|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 14 November 2002
doi: 10.1242/jcs.00190
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |

1 Unité de Biologie Cellulaire du Parasitisme, INSERM U389, Institut
Pasteur, 28 rue du Dr Roux, 75724 Paris Cedex 15, France
2 Unité d'Analyse d'Images Quantitative, Institut Pasteur, 25 rue du Dr
Roux, 75724 Paris Cedex 15, France
Present address: Gene expression program, EMBL Heidelberg, Meyerhofstrasse 1,
D-69117 Heidelberg, Germany
* Author for correspondence (e-mail: elabruye{at}pasteur.fr)
Accepted 25 September 2002
| Summary |
|---|
|
|
|---|
Key words: Amoebiasis, Pseudopod, Serine/threonine kinase, Quantitative imaging, Rac
| Introduction |
|---|
|
|
|---|
A highly motile amoeba, the pathogenic protozoan parasite Entamoeba
histolytica, is the causative agent of human amoebiasis, a wide spread
infectious disease whereby the amoeba invade and destroy human intestine and
liver. The motility of this parasite is critical for its pathogenicity, which
is reflected by tissue invasion, dissemination and development of acute
disease. Motile E. histolytica trophozoites are polarised with an
anterior extended pseudopodia and a posterior appendage called uroid, which is
composed of accumulated membrane (for a review, see
Guillén, 1996
). In
E. histolytica, signal transduction mechanisms enhanced by external
stimulation result in reorganisation of the actin cytoskeleton
(Meza, 2000
).
Erythrophagocytosis, a pathogenic marker of E. histolytica, requires
pseudopodia extensions and is dependent on the actin-myosin cytoskeleton
dynamic (Voigt and Guillén,
1999
). Proteins related to actin cytoskeleton dynamics such as
tyrosine or serine/threonine kinases or small GTPases from the Rac and Rho
subfamilies (Guillén et al.,
1998
; Lohia and Samuelson,
1993
; Que et al.,
1993
) have been identified in E. histolytica. A Rac
protein, Rac G, has been shown to be involved in the signal transduction
pathway controlling capping of surface receptors and uroid formation, as well
as in distribution of F-actin, parasite polarity and cytokinesis
(Guillén et al., 1998
).
A gene encoding a polypeptide, named EhPAK, that shares homology with the
murine p21-activated kinase and the yeast Ste20 was also described
(Gangopadhyay et al., 1997
).
Given the lack of knowledge of transduction pathways leading to cell
polarization, motility and phagocytosis in E. hitolytica, we decided
to investigate EhPAK with regard to its potential role in these processes by
biochemical and cell biology approaches. The C-terminal domain of EhPAK,
carrying a constitutively kinase activity, was overproduced in E.
histolytica and caused a loss of polarity, a decrease in motility and an
enhancement of red blood cell phagocytosis. Although EhPAK does not contain a
CRIB motif, the N-terminal domain of EhPAK was able to bind to the small
GTPase Rac1. Taken together, our data suggest that N-terminal part of EhPAK is
a regulatory domain and that EhPAK is a major player in the signalling pathway
that controls E. histolytica polarity, motility and phagocytosis of
human cells.
| Materials and Methods |
|---|
|
|
|---|
and BL21 (DE3), used for plasmid
construction and for recombinant PAK production respectively, were grown in
Luria-Bertani medium (Sambrook et al.,
1989
Cloning of the pak gene, truncated pak gene
amplification and purification of recombinant proteins
The ORF corresponding to the pak gene was amplified from E.
histolytica genomic DNA by PCR using two oligonucleotide primers based on
the published pak gene sequence
(Gangopadhyay et al., 1997
).
