|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 14 November 2002
doi: 10.1242/jcs.00176
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
1 Departments of Biochemistry and Molecular Biology, and Genetics, University of
Georgia, Life Sciences Building, Athens, GA 30602, USA
2 Department of Biochemistry, Emory University, Atlanta, GA 30322, USA
3 Department of Pharmacology, Center for Cell Signaling, University of Virginia
School of Medicine, Charlottesville, VA 22908, USA
* Author for correspondence (e-mail: mterns{at}bmb.uga.edu)
Accepted 18 September 2002
| Summary |
|---|
|
|
|---|
Key words: Small nucleolar RNA, RanGTP, RNA transport, Nucleolus, tsBN2, Xenopus oocytes, S. cerevisiae
| Introduction |
|---|
|
|
|---|
In addition to its well characterized role in nucleocytoplasmic transport,
there is recent evidence suggesting the direct involvement of Ran in
regulating a variety of other important cellular processes including mitotic
spindle formation (Gruss et al.,
2001
; Kahana and Cleveland,
2001
; Nachury et al.,
2001
), nuclear envelope formation
(Hetzer et al., 2000
;
Hughes et al., 1998
;
Zhang and Clarke, 2001
) and
mitotic cell cycle regulation (Matsumoto
and Beach, 1991
; Quimby et
al., 2000b
; Sazer and Nurse,
1994
). Although Ran shuttles between the nucleus and cytoplasm
(Görlich and Kutay,
1999
), it exhibits a primarily steady-state localization within
the nucleus (Quimby et al.,
2000a
), and evidence is accumulating that Ran is important for
regulating intra-nuclear processes. Some of the evidence suggesting
intra-nuclear roles for the Ran protein stems from analysis of a conditional
mutant in the Ran guanine exchange factor, RCC1
(Ohtsubo et al., 1987
). RCC1
(Regulator of Chromatin Condensation 1) was originally isolated as the
conditional tsBN2 mutant from hamster cells that showed a premature chromatin
condensation phenotype (Dasso,
1993
; Ohtsubo et al.,
1987
). Subsequent biochemical analysis demonstrated that RCC1 is
tightly bound to chromatin and acts as a guanine nucleotide exchange factor
for the Ran GTPase (Bischoff and
Ponstingl, 1991
; Nemergut et
al., 2001
). The chromosome condensation phenotype associated with
the RCC1 mutant suggests a role for Ran in regulating important intra-nuclear
events such as DNA replication and mitosis. Consistent with this idea, several
S. pombe mutants in components of the Ran cycle show clear cell cycle
defects (Fleig et al., 2000
;
Sazer and Nurse, 1994
). These
observations suggest potential functions for Ran in regulating intra-nuclear
processes.
One potential function for Ran within the nucleus could be to regulate
intra-nuclear transport events. In addition to movement between the nucleus
and cytoplasm, there is also macromolecular trafficking that must occur within
the nucleus. RNAs must move from their site of transcription to their site of
action. For most newly synthesized cellular RNAs (e.g. messenger RNAs,
transfer RNAs, ribosomal RNAs) this means that they must be appropriately
targeted from nucleoplasmic genes to nuclear pore complexes for delivery to
the cytoplasm (Carmo-Fonseca et al.,
1999
; Izaurralde and Adam,
1998
; Mattaj and Englmeier,
1998
; Nakielny et al.,
1997
). Many other classes of RNAs will ultimately function within
the nucleus (Terns and Terns,
2002
; Will and Luhrmann,
2001
). Although some of these RNA species (e.g. spliceosomal small
nuclear RNAs) are transported to the cytoplasm for processing and maturation
(Mattaj, 1986
;
Yang et al., 1992
), other RNAs
(e.g. small nucleolar RNAs) exist solely within the nucleus and must be
targeted from their site of transcription to their intra-nuclear site of
action (Terns and Terns,
2002
). Conceivably, RanGTP might be required for this
intra-nuclear transport.
Indeed there is evidence to suggest that Ran plays a role in regulating the
intra-nuclear trafficking of macromolecules. Previous work has shown that the
temperature-sensitive RCC1 mutant, tsBN2, shows a change in the intra-nuclear
localization of both small ribonucleoproteins (snRNPs) and the general
splicing factor SC35 (Cheng et al.,
1995
; Huang et al.,
1997
) following a shift to the non-permissive temperature.
Furthermore, biochemical experiments have implicated RCC1 in the transport of
some but not all RNAs within the nucleus
(Cheng et al., 1995
). Cheng et
al. used pulse/chase experiments to analyze precursor RNAs and to demonstrate
that many of the small RNAs involved in splicing, U1, U2, U4 and U5, are not
properly exported to the cytoplasm when RCC1 is inactivated in tsBN2 cells
(Cheng et al., 1995
). However,
this analysis also suggested a role for nuclear RanGTP in the retention of U3
snoRNA within the nucleus (Cheng et al.,
1995
). When tsBN2 cells were shifted to the non-permissive
temperature to deplete RCC1, the biochemical fractionation properties of U3
snoRNA were altered and U3, which is normally strictly localized to the
nuclear fraction (in nucleoli), could be detected in the cytoplasm. The
appearance of U3 snoRNA in the cytoplasmic fraction was attributed to an
inability of the RNA to be retained within the nucleus by virtue of its
inability to become localized to the nucleolus in the absence of RanGTP
(Cheng et al., 1995
). Thus, it
was proposed that RCC1 (and hence nuclear RanGTP) was essential to localize U3
to the nucleolus.
The goal of the present study was to determine whether Ran is required for
intra-nuclear transport of RNAs and, more specifically, to address whether
nuclear RanGTP is essential for the nucleolar localization of snoRNAs. SnoRNAs
are a large family of cellular RNAs that are synthesized in the nucleoplasm,
actively retained within the nucleus during all steps of maturation and
function and specifically targeted to the nucleolus where they function in
rRNA processing/modification and ribosome biogenesis
(Filipowicz et al., 1999
;
Terns and Terns, 2002
;
Tollervey and Kiss, 1997
;
Weinstein and Steitz, 1999
).
