C. A., Kanzaki, M., Thurmond, D. C., Watson, R. T., Neudauer, C. L., Macara, I. G., Pessin, J. E. and Saltiel, A. R. (2001). Insulin-stimulated GLUT4 translocation requires the CAP-dependent activation of TC10. Nature 410,944 -948.[CrossRef][Medline]
Chomczynski, P. and Sacchi, N. (1987). Single-step method of RNA isolation by acid guanidinium thiocyanatephenolchloroform extraction. Anal. Biochem. 162,156 -159.[Medline]
Drivas, G. T., Shih, A., Coutavas, E., Rush, M. G. and
D'Eustachio, P. (1990). Characterization of four novel
ras-like genes expressed in a human teratocarcinoma cell line. Mol.
Cell. Biol. 10,1793
-1798.
Dutartre, H., Davoust, J., Gorvel, J.-P. and Chavrier, P. (1996). Cytokinesis arrest and redistribution of actin-cytoskeleton regulatory components in cells expressing the Rho GTPase CDC42Hs. J. Cell Sci. 109,367 -377.[Abstract]
Endo, T. (1992). SV40 large T inhibits myogenic
differentiation partially through inducing c-jun. J.
Biochem. 112,321
-329.
Endo, T. and Nadal-Ginard, B. (1987). Three types of muscle-specific gene expression in fusion-blocked rat skeletal muscle cells: translational control in EGTA-treated cells. Cell 49,515 -526.[CrossRef][Medline]
Endo, T. and Nadal-Ginard, B. (1998). Reversal of myogenic terminal differentiation by SV40 large T antigen results in mitosis and apoptosis. J. Cell Sci. 111,1081 -1093.[Abstract]
Endo, T., Matsumoto, K., Hama, T., Ohtsuka, Y., Katsura, G. and
Obinata, T. (1996). Distinct troponin T genes are expressed
in embryonic/larval tail striated muscle and adult body wall smooth muscle of
ascidian. J. Biol. Chem.
271,27855
-27862.
Evan, G. I., Lewis, G. K., Ramsay, G. and Bishop, J. M.
(1985). Isolation of monoclonal antibodies specific for human
c-myc proto-oncogene product. Mol. Cell. Biol.
5,3610
-3616.
Freeman, J. L., Abo, A. and Lambeth, J. D.
(1996). Rac "insert region" is a novel effector
region that is implicated in the activation of NADPH oxidase, but not PAK65.
J. Biol. Chem. 271,19794
-19801.
Fukuoka, M., Suetsugu, S., Miki, H., Fukami, K., Endo, T. and
Takenawa, T. (2001). A novel neural Wiskott-Aldrich syndrome
protein (N-WASP) binding protein, WISH, induces Arp2/3 complex activation
independent of Cdc42. J. Cell Biol.
152,471
-482.
Gallo, G. and Letourneau, P. C. (1998). Axon guidance: GTPases help axons reach their targets. Curr. Biol. 8,R80 -R82.[CrossRef][Medline]
Glomset, J. A. and Farnsworth, C. C. (1994). Role of protein modification reactions in programming interactions between Ras-related GTPases and cell membranes. Annu. Rev. Cell Biol. 10,181 -205.[CrossRef]
Gould, G. W. and Holman, G. D. (1993). The glucose transporter family: structure, function and tissue-specific expression. Biochem. J. 295,329 -341.
Greene, L. A. and Tischler, A. S. (1976).
Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma
cells which respond to nerve growth factor. Proc. Natl. Acad. Sci.
USA 73,2424
-2428.
Guasch, R. M., Scambler, P., Jones, G. E. and Ridley, A. J.
(1998). RhoE regulates actin cytoskeleton organization and cell
migration. Mol. Cell. Biol.
18,4761
-4771.
Hall, A. (1998). Rho GTPases and the actin
cytoskeleton. Science
279,509
-514.
Hancock, J. F., Magee, A. I., Childs, J. E. and Marshall, C. J. (1989). All ras proteins are polyisoprenylated but only some are palmitoylated. Cell 57,1167 -1177.[CrossRef][Medline]
Heidemann, S. R. and Buxbaum, R. E. (1991). Growth cone motility. Curr. Opin. Neurobiol. 1, 339-345.[CrossRef][Medline]
Hirose, M., Ishizaki, T., Watanabe, N., Uehata, M., Kranenburg,
O., Moolenaar, W., Matsumura, F., Maekawa, M., Bito, H. and Narumiya, S.