(Sense primer:
5'GGGAATTCCATATGGTTTCATGTAAAAAACATGG3', which
created a NdeI site and an antisense primer that created a
XhoI site:
5'CCGCCTCGAGAATACCTACTTTCATTCCTCTTTG3'). From five
distinct PCR isolates a 1.4 kb fragment was obtained, cloned into pUC19 and
sequenced. The deduced sequence of E. histolytica PAK amino acids was
compared with protein sequences in the National Center for Biotechnology
Information. To obtain GST hybrid proteins, the entire and truncated
pak genes were amplified by PCR, subcloned in the prokaryotic gene
fusion vector pPGEX-4T-2 and expressed in E. coli as follows. The
5' primers created an EcoRI site, the 3' primers created
a XhoI site. To amplify the pak gene, the oligonucleotide
sense, OS1, 5'GATCGAATTCATGGTTTCATGTAAAAAACATGG3'
and the antisense, OR 1374,
5'GATC-CTCGAGTTAAATACCTACTTTCATTCCTC3' primers
were used. To amplify both the DNA encoding N-PAK (amino acids 1-150) and the
DNA encoding Np-PAK (amino acids 1-186) the 3' primer used was OS1 and
the 5' antisense primers were 5'
GATCCTCGAGTCTTTTCTCTGTAACCGTAG 3' for N-PAK and 5'
GATCCTCGAGTGGGTCTTCTGTTTTACTATATC 3' for Np-PAK. A DNA
fragment encoding amino acids 187-457 (C-PAK) was amplified with 5'
primer (sense:
5'GATCGAATTCCATAAATATTTTACAAATCTTGTTTC3' and
3' primer antisense OR1374). The amplified products were digested and
then cloned into the pPGEX-4T-2 cleaved with EcoRI and XhoI.
Hybrid proteins GST-PAK, GST-N-PAK, GST-Np-PAK and GST-C-PAK, were expressed
in E. coli BL21 cells and purified on glutathione-coupled Sepharose
beads as described in the instructions (Amersham Pharmacia Biotech).
In vitro kinase assay
Sepharose glutathione beads alone or loaded with GST-C-PAK (1 µg) and
the resulting soluble C-PAK (500 ng) after a thrombin cleavage were incubated
in 40 µl of kinase buffer (40 mM HEPES, pH 7.4, 20 mM MgCl2, 4
mM MnCl2) containing 10 µg of myelin basic protein (0.25
µg/ml), 10 µM ATP and 2 µCi of [
-32P] ATP for 20
minutes at 30°C. Kinase assays were stopped by addition of sample buffer,
boiled for 5 minutes, and proteins separated by a 15% SDS-PAGE for transfer to
nitrocellulose were analysed by phosphorimaging.
Binding to Rac or to CDC42 assay
GST-truncated PAK proteins were bound to glutathione beads and incubated
with purified Rac1 or Cdc42. E. coli producing GST-Rac1 or GST-Cdc42
were kindly provided by A. Hall, (University College London, London, UK) and
E. coli producing GST N-WASP were a gift from C. Egile (our
laboratory). The small GTPases and N-WASP were purified on glutathione-coupled
Sepharose beads. To obtain active GTPases, GST-Rac1 and GST-Cdc42 bound to
glutathione beads were depleted from nucleotide by incubation in 50 mM Tris
HCl pH 7.6, 100 mM NaCl, 1 mM DTT and 2.5 mM EDTA for 1 hour at room
temperature. GST-Rac and GST-Cdc42 were then loaded with GDP or GTP
S in
50 mM Tris HCl pH 7.6, 100 mM NaCl, 1 mM DTT, 10 mM MgCl2 and 1 mM
GDP or GTP
S for another hour and then cleaved with thrombin. The
resulting proteins were analysed by western blot using monoclonal anti GST
(kindly provided by C. Egile) and either an anti Rac or an anti Cdc42 antibody
to confirm that the GST-hybrid was not present. 1.5 µg of Cdc42 or Rac1
(GDP or GTP
S loaded) were incubated with the GST-fusion proteins
GST-PAK (0.5 µg), GST-N-PAK (5 µg), GST-Np-PAK (5 µg) and GST-C-PAK
(5 µg) bound to glutathione-coupled Sepharose beads. After three washes,
beads were suspended in SDS-PAGE sample buffer, boiled for 5 minutes, then
proteins separated on a 12% acrylamide gel and transferred to a nitrocellulose
membrane. The interaction between GST-hybrids proteins and GTPases were
examined by anti-GST, anti-Rac1 and anti-Cdc42 immunoblots.