There are two major families of snoRNAs, the box C/D and the box H/ACA
families (Balakin et al., 1996
;
Ganot et al., 1997
). Each
snoRNA family associates with a specific subset of proteins including
fibrillarin, Nop56, Nop58, p15.5kD (Box C/D) or Cbf5p, Gar1, Nhp2, Nop10 (Box
H/ACA) (Terns and Terns,
2002
). Localization of the snoRNAs to the nucleolus requires the
highly conserved box C/D and box H/ACA motif, respectively
(Lange et al., 1998
;
Lange et al., 1999
;
Narayanan et al., 1999a
;
Narayanan et al., 1999b
;
Ruhl et al., 2000
;
Samarsky et al., 1998
). It is
hypothesized that proteins that bind to the motifs are instrumental in
localizing snoRNAs to the nucleolus (Terns
et al., 1995
; Verheggen et
al., 2001
). Although it is clear that nuclear RanGTP is essential
for the assembly of some RNP export complexes within the nucleus
(Arts et al., 1998
;
Dahlberg and Lund, 1998
;
Izaurralde et al., 1995
;
Kutay et al., 1998
), it is not
known whether the intra-nuclear assembly of a snoRNP complex and/or nucleolar
localization of snoRNPs requires nuclear RanGTP. In this study, we have
disrupted the Ran gradient or Ran itself in three different cellular systems
and our results indicate that nuclear RanGTP is not required for nuclear
retention or nucleolar localization of snoRNA.
| Materials and Methods |
|---|
|
|
|---|
Yeast strains and media
All yeast strains were grown in yeast extract peptone dextrose (YEPD)
medium under standard conditions (Adams et
al., 1997
). The relevant genotype for the wild-type strain,
ACY192, is Mata ura3-52, trp1-
63,
leu2-
1. The following temperature-sensitive mutants were
also used: ACY212, Mata GSP1::HIS3 GSP2::HIS3 ura3-52
leu2-
1, trp1-
63 (transformed with a
gsp1-1, LEU, AMP, CEN plasmid (pAC413) or with a gsp1-2, LEU,
AMP, CEN plasmid (pAC414)) (Wong et
al., 1997
); ACY109 Mata prp20-1 trp1
leu2-
1 ura3 (Amberg et
al., 1993
); and ACY61, Mata rna1-1
leu2-
1 ura3-52 his3
(Corbett et al., 1995a
).
Yeast fluorescence in situ hybridization and immunofluorescence
FISH analysis and immunofluorescence in yeast was performed as described
(Amberg et al., 1992
;
Wong et al., 1997
) except that
Cy3-labled DNA probes were used. The anti-sense deoxyoligonucleotide probes
against yeast U3 snoRNA (5'
ATTCAGTGGCTCTTTTGAAGAGTCAAAGAGTGACGATTCCTATAGAAATGA 3'), snR10 snoRNA
(5' CAGACGACAGAAAGACTGTTGCACCCAAGATCGATAAATTTGTTCTCCAGTCC 3') and
poly(A)+ mRNA (oligo d(T)50) were synthesized by Operon Technologies with a
single Cy3 label at the 5' end. Briefly, the strains were grown in YEPD
at room temperature and shifted to 37°C for 3 hours. Formaldehyde-fixed
cells were harvested, spheroplasted with 300 µg of Zymolyase 100T (US
Biological), resuspended in P solution (1.2 M sorbitol in 0.1 M potassium
phosphate buffer, pH 6.5) and applied to 14-well Teflon-faced microscope
slides (CellPoint Scientific, Inc.) precoated with 0.1% polylysine. Following
permeabilization with 0.5% IGEPAL, hybridization was performed using 100-150
ng of Cy3-labeled probe overnight at 37°C. In some experiments, indirect
immunofluorescence was also performed as described previously
(Wong et al., 1997
) using a
1:1000 dilution of anti-Nop1p (A66) monoclonal antibodies
(Aris and Blobel, 1988
) and a
1:50 dilution of Texas-Red-conjugated anti-mouse secondary antibodies (Jackson
Immunoresearch Laboratories). Cells were stained with 1 µg/ml
4,6-diamino-2-phenylindole (DAPI), air dried and mounted in 1 mg
p-phenylene diamine/ml 90% glycerol in 1xPBS.
Xenopus laevis oocyte microinjection and RNA analysis
The nuclear retention and nucleolar localization of microinjected
fluorescently labeled U3 snoRNA or U65 snoRNA was assayed as described
previously (Narayanan et al.,
1999a
; Narayanan et al.,
1999b
; Speckmann et al.,
1999
) in Xenopus oocytes in which the Ran system was
disrupted using Ran T24N. The RNAs for microinjection were transcribed in
vitro with a fluorescein-12-UTP label (for detection by fluorescence
microscopy) and a 32P-GTP label (for detection by gel
electrophoresis and autoradiography). Recombinant T24N mutant Ran was
expressed and purified from E. coli as described previously
(Lounsbury et al., 1996
).
32P labeled, U1sm- snRNA (and U3 snoRNA in
Fig. 5C and D) was coinjected
with the fluorescein-labeled RNAs as controls for RNA nuclear export (or
retention). 40 µmoles of Ran T24N in 10 nl of microinjection buffer (10 mM
NaH2PO4, pH 7.2, 70 mM KCl, 1 mM MgCl2 and 10
mg/ml blue dextran) or 10 nl of microinjection buffer alone were injected into
the nuclei of stage V/VI oocytes. The oocytes were incubated at 18°C for 1
hour before a second nuclear injection containing 1 fmole of
fluorescein/32P-GTP-labeled U3 or U65. For analysis of
intra-nuclear localization, the oocytes were incubated at 18°C, and the
nuclei were dissected four hours after injection of the RNA. The contents of
each dissected nucleus were transferred to a microscope slide. The slides were
centrifuged, fixed, mounted and subjected to fluorescence microscopy as
described (Narayanan et al.,
1999a
; Narayanan et al.,
1999b
). For analysis of nucleocytoplasmic distribution, RNA was
extracted from the nuclear and cytoplasmic fractions from others of the set of
injected oocytes, and the radiolabeled RNAs were detected by 8% denaturing gel
elctrophoresis and autoradiography.