(1998). Molecular dissection of the Rho-associated protein kinase
(p160ROCK)-regulated neurite remodeling in neuroblastoma N1E-115 cells.
J. Cell Biol. 141,1625
-1636.
Jalink, K., van Corven, E. J., Hengeveld, T., Morii, N.,
Narumiya, S. and Moolenaar, W. H. (1994). Inhibition of
lysophosphatidate- and thrombin-induced neurite retraction and neuronal cell
rounding by ADP ribosylation of the small GTP-binding protein Rho.
J. Cell Biol. 126,801
-810.
Jiang, H., Luo, J.-Q., Urano, T., Frankel, P., Lu, Z., Foster, D. A. and Feig, L. A. (1995). Involvement of Ral GTPse in v-Src-induced phospholipase D activation. Nature 378,409 -412.[CrossRef][Medline]
Jiang, Z. Y., Chawla, A., Bose, A., Way, M. and Czech, M. P.
(2002). A phosphatidylinositol 3-kinase-independent insulin
signaling pathway to N-WASP/Arp/2/3/F-actin for GLUT4 glucose transporter
recycling. J. Biol. Chem.
277,509
-515.
Joberty, G., Perlungher, R. R. and Macara, I. G.
(1999). The Borgs, a new family of Cdc42 and TC10
GTPase-interacting proteins. Mol. Cell. Biol.
19,6585
-6597.
Joberty, G., Petersen, C., Gao, L. and Macara, I. G. (2000). The cell-polarity protein Par6 links Par3 and atypical protein kinase C to Cdc42. Nat. Cell Biol. 2, 531-539.[CrossRef][Medline]
Kadota, N., Suzuki, A., Nakagami, Y., Izumi, T. and Endo, T.
(2000). Endogenous meltrin
is ubiquitously expressed and
associated with the plasma membrane but exogenous meltrin
is retained
in the endoplasmic reticulum. J. Biochem.
128,941
-949.
Kaibuchi, K., Kuroda, S. and Amano, M. (1999). Regulation of the cytoskeleton and cell adhesion by the Rho family GTPases in mammalian cells. Annu. Rev. Biochem. 68,459 -486.[CrossRef][Medline]
Katoh, H., Aoki, J., Ichikawa, A. and Negishi, M.
(1998). p160 RhoA-binding kinase ROK
induces neurite
retraction. J. Biol. Chem.
273,2489
-2492.
Katoh, H., Yasui, H., Yamaguchi, Y., Aoki, J., Fujita, H., Mori,
K. and Negishi, M. (2000). Small GTPase RhoG is a key
regulator for neurite outgrowth in PC12 cells. Mol. Cell.
Biol. 20,7378
-7387.
Kjøller, L. and Hall, A. (1999). Signaling to Rho GTPases. Exp. Cell. Res. 253,166 -179.[CrossRef][Medline]
Kloog, Y., Axelrod, J. and Spector, I. (1983). Protein carboxyl methylation increases in parallel with differentiation of neuroblastoma cells. J. Neurochem. 40,522 -529.[CrossRef][Medline]
Kozma, R., Ahmed, S., Best, A. and Lim, L. (1995). The Ras-related protein Cdc42Hs and bradykinin promote formation of peripheral actin microspikes and filopodia in Swiss 3T3 fibroblasts. Mol. Cell. Biol. 15,1942 -1952.[Abstract]
Kozma, R., Sarner, S., Ahmed, S. and Lim, L. (1997). Rho family GTPases and neuronal growth cone remodelling: relationship between increased complexity induced by Cdc42Hs, Rac1, and acetylcholine and collapse induced by RhoA and lysophosphatidic acid. Mol. Cell. Biol. 17,1201 -1211.[Abstract]
Lipman, D. J. and Pearson, W. R. (1985). Rapid
and sensitive protein similarity searches. Science
227,1435
-1441.
Luo, J.-Q., Liu, X., Frankel, P., Rotunda, T., Ramos, M., Flom,
J., Jiang, H., Feig, L. A., Morris, A. J., Kahn, R. A. and Foster, D. A.
(1998). Functional association between Arf and RalA in active
phospholipase D complex. Proc. Natl. Acad. Sci. USA
95,3632
-3637.