Immunoblotting and antibodies
Samples were boiled for 2 minutes in SDS-sample buffer containing 2%
2ß mercaptoethanol, electrophoresed on 12% SDS-PAGE gels and transferred
to PVDF or to nitrocellulose membranes by semi-dry electrophoretic transfer in
Tris-glycine buffer. Western blots were performed as described previously
(Arhets et al., 1998
). Specific
proteins were detected using the appropriate antibodies: monoclonal anti human
Rac1 (Upstate Biotechnology) (diluted 1:1000); monoclonal anti human Cdc 42
(Santa Cruz Biotechnology, Inc) (diluted 1:2000); monoclonal anti actin (mAb
N350; Amersham Pharmacia Biotech) (diluted 1:2000). To produce polyclonal
serum to PAK (this work) rabbits were immunised with recombinant C-PAK and
with entire PAK. Antibodies were affinity purified by elution from purified
proteins transferred to a nitrocellulose support. Secondary antibodies,
peroxidase-labelled anti-rabbit IgG or anti-mouse IgG (Nordic Immunology)
(1:20000) were used, and immunoreaction was detected with ECL or ECL plus kits
detection methods (Amersham Pharmacia Biotech). Immunoblots were exposed to
X-OMAT film (Eastman Kodak Company) or to a phosphor screen for general
purposes (Eastman Kodak Company) when necessary to quantify the bands with the
IQ Mac V12 molecular imaging system.
Immunofluorescence and confocal microscopy
Trophozoites incubated at 36°C in amoebae culture medium without serum
on coverslips were fixed with 3.7% paraformaldehyde (PFA), permeabilised with
0.1% Triton X100/PBS, blocked with 1% BSA/PBS for 30 minutes, washed and
incubated with purified IgG anti-C-PAK (1:20 dilution) in 1% BSA/PBS for 1
hour. Coverslips were washed and incubated for 30 minutes with CY3-labelled
rabbit antibodies (diluted 1:300) in 1% BSA/PBS (Jackson Immuno Research
Laboratories, Inc.). F-actin was stained with FITC Bodipy phallacidine (Sigma
Chemical Co.) Samples were analysed with an Axiovert 100M- Zeiss piloted by a
LSM 510 confocal laser scanning microscope. Observations were performed in 15
to 20 planes from the bottom to the top with a thickness of 1 µm per
optical section.
DNA plasmid transfection into E. histolytica
For overexpression experiments in E. histolytica, the gene
encoding PAK cloned in pUC19 was amplified by PCR using a 5' primer
(sense: 5' GATCGGTACCATGGTTTCATGTAAAAAACATGG 3')
that created a Kpn1 site and 3' primer (antisense:
GATCGGATCCTTAAATACCTACTTTCATTCCTC 3') that created a
BamHI site, and the fragment encoding C-PAK (the last 273 amino
acids), cloned into pUC19, was amplified with a 5' primer beginning at
oligonucleotide 559 and creating a KpnI site (sense: 5'
GATCGGTACCATGCATAAATATTTTACAAATCTTGTTTCTATTG 3') and a 3'
primer creating a BamHI site (antisense: 5'
GATCGGATCCTTAAATACCTACTTTCATTCCTC 3'). The PCR products were
digested by BamHI and KpnI and then cloned into the pExEhNeo
plasmid, derived from pEhNEo/CAT (Hamann
et al., 1995
) and kindly provided by E. Tannich (Bernhard Nocht
Institute for Tropical Medicine, Hambourg, Germany) at the BamHI and
KpnI sites. pExEhNeo contains a gene conferring G418 resistance as a
selectable marker and in this plasmid. The ORF-encoding PAK and C-PAK are
flanked by 485 bp of untranslated 5' sequence of an E.
histolytica lectin gene and 600 bp of the untranslated 3' sequence
of an E. histolytica actin gene. Purification of the plasmids,
transfection and selection of E. histolytica have already been
described (Arhets et al., 1998
;
Guillén et al., 1998
).