|
Microscopy
Microscopy was performed using a Zeiss Axiovert S 100 inverted fluorescence
microscope equipped with differential interference contrast optics (Thornwood,
NY, USA). Images were acquired using a cooled charge-coupled device camera
(Quantix-Photometrix, AZ, USA) and IP Lab Spectrum software (Signal Analytics,
VA).
| Results |
|---|
|
|
|---|
Mammalian cells
Previous biochemical studies have suggested that a functional Ran guanine
nucleotide exchange factor, RCC1, is required for targeting U3 snoRNA to the
nucleolus (Cheng et al.,
1995
). We examined the subcellular localization of the U3 snoRNA
in tsBN2 cells, which carry a temperature-sensitive allele of RCC1 that
results in rapid depletion of the RCC1 protein soon after shift to the
non-permissive temperature (Nishijima et
al., 2000
; Ohtsubo et al.,
1987
). The U3 snoRNA was detected by fluorescence in situ
hybridization (FISH) with an anti-sense U3 snoRNA probe, which was previously
demonstrated to selectively detect U3 snoRNA
(Michienzi et al., 2000
). As
shown in Fig. 1, U3 snoRNA is
localized to the nucleolus even following a 6 hour shift to the non-permissive
temperature (40°C). To verify that the cells have undergone the
temperature shift, the localization of the trimethyl guanosine cap (TMG), a
marker for the TMG-capped U snRNAs, was also examined. As previously reported,
U snRNA localization shifts from widespread nucleoplasmic staining to less
numerous foci when the RanGTP gradient is disrupted
(Cheng et al., 1995
;
Huang et al., 1997
). These
data suggest that in contrast to previous reports
(Cheng et al., 1995
), the
RanGTP gradient may not be required for localization of snoRNAs to the
nucleolus.
|
The data presented above demonstrate that a functional Ran guanine
nucleotide exchange factor is not required for snoRNA localization in
mammalian (tsBN2) cells. To confirm that the Ran gradient is dispensable for
snoRNA targeting to the nucleolus, it would be valuable to employ conditional
mutants of other components of the Ran system, including Ran itself.
Unfortunately, there are no other mammalian cell lines containing conditional
mutants of Ran components. There are, however, numerous conditional mutants
available in the budding yeast, S. cerevisiae
(Corbett and Silver, 1997
;
Damelin et al., 2002
).
S. cerevisiae
For our studies in S. cerevisiae, we developed a protocol to
detect snoRNAs using two specific anti-sense probes that recognize snoRNAs
(see Materials and Methods). One detects U3 (a box C/D snoRNA) and the other
detects snR10 (a box H/ACA snoRNA). Fluorescence in situ hybridization (FISH)
was carried out as described in Materials and Methods. Results of this control
experiment are shown in Fig. 2.
Fig. 2A shows the intracellular
localization of U3 and snR10 snoRNAs in wild-type cells. Cells were co-stained
with the chromatin staining dye, DAPI, to demonstrate that the signal observed
is adjacent to but not coincident with the chromatin staining (see merge
panels). To confirm that the snoRNA signal is within the nucleolus, we also
co-stained cells with an antibody directed against the nucleolar protein Nop1p
(yeast fibrillarin) (Aris and Blobel,
1988
; Henriquez et al.,
1990
). As shown in Fig.
2B, the signal for U3 snoRNA (green) clearly overlaps with the
Nop1p signal (red) as indicated by the yellow in the merged image. No signal
was detected when snoRNA probes were omitted from experiments or when sense
probes were used (data not shown). These data clearly demonstrate that we can
detect the nucleolar localization of at least two snoRNAs in wild-type S.
cerevisiae cells.
|
To address whether Ran function or the Ran gradient is required for snoRNA
localization in S. cerevisiae, we examined the targeting of snoRNAs
to the nucleolus in several yeast mutants that are known the perturb the Ran
gradient. As a control we also examined the localization of poly(A)+ RNA in
these cells since many studies have demonstrated that export of poly(A)+ RNA
from the nucleus is blocked when the Ran gradient is disrupted
(Saavedra et al., 1996
;
Wong et al., 1997
).
We first examined the localization of U3 and snR10 in rna1-1
mutant cells. The RNA1 gene encodes the yeast Ran GTPase activating
protein or RanGAP, which is required for GTP hydrolysis by Ran
(Becker et al., 1995
), and thus
maintenance of the RanGTP gradient. The rna1-1 mutant is a well
characterized temperature-sensitive allele of RNA1
(Hopper et al., 1990
). The
rna1-1 mutant cells were grown at the permissive temperature
(25°C), the culture was split, and half the cells were shifted to the
non-permissive temperature (37°C) whereas the other half was retained at
25°C. FISH was performed following a 3 hour shift to the non-permissive
temperature.