Matsumoto, K., Asano, T. and Endo, T. (1997). Novel small GTPase M-Ras participates in reorganization of actin cytoskeleton. Oncogene 15,2409 -2417.[CrossRef][Medline]
McCallum, S. J., Wu, W. J. and Cerione, R. A.
(1996). Identification of a putative effector for Cdc42Hs with
high sequence similariry to the RasGAP-related protein IQGAP1 and a Cdc42Hs
binding partner with IQGAP2. J. Biol. Chem.
271,21732
-21737.
Michaelson, D., Silletti, J., Murphy, G., D'Eustachio, P., Rush,
M. and Philips, M. R. (2001). Differential localization of
Rho GTPases in live cells: regulation by hypervariable regions and RhoGDI
binding. J. Cell Biol.
152,111
-126.
Miki, H., Miura, K. and Takenawa, T. (1996). N-WASP, a novel actin-depolymerizing protein, regulates the cortical cytoskeletal rearrangement in a PIP2-dependent manner downstream of tyrosine kinases. EMBO J. 15,5326 -5335.[Medline]
Miki, H., Sasaki, T., Takai, Y. and Takenawa, T. (1998). Induction of filopodium formation by a WASP-related actin-depolymerizing protein N-WASP. Nature 391, 93-96.[CrossRef][Medline]
Milburn, M. V., Tong, L., deVos, A. M., Brünger, A.,
Yamaizumi, Z., Nishimura, S. and Kim, S.-H. (1990). Molecular
switch for signal transduction: structural differences between active and
inactive forms of protooncogene ras proteins.
Science 247,939
-945.
Murphy, C., Saffrich, R., Grummt, M., Gournier, H., Rybin, V., Rubino, M., Auvinen, P., Lütcke, A., Parton, R. G. and Zerial, M. (1996). Endosome dynamics regulated by a Rho protein. Nature 384,427 -432.[CrossRef][Medline]
Murphy, G. A., Solski, P. A., Jillian, S. A., de la Ossa, P. P., D'Eustachio, P., Der, C. J. and Rush, M. G. (1999). Cellular functions of TC10, a Rho family GTPase: regulation of morphology, signal transduction and cell growth. Oncogene 18,3831 -3845.[CrossRef][Medline]
Neudauer, C. L., Joberty, G., Tatsis, N. and Macara, I. G. (1998). Distinct cellular effects and interactions of the Rho-family GTPase TC10. Curr. Biol. 8,1151 -1160.[CrossRef][Medline]
Neudauer, C. L., Joberty, G. and Macara, I. G. (2001). PIST: a novel PDZ/coiled-coil domain binding partner for the Rho-family GTPase TC10. Biochem. Biophy. Res. Commun. 280,541 -547.[CrossRef][Medline]
Nishiki, T., Narumiya, S., Morii, N., Yamamoto, M., Fujiwara, M., Kamata, Y., Sakaguchi, G. and Kozaki, S. (1990). ADP-ribosylation of the rho/rac proteins induces growth inhibition, neurite outgrowth and acetylcholine esterase in cultured PC-12 cells. Biochem. Biophys. Res. Commun. 167,265 -272.[CrossRef][Medline]
Nobes, C. D. and Hall, A. (1995). Rho, Rac, and Cdc42 GTPases regulate the assembly of multimolecular focal complexes associated with actin stress fibers, lamellipodia, and filopodia. Cell 81,53 -62.[CrossRef][Medline]
Nobes, C. D., Lauritzen, I., Mattei, M.-G., Paris, S., Hall, A.
and Chardin, P. (1998). A new member of the Rho family, Rnd1,
promotes disassembly of actin filament structures and loss of cell adhesion.
J. Cell Biol. 141,187
-197.
Page, R. D. (1996). TreeView: an application to
display phylogenetic trees on personal computers. Comput. Appl.
Biosci. 12,357
-358.
Ralston, E. and Ploug, T. (1996). GLUT4 in cultured skeletal myotubes is segregated from the transferrin receptor and stored in vesicles associated with the TGN. J. Cell Sci. 109,2967 -2978.[Abstract]
Reznikoff, C. A., Brankow, D. W. and Heidelberger, C.
(1973). Establishment and characterization of a cloned line of
C3H mouse embryo cells sensitive to postconfluence inhibition of division.
Cancer Res. 33,3231
-3238.