In summary, the vector pExEhNeo and the recombinant plasmid (pExEhNeo/C-PAK)
were replicated in E. coli, purified and transfected by
electroporation in E. histolytica then grown in TYI-S-33 medium.
After 48 hours, the transfected parasites were selected by their resistance to
a medium supplemented with G418 (10 µg/ml). Amoeba expressing G418
resistance were cultured with G418 (3 µg /ml) and when necessary submitted
to increasing concentrations of G418 up to 30 µg/ml.
Counting of E. histolytica protrusions
Membrane extensions of E. histolytica were analysed by confocal
microscopy. Images obtained with differential interference contrast were
superposed on images obtained by confocal laser-scanning fluorescence
revealing F-actin staining at the posterior part of the parasite. Membrane
protrusions were counted on roughly 50 amoeba of the control and
C-PAK+ strains.
Cell fractionation
After two days of culture, 106 trophozoites were allowed to
adhere to the plastic bottom of a culture dish for 10 minutes in 2 ml of
culture medium without serum and then were scrapped and centrifuged at 1200
g for 4 minutes at 37°C. The pellets were resuspended in
200 µl of cool PBS buffer containing an inhibitor cocktail EDTA free (Roche
molecular Biochemicals), protease inhibitors (10 mM N-ehtyl-maleimide, 2 mM
phenylmethylsulfonyl fluoride, 0.01 mM leupeptin and 2 mM
parahydroxymercuribenzoate) and 1% Triton X100 and incubated for 30 minutes at
4°C. Debris and intact parasites were removed by low-speed centrifugation
(1200 g) at 4°C. The supernatants were submitted to a
high-speed centrifugation (245,000 g) for 30 minutes at
4°C. Pellets were washed in PBS and suspended in 200 µl of PBS buffer
containing 1% SDS. The protein concentration of the supernatant was measured
using the Bradford method, and for each sample an equal volume of the
supernatant and the pellet fractions were analysed for their PAK and actin
content by immunoblotting, and the bands were quantified with the IQ Mac V12
molecular imaging system.
Recording of E. histolytica migration and computer-assisted
analysis of cellular movement
Prior to computer-assisted analysis, 5x105 amoeba,
cultured in 30 µg/ml of G418, were transferred into a plastic flask full of
culture medium without serum at 37°C. Adherent E. histolytica
were filmed for 5 minutes in phase contrast mode with a video-camera mounted
on top of an inverted-light-microscope. For each of the two strains (control,
and C-PAK+) a total of roughly 40 amoeba was analysed in three
experiments. The video observations were digitised using a realtime
digitisation system and decimated down to 1 frame per second, yielding
sequences of 300 images for each experiment.
These image sequences were then processed for quantitative analysis with
the help of a dedicated computer program based on the active contour approach
(Kass et al., 1988
), a widely
used framework for image segmentation (identification of object regions) and
tracking (following object motion in time series). In this method, the
boundaries of each object (i.e. cells) are represented by a parametric curve
C(s,t), where s specifies position along the curve and
t is a virtual time. Starting from an initial position
C(s,t=0)=C0, the curve is deformed according to an
evolution equation:
![]() |
is a positive coefficient and f is a so-called `edge
map', that is, an intermediate image computed from the original image in such
a way that bright pixels strongly correlate with the locations of object
boundaries. For phase contrast images, where cell boundaries have lower
intensities than the background, a suitable edge map can be obtained by
blurring the negative of the original image intensity field I with a
Gaussian spread function G
of standard deviation
: f=-G
*1 (*
denotes convolution). The term
f in the equation above tends
to push the contour towards object edges, whereas the other term acts to
enforce contour smoothness and helps in overcoming image noise. The evolution
process proceeds until convergence and the final curve was used to define the
detected object boundaries. Thanks to several improvements
(Zimmer et al., 2001
Spectrophotometric haemoglobin assay
To quantify the number of red blood cells (RBCs) ingested by the amoeba, a
colorimetric determination of internalised haemoglobin was used. The method
was described by Voigt and collaborators
(Voigt et al., 1999
). Briefly,
RBCs from a healthy human volunteer was washed three times (2 minutes, 300
g) with amoeba culture medium TYIS-33 to eliminate the serum
and resuspended at 1-10x108 cells/ml. E. histolytica
were washed with the same culture medium (2 minutes, 1000 g)
and pelleted at a concentration of 1-10x106cells/ml. Amoeba
(2.4x105) were incubated with RBCs (2.4x107)
for 10 minutes at 37°C in 0.2 ml of TYIS-33. The amoeba and RBCs were then
spun down (15 seconds, 8000 g) and twice resuspended in 1 ml
of cold distilled water in order to burst non-ingested RBCs then centrifuged
(15 seconds, 8000 g). The pellet containing amoeba with RBCs
completely engulfed was resuspended in 1 ml concentrated formic acid. Samples
were measured with a spectrophotometer at 400 nm.