Fig. 3A shows the
localization of U3 snoRNA, snR10 snoRNA and poly(A)+ RNA in rna1-1
cells at the permissive and non-permissive temperatures. The localization of
the snoRNAs is somewhat punctate at the non-permissive temperature, which is
consistent with previous reports that the nucleolus fragments when the RanGTP
gradient is disrupted in S. cerevisiae
(Saavedra et al., 1996
;
Wong et al., 1997
). This
suggests that, despite the nucleolar fragmentation, the snoRNAs are still
associated with the nucleolus in the rna1-1 mutant. As expected when
the Ran gradient is disrupted, there is a clear accumulation of poly(A)+ RNA
within the nucleus of rna1-1 cells
(Corbett et al., 1995b
).
|
To confirm that the fragmented signal observed for the snoRNAs at the
non-permissive temperature is coincident with the nucleolar fragments, we took
advantage of previous work, which demonstrated that the nucleolar
fragmentation phenomenon is dependent on ongoing RNA polymerase II
transcription (Kadowaki et al.,
1994
). We combined the rna1-1 mutation with a mutation in
RNA polymerase II, rbp1-1, which rapidly shuts down poly(A)+ RNA
synthesis at 37°C (Nonet et al.,
1987
). Previous work has shown that the nucleolus no longer
fragments when mutants that disrupt the Ran gradient are combined with the
rbp1-1 mutant (Kadowaki et al.,
1994
; Nonet et al.,
1987
). Fig. 3B
shows the localization of U3, snR10, and poly(A)+ RNA in the rna1-1
rbp1-1 double mutant cells. In these cells, the nucleolar fragmentation
is virtually eliminated and the localization of both snoRNAs to the nucleolus
is clear. Consistent with a decrease in poly(A)+ RNA synthesis, very little
signal is detected with the oligo dT probe. Taken together, these data
strongly suggest that the RanGTP gradient in S. cerevisiae is not
required for nucleolar localization of snoRNAs.
To further assess the role of Ran in snoRNA localization, we took advantage
of mutations in the yeast Ran protein, Gsp1p. Two different conditional Gsp1p
mutants were used for these experiments, gsp1-1 and gsp1-2
(Wong et al., 1997
). Results
in Fig. 4A show the
localization of U3, snR10, and poly(A)+ RNA in gsp1-1 cells. As
observed with the rna1-1 mutant, the snoRNAs are localized to
punctate intra-nuclear sites, and poly(A)+ RNA accumulates in the nucleus at
the non-permissive temperature. To once again confirm that these punctate
signals represent fragmentation of the nucleolus, the gsp1-1 rbp1-1
double mutant was constructed. As shown in
Fig. 4B, this eliminated the
fragmentation of the snoRNA signal. Localization of U3 and snR10 snoRNAs to
nucleoli was also unaffected in strains harboring a different
temperature-sensitive allele of Ran (gsp1-2)
(Wong et al., 1997
) or
containing a temperature-sensitive allele (prp20-1)
(Aebi et al., 1990
;
Amberg et al., 1993
) of the Ran
guanine nucleotide exchange factor (data not shown). Taken together, these
results strongly suggest that neither the Ran gradient nor the Ran protein
itself is required for correct nucleolar localization of snoRNAs.
|
Xenopus oocytes
Although in both the conditional mutant mammalian and yeast systems used
above, the temperature shift was clearly sufficient to alter the intracellular
localization of an RNA species (U snRNA in the tsBN2 cells and poly(A)+ RNA in
the yeast), it is conceivable that mislocalized snoRNAs would not be readily
detected in a background of snoRNAs that had achieved correct localization
prior to the temperature shift period. Furthermore, although it is possible
that the pool of newly synthesized snoRNAs could be reduced in these mutants,
it is known that nascent U3 snoRNA levels are not affected in tsBN2 cells
during the temperature shift (Cheng et
al., 1995
). Moreover, our experiments with the yeast and tsBN2
cells indicate that disruption of the Ran system does not significantly affect
the retention of the RNA in the nucleolus.
To directly examine the trafficking and nucleolar targeting of a specific
pool of snoRNAs, we took advantage of the Xenopus oocyte system,
which permits analysis of retention of newly injected snoRNAs within the
nucleus as well as their nucleolar localization. To disrupt the RanGTP
gradient in the Xenopus oocyte, we used a well characterized
dominant-negative Ran mutant, T24N Ran
(Lounsbury et al., 1996
;
Palacios et al., 1996
). The
T24N Ran is a mutant form of the Ran protein that is locked in the GDP-bound
form (Carey et al., 1996
;
Palacios et al., 1996
). The
T24N Ran mutant protein also sequesters cellular RCC1 (RanGEF)
(Lounsbury et al., 1996
).
Thus, when T24N Ran is injected into the nucleus, RCC1 becomes unavailable to
replenish RanGTP in the nucleus and overall, nuclear RanGTP levels decrease
and RanGDP levels increase (Lounsbury et
al., 1996
).
For this experiment, recombinant T24N Ran protein was microinjected into
Xenopus oocyte nuclei and was followed an hour later by injection of
fluorescently and 32P-labeled U3 Box C/D snoRNA
(Fig. 5A) or U65 Box H/ACA
snoRNA (Fig. 5C) RNAs. As a
control to confirm that nuclear RanGTP levels were indeed disrupted and U
snRNA export was blocked as previously reported
(Izaurralde et al., 1997
),
32P-labeled U1sm- snRNA was co-injected with the
snoRNAs. When T24N Ran was pre-injected into the nucleus, export of
co-injected U1sm- snRNA from the nucleus was completely blocked,
similar to results reported earlier
(Izaurralde et al., 1997
). As
expected, export of U1sm- was unaffected in control (mock-injected)
oocytes (Fig. 5B,D, compare
lane 3 with 6). Under nuclear RanGTP-depleted conditions, fluorescently
labeled U3 and U65 snoRNAs were transported and localized to nucleoli
(Fig. 5A,C, panels U3+T24N and
U65+T24N). The nucleolar structure appeared normal when nuclear RanGTP levels
were disrupted and was comparable to the morphology of the nucleoli in cells
that were not pre-injected with T24N Ran. In addition, the stability and
nuclear retention of U3 and U65 remained unaffected by injection of T24N
(Fig. 5B,D, compare lanes 2 and
5). Taken together, these results suggest that in Xenopus oocytes
RanGTP is not required to retain Box C/D and Box H/ACA snoRNAs in the nucleus
or to localize the snoRNAs to nucleoli.