Ridley, A. J. and Hall, A. (1992). The small GTP-binding protein rho regulates the assembly of focal adhesions and actin stress fibers in response to growth factors. Cell 70,389 -399.[CrossRef][Medline]
Ridley, A. J., Paterson, H. F., Johnston, C. L., Diekmann, D. and Hall, A. (1992). The small GTP-binding protein rac regulates growth factor-induced membrane ruffling. Cell 70,401 -410.[CrossRef][Medline]
Rohatgi, R., Ma, L., Miki, H., Lopez, M., Kirchhausen, T., Takenawa, T. and Kirschner, M. W. (1999). The interaction between N-WASP and the Arp2/3 complex links Cdc42-dependent signals to actin assembly. Cell 97,221 -231.[CrossRef][Medline]
Takenawa, T. and Miki, H. (2001). WASP and WAVE family proteins: key molecules for repid rearrangement of cortical actin filaments and cell movement. J. Cell Sci. 114,1801 -1809.[Abstract]
Tigyi, G. and Miledi, R. (1992).
Lysophosphatidates bound to serum albumin activate membrane currents in
Xenopus oocytes and neurite retraction in PC12 pheochromocytoma
cells. J. Biol. Chem.
267,21360
-21367.
Tsubakimoto, K., Matsumoto, K., Abe, H., Ishii, J., Amano, M., Kaibuchi, K. and Endo, T. (1999). Small GTPase RhoD suppresses cell migration and cytokinesis. Oncogene 18,2431 -2440.[CrossRef][Medline]
Vignal, E., de Toledo, M., Comunale, F., Ladopoulou, A.,
Gauthier-Rouvière, C., Blangy, A. and Fort, P. (2000).
Characterization of TCL, a new GTPase of the Rho family related to TC10 and
Cdc42. J. Biol. Chem.
275,36457
-36464.
Watson, R. T., Shigematsu, S., Chiang, S.-H., Mora, S., Kanzaki,
M., Macara, I. G., Saltiel, A. R. and Pessin, J. E. (2001).
Lipid raft microdomain compartmentalization of TC10 is required for insulin
signaling and GLUT4 translocation. J. Cell Biol.
154,829
-840.
Wu, W.-J., Leonard, D. A., Cerione, R. A. and Manor, D.
(1997). Interaction between Cdc42Hs and RhoGDI is mediated
through the Rho insert region. J. Biol. Chem.
272,26153
-26158.
Yaffe, D. and Saxel, O. (1977). Serial passaging and differentiation of myogenic cells isolated from dystrophic mouse muscle. Nature 270,725 -727.[CrossRef][Medline]
Zhang, F. L. and Casey, P. J. (1996). Protein prenylation: molecular mechanisms and functional consequences. Annu. Rev. Biochem. 65,241 -269.[CrossRef][Medline]
Zohn, I. M., Campbell, S. L., Khosravi-Far, R., Rossman, K. L. and Der, C. J. (1998). Rho family proteins and Ras transformation: the RHOad less traveled gets congested. Oncogene 17,1415 -1438.[CrossRef][Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
M. Coisy-Quivy, O. Touzet, A. Bourret, R. A. Hipskind, J. Mercier, P. Fort, and A. Philips TC10 controls human myofibril organization and is activated by the sarcomeric RhoGEF obscurin J. Cell Sci., April 1, 2009; 122(7): 947 - 956. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Alexander, K. K. M. Chan, A. B. Byrne, G. Selman, T. Lee, J. Ono, E. Wong, R. Puckrin, S. J. Dixon, and P. J. Roy An UNC-40 pathway directs postsynaptic membrane extension in Caenorhabditis elegans Development, March 15, 2009; 136(6): 911 - 922. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. C. Pertz, Y. Wang, F. Yang, W. Wang, L. J. Gay, M. A. Gristenko, T. R. Clauss, D. J. Anderson, T. Liu, K. J. Auberry, et al. Spatial mapping of the neurite and soma proteomes reveals a functional Cdc42/Rac regulatory network PNAS, February 12, 2008; 105(6): 1931 - 1936. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. K. Garvalov, K. C. Flynn, D. Neukirchen, L. Meyn, N. Teusch, X. Wu, C. Brakebusch, J. R. Bamburg, and F. Bradke Cdc42 Regulates Cofilin during the Establishment of Neuronal Polarity J. Neurosci., November 28, 2007; 27(48): 13117 - 13129. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. L. Gupton and F. B. Gertler Filopodia: The Fingers That Do the Walking Sci. Signal., August 21, 2007; 2007(400): re5 - re5. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Pommereit and F. S. Wouters An NGF-induced Exo70-TC10 complex locally antagonises Cdc42-mediated activation of N-WASP to modulate neurite outgrowth J. Cell Sci., August 1, 2007; 120(15): 2694 - 2705. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Yokoyama, K. Takano, A. Yoshida, F. Katada, P. Sun, T. Takenawa, T. Andoh, and T. Endo DA-Raf1, a competent intrinsic dominant-negative antagonist of the Ras-ERK pathway, is required for myogenic differentiation J. Cell Biol., June 21, 2007; 177(5): 781 - 793. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Hajdo-Milasinovic, S. I. J. Ellenbroek, S. van Es, B. van der Vaart, and J. G. Collard Rac1 and Rac3 have opposing functions in cell adhesion and differentiation of neuronal cells J. Cell Sci., February 15, 2007; 120(4): 555 - 566. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Boureux, E. Vignal, S. Faure, and P. Fort Evolution of the Rho Family of Ras-Like GTPases in Eukaryotes Mol. Biol. Evol., January 1, 2007; 24(1): 203 - 216. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Sun, H. Watanabe, K. Takano, T. Yokoyama, J.-i. Fujisawa, and T. Endo Sustained activation of M-Ras induced by nerve growth factor is essential for neuronal differentiation of PC12 cells. Genes Cells, September 1, 2006; 11(9): 1097 - 1113. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Czuchra, X. Wu, H. Meyer, J. van Hengel, T. Schroeder, R. Geffers, K. Rottner, and C. Brakebusch Cdc42 Is Not Essential for Filopodium Formation, Directed Migration, Cell Polarization, and Mitosis in Fibroblastoid Cells Mol. Biol. Cell, October 1, 2005; 16(10): 4473 - 4484. [Abstract] [Full Text] [PDF] |
||||
![]() |
E.-E. Govek, S. E. Newey, and L. Van Aelst The role of the Rho GTPases in neuronal development Genes & Dev., January 1, 2005; 19(1): 1 - 49. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kawamura, K. Takano, S. Suetsugu, S. Kurisu, D. Yamazaki, H. Miki, T. Takenawa, and T. Endo N-WASP and WAVE2 Acting Downstream of Phosphatidylinositol 3-Kinase Are Required for Myogenic Cell Migration Induced by Hepatocyte Growth Factor J. Biol. Chem., December 24, 2004; 279(52): 54862 - 54871. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Gustavsson, M. Yuan, and M. Fallman Temporal Dissection of {beta}1-Integrin Signaling Indicates a Role for p130Cas-Crk in Filopodia Formation J. Biol. Chem., May 28, 2004; 279(22): 22893 - 22901. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. T. Watson, M. Kanzaki, and J. E. Pessin Regulated Membrane Trafficking of the Insulin-Responsive Glucose Transporter 4 in Adipocytes Endocr. Rev., April 1, 2004; 25(2): 177 - 204. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Wennerberg and C. J. Der Rho-family GTPases: it's not only Rac and Rho (and I like it) J. Cell Sci., March 15, 2004; 117(8): 1301 - 1312. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. Pertz and K. M. Hahn Designing biosensors for Rho family proteins -- deciphering the dynamics of Rho family GTPase activation in living cells J. Cell Sci., March 15, 2004; 117(8): 1313 - 1318. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. JeBailey, A. Rudich, X. Huang, C. D. Ciano-Oliveira, A. Kapus, and A. Klip Skeletal Muscle Cells and Adipocytes Differ in Their Reliance on TC10 and Rac for Insulin-Induced Actin Remodeling Mol. Endocrinol., February 1, 2004; 18(2): 359 - 372. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Gasman, S. Chasserot-Golaz, M. Malacombe, M. Way, and M.-F. Bader Regulated Exocytosis in Neuroendocrine Cells: A Role for Subplasmalemmal Cdc42/N-WASP-induced Actin Filaments Mol. Biol. Cell, February 1, 2004; 15(2): 520 - 531. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. de Toledo, F. Senic-Matuglia, J. Salamero, G. Uze, F. Comunale, P. Fort, and A. Blangy The GTP/GDP Cycling of Rho GTPase TCL Is an Essential Regulator of the Early Endocytic Pathway Mol. Biol. Cell, December 1, 2003; 14(12): 4846 - 4856. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||