| Results |
|---|
|
|
|---|
|
Binding of human small GTPases Rac1 and Cdc42 to E.
histolytica PAK
To analyse whether EhPAK was a member of the p21-activated kinase family
despite the absence of the CRIB domain, binding assays were performed with the
GTPases Rac and/or Cdc42 (Fig.
2A). We decided to conduct these experiments with human GTPases,
since no Cdc42 has been described in E. histolytica and human Rac1
present 99% homology to RacG from E. histolytica
(Guillén et al., 1998
).
As the full-length EhPAK produced in E. coli was unstable and easily
degraded, only truncated forms N-PAK (amino acids 1 to 150), NpPAK (amino
acids 1 to 186) and C-PAK (187 to 457) were purified as GST hybrid proteins
and used in binding assays. These proteins were incubated in the presence of
human Rac1 and Cdc42 in an inactive form loaded with GDP or in an active form
loaded with the non-hydrolyzable GTP analogue GTP
S. GTPases were
incubated with beads coated with different PAKs and control peptides
(Fig. 2A). Since it is well
known that the Wiskott-Aldrich-Syndrome Protein (WASP) binds Rac and Cdc42 in
vitro, the truncated WASP protein containing the CRIB motif was included as a
positive control and the purified GST protein as a negative control. The
proteins binding the beads were then electrophoresed and blotted. The capacity
of the p21 GTPases to bind to the different PAK constructs was determined by
western blot analyses with antibodies against Rac1 and antibodies against
Cdc42 (Fig. 2A). The amount of
different PAK GST-hybrid proteins was verified by monoclonal antibodies
against GST (data not shown). The major result obtained in these experiments
is that a Rac-binding site is located in the N-terminal domain of EhPAK,
suggesting that this region could be the regulatory domain of the enzyme.
EhPAK seemed to bind exclusively the active form of Rac1 (GTP/Rac1) and did
not bind GDP/Rac1 or Cdc42 (GTP/Cdc42 or GDP/Cdc42). These results contrasted
with those obtained from the analysis of other PAKs, which interacted via a
CRIB motif with both activated Rac and Cdc42
(Burbelo et al., 1995
).
|
Kinase activity of PAK from E. histolytica
We were not yet able to preserve the stability of the full-length enzyme
in E. coli to reveal the kinase activity of the entire EhPAK, as well
as its putative regulation by a Rac protein. To determine whether EhPAK had a
kinase activity, we chose to carry out the myelin basic protein (MBP) kinase
assay on the protein with its N-terminal domain deleted. Samples were run on a
gel, analysed with a phosphoimager and the phosphorylation was quantified in
arbitrary units with the IQ Mac V12 molecular imaging system. Both recombinant
GST-C-PAK bound to beads and soluble C-PAK (amino acids 187-457), containing
the putative kinase catalytic domain, were utilised
(Fig. 2B). In comparison with
the residual background (Fig.
2B, lane 3) there was a major increase in MBP phosphorylation with
both beads-GST-C-PAK (a twofold increase) and C-PAK (a fourfold increase)
(Fig. 2B lane1 and lane 2,
respectively), demonstrating that EhPAK possessed a kinase activity and, in
addition, that N-terminal deletion yielded a constitutively active fragment
able to phosphorylate MBP as a substrate.