| Discussion |
|---|
|
|
|---|
A previous study indicated that Ran GTP was required for the nuclear
retention and perhaps nucleolar localization of U3 snoRNA in tsBN2 cells
(Cheng et al., 1995
). Cheng et
al. reported a significant portion of newly synthesized U3 snoRNA in a
cytoplasmic fraction of tsBN2 cells at the non-permissive temperature, whereas
essentially all U3 was observed in the nuclear fraction of cells cultured at
the permissive temperature. The model proposed by Cheng et al. to explain the
appearance of U3 snoRNA in the cytoplasmic fraction of tsBN2 cells at the
non-permissive temperature is that loss of RCC1 (and nuclear RanGTP) prevents
the nucleolar localization of U3 and results in mislocalization of U3 to the
cytoplasm (Cheng et al.,
1995
). We have examined the subcellular localization of U3 snoRNA
by fluorescence in situ hybridization in intact tsBN2 cells. Our studies did
not reveal the presence of U3 snoRNA in the cytoplasm (or a noticeable
decrease in U3 snoRNA in nucleoli) within the interphase tsBN2 cells (or
S. cerevisiae) examined at the non-permissive temperature (Figs
1,
3 and
4). This suggests that
retention of snoRNAs within nuclei and nucleoli does not depend on nuclear
RanGTP. Although we cannot strictly rule out the possibility that the
population of U3 snoRNA that was synthesized during the temperature shift was
mislocalized and not localized by FISH, our results in Xenopus
oocytes argue that RanGTP is not required for the nuclear retention or
nucleolar localization of a population of newly injected Box C/D or Box H/ACA
snoRNAs. The results of Cheng et al. could be explained if depletion of RanGTP
affects nuclear structure in a manner that leads to alteration of biochemical
fractionation properties of U3 snoRNA. In addition, U3 might appear in a
`cytoplasmic' fraction derived from a population of cells that includes
increased numbers of mitotic cells resulting from RCC1 depletion in the tsBN2
cells (Nishimoto et al.,
1978
).
In S. cerevisiae, we also observed proper nucleolar localization of snoRNAs following RanGEF depletion in (data not shown). Indeed, the nucleolar localization of snoRNAs went unperturbed in yeast strains carrying a conditional allele of another key component of the Ran cycle, RanGAP (Fig. 2) as well as Ran itself (Fig. 3). These findings also strongly argue against an essential role for Ran in the nucleolar localization of snoRNAs.
Although the experiments that we have performed in the mammalian and yeast cells show that an intact Ran gradient is not required for the steady-state nucleolar localization of snoRNAs, the Xenopus oocyte microinjection experiments extended these observations by enabling the characterization of a single population of snoRNA molecules. Importantly, our findings in the oocyte system show that snoRNA targeting to the nucleolus per se proceeds even when RanGTP is depleted. Both the nuclear retention and nucleolar targeting of snoRNAs remain unaffected under conditions that fully block the export of co-injected control U1 snRNA (Fig. 4). Though it is possible that low levels of nuclear RanGTP are sufficient to localize snoRNAs to nucleoli, our control experiments [reorganization of TMG capped U snRNA (Fig. 1), block of mRNA export in yeast cells (Figs 2 and 3) and block of snRNA export in Xenopus oocytes (Fig. 4)] indicate that severe or total disruption of the RanGTP cycle was achieved.
In the case of nuclear export of most cellular RNAs, nuclear RanGTP has
been shown to be essential for the assembly of an export complex that
subsequently translocates through nuclear pore complexes at the nuclear
envelope (Dahlberg and Lund,
1998
). Our data suggest that Ran binding is not involved in the
assembly and nucleolar targeting of snoRNPs (complexes of snoRNAs and snoRNA
binding proteins). The nucleolus is not a membrane-bound structure and there
is no known physical barrier for entry into this organelle. Transport of the
assembled snoRNPs to nucleoli may occur by simple diffusion or be facilitated
by extrinsic factors other than Ran. Conceivably, appropriate snoRNP assembly
may be the most crucial requirement for the transport and localization of
snoRNPs to the nucleolus. Interaction of specific components of the snoRNPs
with components of the nucleolus may serve to trap and retain the snoRNPs
within the nucleolus, the functional destination of most snoRNPs.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Adams, A., Gottschling, D. E., Kaiser, C. A. and Stearns, T. (1997). Methods in Yeast Genetics. Cold Spring Harbor: Cold Spring Harbor Laboratory Press.
Aebi, M., Clark, M. W., Vijayraghavan, U. and Abelson, J. (1990). A yeast mutant, PRP20, altered in mRNA metabolism and maintenance of the nuclear structure, is defective in a gene homologous to the human gene RCC1 which is involved in the control of chromosome condensation. Mol. Gen. Genet. 224, 72-80.[CrossRef][Medline]
Amberg, D. C., Goldstein, A. L. and Cole, C. N.
(1992). Isolation and characterization of RAT1: An
essential gene of Saccharomyces cerevisiae required for the efficient
nucleocytoplasmic trafficking of mRNA. Genes Dev.
6,1173
-1189.
Amberg, D. C., Fleischmann, M., Stagljar, I., Cole, C. N. and Aebi, M. (1993). Nuclear PRP20 protein is required for mRNA export. EMBO J. 12,233 -241.[Medline]
Aris, J. P. and Blobel, G. (1988).
Identification and characterization of a yeast nucleolar protein that is
similar to a rat liver nucleolar protein. J. Cell
Biol. 107,17
-31.
Arts, G. J., Fornerod, M. and Mattaj, I. W. (1998). Identification of a nuclear export receptor for tRNA. Curr. Biol. 12,305 -314.
Azuma, Y. and Dasso, M. (2000). The role of Ran in nuclear function. Curr. Opin. Cell Biol. 12,302 -307.[CrossRef][Medline]
Balakin, A., Smith, L. and Fournier, M. (1996). The RNA world of the nucleolus: two major families of small RNAs defined by different box elements with related functions. Cell 86,823 -834.[CrossRef][Medline]
Becker, J., Melchior, F., Gerke, V., Bischoff, F. R., Ponstigl,
H. and Wittinghoffer, A. (1995). RNA1 encodes a
GTPase-activating protein specific for Gsp1p, the Ran/TC4 homologue of
Saccharomyces cerevisiae. J. Biol. Chem.