Cellular distribution of PAK in E. histolytica
Since PAKs are known to regulate actin organisation in mammalian cells and
in amoeba such as D. discoideum, the distribution of both EhPAK and
the filamentous actin were examined together by laser confocal microscopy in
rounded parasite and in elongated migrating E. histolytica. PAK was
revealed using a polyclonal antibody affinity purified using the last 271
amino acids of the protein (Materials and Methods). This serum recognised a
unique E. histolytica peptide at 53 kDa
(Fig. 5B). Polymerised actin
was co-stained with fluorescent phallacidin. In rounded amoeba, PAK and
F-actin were dispersed throughout the cytoplasm (unpublished results). In
moving trophozoites, PAK redistributed to the anterior part of the cell and
became highly concentrated in the nascent pseudopod
(Fig. 3). Polymerised actin,
moderately abundant in the cytoplasm, was present in the forming pseudopod and
at the periphery of the cell. In contrast to the localisation of PAK, F-actin
was in addition distributed in increased abundance at the posterior pole of
the amoeba (Fig. 3). Thus, in
moving parasites, the concentrated labelling at opposite ends of PAK versus
F-actin reinforced the polarised state of migrating E.
histolytica.
|
|
Construction of an E. histolytica strain overproducing the
catalytic domain of EhPAK
To examine the role of EhPAK in vivo, and as genetic exchanges are not yet
available in E. histolytica, we decided to engineer strains
overproducing full-length or truncated EhPAK. Recombinant plasmids and the
control carrier vector (ExEhNeo) were electroporated into amoeba, and
transfected parasites were selected in the presence of G418 at 10 µg/ml
(Materials and Methods). The following strains: N-PAK+,
C-PAK+ and PAK+, carrying, respectively, the DNA
fragment encoding the N-terminal domain (amino acids 1-150), the C-terminal
part (amino acids 187-457) of EhPAK and the entire protein, were obtained.
Analysis of the protein content of these different transfectants, grown at 30
µg/ml of G418, revealed that the N-terminal peptide was unstable since it
was not detectable with specific antibodies. For this reason the
N-PAK+ strain was not analysed further. The PAK+ strain
produced twofold more of the enzyme (data not shown) than the total endogenous
PAK, and the C-PAK+ strain produced an equivalent amount of the
C-PAK fragment (Fig. 5B).
Cell morphology analysis of E. histolytica strain
overproducing C-PAK
In mammalian cells, the PAK enzyme is a major regulator of cell morphology.
To examine the role of EhPAK on the polarisation of E. histolytica in
wild-type and transfected strains, we counted the number of pseudopodia on
fixed amoeba (Materials and Methods). No noticeable morphology differences
were observed between the control plasmid carrying strain
(Fig. 4A,B), the
PAK+ strain (data not shown) and the wild-type E.
histolytica. Roughly 90% of these trophozoites produced one to three
pseudopodia, but only one of them became dominant, indicating the direction of
locomotion (Fig. 4A,B). By
contrast, we observed that cells from the C-PAK+ strain displayed a
dramatic change in morphology (Fig.
4A,B). In fact, 70% of the cells producing C-PAK exhibited four to
six lateral extensions distributed all around the cell
(Fig. 4A,B). Simultaneous
protrusions of multiple pseudopod-like structures inhibited cell polarisation
in the strain overproducing the constitutively active C-PAK. Thus, EhPAK
appeared as a regulatory element controlling pseudopod extension and cell
polarity.
|
EhPAK and F-actin distribution in transfectant strains
E. histolytica motility requires a dynamic redistribution of the
actin cytoskeleton to produce a polarised cell. To examine whether
overproduction of C-PAK had an impact on this process, the actin cytoskeleton
was stained with fluorescent phallacidine. EhPAK and C-PAK were revealed by
immunostaining with the polyclonal serum against EhPAK
(Fig. 5A). Analysis by confocal
microscopy showed that the distribution of EhPAK and F-actin in the control
strain, containing the empty plasmid (Fig.