270,11860
-11865.
Bischoff, F. R. and Ponstingl, H. (1991). Catalysis of guanine nucleotide exchange on Ran by the mitotic regulator RCC1. Nature 354,80 -82.[CrossRef][Medline]
Bischoff, F. R., Klebe, C., Kretschmer, J., Wittinghofer, A. and
Ponstingl, H. (1994). RanGAP1 induces GTPase activity of
nuclear Ras-related Ran. Proc. Natl. Acad. Sci. USA
91,2587
-2591.
Bringmann, P., Rinke, J., Appel, B., Reuter, R. and Luhrmann, R. (1983). Purification of snRNPs U1, U2, U4, U5 and U6 with 2,2,7-trimethylguanosine-specific antibody and definition of their constituent proteins reacting with anti-Sm and anti-(U1)RNP antisera. EMBO J. 2,1129 -1135.[Medline]
Carey, K. L., Richards, S. A., Lounsbury, K. M. and Macara, I.
G. (1996). Evidence using a green fluorescent
protein-glucocorticoid receptor chimera that the RAN/TC4 GTPase mediates an
essential function independent of nuclear protein import. J. Cell
Biol. 133,985
-996.
Carmo-Fonseca, M., Custodio, N. and Calado, A. (1999). Intranuclear trafficking of messenger RNA. Crit. Rev. Eukaryot. Gene Expr. 9, 213-219.[Medline]
Chavrier, P. and Goud, B. (1999). The role of ARF and Rab GTPases in membrane transport. Curr. Opin. Cell Biol. 11,466 -475.[CrossRef][Medline]
Cheng, Y., Dahlberg, J. E. and Lund, E. (1995).
Diverse effects of the guanine nucleotide exchange factor RCC1 on RNA
transport. Science 267,1807
-1810.
Clarke, P. R. and Zhang, C. (2001). Ran GTPase: a master regulator of nuclear structure and function during the eukaryotic cell division cycle? Trends Cell Biol. 11,366 -371.[CrossRef][Medline]
Corbett, A. H., Koepp, D. M., Lee, M. S., Schlenstedt, G.,
Hopper, A. K. and Silver, P. A. (1995a). Rna1p, a Ran/TC4
GTPase activating protein is required for nuclear import. J. Cell
Biol. 130,1017
-1026.
Corbett, A. H., Koepp, D. M., Schlenstedt, G., Lee, M. S.,
Hopper, A. K. and Silver, P. A. (1995b). Rna1p, a Ran/TC4
GTPase activating protein is required for nuclear import. J. Cell
Biol. 130,1017
-1026.
Corbett, A. H. and Silver, P. A. (1997). Nucleocytoplasmic transport of macromolecules. Microbiol. Mol. Biol. Rev. 61,193 -211.[Abstract]
Dahlberg, J. E. and Lund, E. (1998). Functions of the GTPase Ran in RNA export from the nucleus. Curr. Opin. Cell Biol. 10,400 -408.[CrossRef][Medline]
Damelin, M., Silver, P. A. and Corbett, A. H. (2002). Nuclear protein transport. Meth. Enzmol. 351,587 -607.
Dasso, M. (1993). RCC1 in the cell cycle: The regulator of chromosome condensation takes on new roles. Trends Biol. Sci. 13,96 -101.
Dasso, M. (2001). Running on Ran: nuclear transport and the mitotic spindle. Cell 104,321 -324.[CrossRef][Medline]
Filipowicz, W., Pelczar, P., Pogacic, V. and Dragon, F. (1999). Structure and biogenesis of small nucleolar RNAs acting as guides for ribosomal RNA modification. Acta Biochim Pol 46,377 -389.[Medline]
Fleig, U., Salus, S. S., Karig, I. and Sazer, S.
(2000). The fission yeast ran GTPase is required for microtubule
integrity. J. Cell Biol.
151,1101
-1112.
Ganot, P., Bortolin, M. L. and Kiss, T. (1997). Site-specific pseudouridine formation in preribosomal RNA is guided by small nucleolar RNAs. Cell 89,799 -809.[CrossRef][Medline]
Görlich, D. and Kutay, U. (1999). Transport between the cell nucleus and the cytoplasm. Annu. Rev. Cell Dev. Biol. 15,607 -660.[CrossRef][Medline]
Gruss, O. J., Carazo-Salas, R. E., Schatz, C. A., Guarguaglini, G., Kast, J., Wilm, M., le Bot, N., Vernos, I., Karsenti, E. and Mattaj, I. W. (2001). Ran induces spindle assembly by reversing the inhibitory effect of importin alpha on TPX2 activity. Cell 104,83 -93.[CrossRef][Medline]
Henriquez, R., Blobel, G. and Aris, J. P.
(1990). Isolation and sequencing of NOP1. A yeast gene encoding a
nucleolar protein homologous to a human autoimmune antigen. J.
Biol. Chem. 265,2209
-2215.
Hetzer, M., Bilbao-Cortes, D., Walther, T. C., Gruss, O. J. and Mattaj, I. W. (2000). GTP hydrolysis by Ran is required for nuclear envelope assembly. Mol. Cell 5,1013 -1024.[CrossRef][Medline]
Hopper, A. K., Traglia, H. M. and Dunst, R. W.
(1990). The yeast RNA1 gene product necessary for RNA
processing is located in the cytosol and apparently excluded from the nucleus.
J. Cell Biol. 111,309
-321.
Huang, S., Mayeda, A., Krainer, A. R. and Spector, D. L. (1997). RCC1 and nuclear organization. Mol. Biol. Cell 8,1143 -1157.[Abstract]
Hughes, M., Zhang, C., Avis, J. M., Hutchison, C. J. and Clarke, P. R. (1998). The role of the ran GTPase in nuclear assembly and DNA replication: characterisation of the effects of Ran mutants. J. Cell Sci. 111,3017 -3026.[Abstract]
Izaurralde, E. and Adam, S. (1998). Transport of macromolecules between the nucleus and the cytoplasm. RNA 4,351 -364.[Abstract]
Izaurralde, E., Lewis, J., Gamberi, C., Jarmalowski, A., McGuigan, C. and Mattaj, I. W. (1995). A cap-binding protein complex mediating U snRNA export. Nature 376,709 -712.[CrossRef][Medline]
Izaurralde, E., Kutay, U., vonKobbe, C., Mattaj, I. W. and Görlich, D. (1997). The assymetric distribution of the constituents of the Ran system is essential for transport into and out of the nucleus. EMBO J. 16,6535 -6547.[CrossRef][Medline]
Kadowaki, T., Hitomi, M., Chen, S. and Tartakoff, A. M. (1994). Nuclear mRNA accumulation causes nucleolar fragmentation in yeast mtr2 mutant. Mol. Biol. Cell 5,1253 -1263.[Abstract]
Kahana, J. A. and Cleveland, D. W. (1999).
Beyond nuclear transport. Ran-GTP as a determinant of spindle assembly.
J. Cell Biol. 146,1205
-1210.
Kahana, J. A. and Cleveland, D. W. (2001). Cell
cycle. Some importin news about spindle assembly.
Science 291,1718
-1719.
Kuersten, S., Ohno, M. and Mattaj, I. W. (2001). Nucleocytoplasmic transport: Ran, beta and beyond. Trends Cell Biol. 11,497 -503.[CrossRef][Medline]
Kutay, U., Lipowsky, G., Izaurralde, E., Bischoff, F. R., Schwarzmaier, P., Hartmann, E. and Görlich, D. (1998). Identification of a tRNA-specific nuclear export receptor. Mol. Cell 1,359 -369.[CrossRef][Medline]
Lange, T. S., Borovjagin, A., Maxwell, E. S. and Gerbi, S. A. (1998). Conserved boxes C and D are essential nucleolar localization elements of U14 and U8 snoRNAs. EMBO J. 17,3176 -3187.[CrossRef][Medline]
Lange, T. S., Ezrokhi, M., Amaldi, F. and Gerbi, S. A.
(1999). Box H and box ACA are nucleolar localization elements of
U17 small nucleolar RNA. Mol. Biol. Cell
10,3877
-3890.
Lounsbury, K. M., Richards, S. A., Carey, K. L. and Macara, I.
G. (1996). Mutations within the Ran/TC4 GTPase: effects on
regulatory factor interactions and subcellular localization. J.
Biol. Chem. 271,32834
-32841.
Matsumoto, T. and Beach, R. (1991). Premature initiation of mitosis in yeast lacking RCC1 or an interacting GTPase. Cell 66,347 -360.[CrossRef][Medline]
Mattaj, I. W. (1986). Cap trimethylation of U snRNA is cytoplasmic and dependent on U snRNP protein binding. Cell 46,905 -911.[CrossRef][Medline]
Mattaj, I. W. and Englmeier, L. (1998). Nucleocytoplasmic transport: the soluble phase. Annu. Rev. Biochem. 67,265 -306.[CrossRef][Medline]
Michienzi, A., Cagnon, L., Bahner, I. and Rossi, J. J.
(2000). Ribozyme-mediated inhibition of HIV 1 suggests nucleolar
trafficking of HIV-1 RNA. Proc. Natl. Acad. Sci. USA
97,8955
-8960.
Nachury, M. V., Maresca, T. J., Salmon, W. C., Waterman-Storer, C. M., Heald, R. and Weis, K. (2001). Importin beta is a mitotic target of the small GTPase Ran in spindle assembly. Cell 104,95 -106.[CrossRef][Medline]
Nakielny, S., Fischer, U., Michael, W. M. and Dreyfuss, G. (1997). RNA transport. Annu. Rev. Neurosci. 20,269 -301.[CrossRef][Medline]
Narayanan, A., Lukowiak, A., Jady, B. E., Dragon, F., Kiss, T., Terns, R. M. and Terns, M. P. (1999a). Nucleolar localization signals of box H/ACA small nucleolar RNAs. EMBO J. 18,5120 -5130.[CrossRef][Medline]
Narayanan, A., Speckmann, W., Terns, R. and Terns, M.
(1999b). Role of the box C/D motif in the localization of small
nucleolar RNAs to nucleoli and coiled bodies. Mol. Biol.
Cell 10,2131
-2147.
Nemergut, M. E., Mizzen, C. A., Stukenberg, T., Allis, C. D. and
Macara, I. G. (2001). Chromatin docking and exchange activity
enhancement of rcc1 by histones h2a and h2b. Science
292,1540
-1543.
Nishijima, H., Seki, T., Nishitani, H. and Nishimoto, T. (2000). Premature chromatin condensation caused by loss of RCC1. Prog. Cell Cycle Res. 4,145 -156.[Medline]
Nishimoto, T., Eilen, E. and Basilico, C. (1978). Premature chromosome condensation in a tsDNA- mutant od BHK cells. Cell 15,475 -483.[CrossRef][Medline]
Nonet, M., Scafe, C., Sexton, J. and Young, R.
(1987). Eucaryotic RNA polymerase conditional mutant that rapidly
ceases mRNA synthesis. Mol. Cell Biol.
7,1602
-1611.
Ohtsubo, M., Kai, R., Furuno, N., Sekiguchi, T., Havashida, H.,
Kuma, K., Miyata, T., Fukushige, S., Murotu, T., Matsubara, K. et al.
(1987). Isolation and characterization of the active cDNA of the
human cell cycle gene (RCC1) involved in the regulation of onset of chromosome
condensation. Genes Dev.
1, 585-593.
Palacios, I., Weis, K., Klebe, C., Mattaj, I. W. and Dingwall,
C. (1996). RAN/TC4 mutants identify a common requirement for
snRNP and protein import into the nucleus. J. Cell
Biol. 133,485
-494.
Quimby, B. B., Lamtina, T., L'Hernault, S. and Corbett, A.
H. (2000a). The Mechanism of Ran import into the nucleus by
NTF2. J. Biol. Chem.
275,28575
-28582.
Quimby, B. B., Wilson, C. A. and Corbett, A. H.
(2000b). The interaction between Ran and NTF2 is required for
cell cycle progression. Mol. Biol. Cell
11,2617
-2629.
Rexach, M. and Blobel, G. (1995). Protein import into the nuclei: Association and dissociation reactions involving transport substrate, transport factors, and nucleoporins. Cell 83,683 -692.[CrossRef][Medline]
Ruhl, D. D., Pusateri, M. E. and Eliceiri, G. L. (2000). Multiple conserved segments of E1 small nucleolar RNA are involved in the formation of a ribonucleoprotein particle in frog oocytes. Biochem. J. 348,517 -524.[CrossRef][Medline]
Saavedra, C., Tung, K.-S., Amberg, D. C., Hopper, A. K. and
Cole, C. N. (1996). Regulation of mRNA export in response to
stress in Saccharomyces cerevisiae. Genes Dev.
10,1608
-1620.
Samarsky, D. A., Fournier, M. J., Singer, R. H. and Bertrand, E. (1998). The snoRNA box C/D motif directs nucleolar targeting and also couples snoRNA synthesis and localization. EMBO J. 17,3747 -3757.[CrossRef][Medline]
Sazer, S. and Nurse, P. (1994). A fission yeast RCC1-related protein is required for the mitosis to interphase transition. EMBO J. 13,606 -615.[Medline]
Speckmann, W., Narayanan, A., Terns, R. and Terns, M. P.
(1999). Nuclear retention elements of U3 small nucleolar RNA.
Mol. Cell. Biol. 19,8412
-8421.
Takai, Y., Sasaki, T. and Matozaki, T. (2001).
Small GTP-binding proteins. Physiol. Rev.
81,153
-208.
Terns, M. P. and Terns, R. M. (2002). Small nucleolar RNAs: versatile transacting molecules of ancient evolutionary origin. Gene Expr. 10,17 -39.[Medline]
Terns, M. P., Grimm, C., Lund, E. and Dahlberg, J. E. (1995). A common maturation pathway for small nucleolar RNAs. EMBO J. 14,4860 -4871.[Medline]
Tollervey, D. and Kiss, T. (1997). Function and synthesis of small nucleolar RNAs. Curr. Opin. Cell Biol. 9,337 -342.[CrossRef][Medline]
Verheggen, C., Mouaikel, J., Thiry, M., Blanchard, J. M., Tollervey, D., Bordonne, R., Lafontaine, L. J. and Bertrand, E. (2001). Box C/D small nucleolar RNA trafficking involves small nucleolar RNP proteins, nucleolar factors, and a novel nuclear domain. EMBO J. 20,5480 -5490.[CrossRef][Medline]
Weinstein, L. B. and Steitz, J. A. (1999). Guided tours: from precursor snoRNA to functional snoRNP. Curr. Opin. Cell Biol. 11,378 -384.[CrossRef][Medline]
Will, C. L. and Luhrmann, R. (2001). Spliceosomal UsnRNP biogenesis, structure and function. Curr. Opin. Cell Biol. 13,290 -301.[CrossRef][Medline]
Wong, D. H., Corbett, A. H., Kent, H. M., Stewart, M. and Silver, P. A. (1997). Interaction between the small GTPase Ran/Gsp1p and Ntf2p is required for nuclear transport. Molec. Cell. Biol. 17,3755 -3767.[Abstract]
Yang, H., Moss, M. L., Lund, E. and Dahlberg, J. E.
(1992). Nuclear processing of the 3'-terminal nucleotides
of pre-U1 RNA in Xenopus laevis oocytes. Mol. Cell.
Biol. 12,1553
-1560.
Zhang, C. and Clarke, P. R. (2001). Roles of Ran-GTP and Ran-GDP in precursor vesicle recruitment and fusion during nuclear envelope assembly in a human cell-free system. Curr. Biol. 11,208 -212.[CrossRef][Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
A. Simoes-Barbosa, C. Louly, O. L. Franco, M. A. Rubio, J. D. Alfonzo, and P. J. Johnson The divergent eukaryote Trichomonas vaginalis has an m7G cap methyltransferase capable of a single N2 methylation Nucleic Acids Res., December 1, 2008; 36(21): 6848 - 6858. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. Simoes-Barbosa, D. Meloni, J. A. Wohlschlegel, M. M. Konarska, and P. J. Johnson Spliceosomal snRNAs in the unicellular eukaryote Trichomonas vaginalis are structurally conserved but lack a 5'-cap structure RNA, August 1, 2008; 14(8): 1617 - 1631. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. Qiu, J. Eifert, L. Wacheul, M. Thiry, A. C. Berger, J. Jakovljevic, J. L. Woolford Jr., A. H. Corbett, D. L. J. Lafontaine, R. M. Terns, et al. Identification of Genes That Function in the Biogenesis and Localization of Small Nucleolar RNAs in Saccharomyces cerevisiae Mol. Cell. Biol., June 1, 2008; 28(11): 3686 - 3699. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Kopp, J. Z. Gasiorowski, D. Chen, R. Gilmore, J. T. Norton, C. Wang, D. J. Leary, E.K.L. Chan, D. A. Dean, and S. Huang Pol I Transcription and Pre-rRNA Processing Are Coordinated in a Transcription-dependent Manner in Mammalian Cells Mol. Biol. Cell, February 1, 2007; 18(2): 394 - 403. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. BALUSKA, D. VOLKMANN, and P. W. BARLOW Eukaryotic Cells and their Cell Bodies: Cell Theory Revised Ann. Bot., July 1, 2004; 94(1): 9 - 32. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. J. Leary, M. P. Terns, and S. Huang Components of U3 snoRNA-containing Complexes Shuttle between Nuclei and the Cytoplasm and Differentially Localize in Nucleoli: Implications for Assembly and Function Mol. Biol. Cell, January 1, 2004; 15(1): 281 - 293. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||