5A) and in the PAK+ strain (data not shown) was
identical to that already described for the wildtype. F-actin and EhPAK were
highly concentrated at the opposite extremities of the migrating parasite,
confirming that these cells displayed a wild-type phenotype. The
C-PAK+ strain that formed several pseudopod-like protrusions showed
an enrichment of the PAK enzyme in these structures. In addition, we observed
that there was no reinforced concentration of F-actin in this amoeba. This was
in agreement with the lack of polarity of the C-PAK+ strain.
Subcellular localisation of EhPAK and filamentous actin
We decided to analyse the potential link between EhPAK and actin
microfilaments using a biochemical approach. Cellular fractionation was
performed on both the control and C-PAK+ strains to determine the
subcellular localisation of F-actin and EhPAK.
(Fig. 5B). The proteins present
in the TritonX100-soluble fraction and in the TritonX100-insoluble
cytoskeleton fraction were separated by SDS-PAGE. The partitioning of actin
and EhPAK was revealed by anti-actin and anti-PAK, respectively. The enzyme
was equally concentrated in the soluble and the insoluble fraction, suggesting
that a fraction of EhPAK could be associated with the actin cytoskeleton and
that there was no major change in this association in the transfectant strain.
From this experiment, we also observed that in the C-PAK+ strain,
the C-terminal domain of EhPAK was partitioned in the insoluble Triton X100
fraction. The F-actin content in each cell fraction was also determined and
quantified by western blot and phosphoimager analysis. The F-actin
repartitioning indicated that in the E. histolytica control strain,
as in other motile cells, the majority of actin was present in a
TritonX100-soluble fraction (70% of total actin). In the C-PAK+
strain, there was an increase in soluble actin of up to 90%, suggesting that
the active form of EhPAK led to an increase in actin concentration in the
TritonX100-soluble fraction. However, whether actin existed as short filaments
or as globular forms needs to be determined. These observations were in
agreement with the confocal microscopy analyses and confirmed that changes in
EhPAK activity regulated the dynamics of the actin cytoskeleton in E.
histolytica.
|
Effect of EhPAK on E. histolytica motility
We reasoned that the effects of EhPAK on actin dynamics and cellular
morphology might result in alterations of E. histolytica motility.
E. histolytica is a cell that aggregates and highly deforms, and in
our experiments usual computer programs failed in tracking them individually.
We therefore developed a procedure allowing the analysis of amoeba motility by
combining video-microscopy and a customised image analysis programme developed
`in-house' (Materials and Methods) (Zimmer
et al., 2002
). Our computerised approach overcame the limitations
of manual quantification, which was prone to user bias and was unreasonably
time-consuming for large data sets as in this study and, of commercial
software packages that consider isolated, well contrasted, non-deformable and
non-aggregating cells. To determine whether EhPAK had a role in E.
histolytica migration, control, PAK+ and C-PAK+
adherent trophozoites in culture flasks were observed by optical phase
microscopy, video-recorded and computer analysed (Materials and Methods). To
quantitatively measure cellular motility, we defined the `trajectory diameter'
as the largest distance between two arbitrary points of the trajectory. The
size of an amoeba is roughly 25 µm, and by FACS analysis we verified that
the control population and the C-PAK+ strains had the same size
(data not shown). We decided that an amoeba was migrating during the recorded
time (5 minutes) when the interval between the two most distant points of its
resulting trajectory was superior to 25 µm.
Fig. 6 shows the plotted
`trajectory diameter' and the mean speed [trajectory length (µm)/time (s)]
calculated for each amoeba of the two transfectant populations. The movement
of an amoeba is influenced by its morphology, direction and speed; these
different factors lead to heterogeneous behaviour of amoebae in the same
culture during 5 minutes of recording. In the control population, 40% of the
amoebae clearly displayed a trajectory diameter in excess of 25 µm, and in
the C-PAK+ population only 20% of amoebae had a displacement beyond
25 µm. The `trajectory diameter' of C-PAK+ cells and control
cells were significantly different, as calculated by a Kolmogorov-Smirnov test
which is more appropriate than a chi-square test to analyse unbinned
distributions (Press et al.,
1992
). The K-S statistics are D
0.3, p
0.04, indicating that
the observed motility reduction of C-PAK+ cells is significant.
This result suggested strongly that overproduction of the activated catalytic
domain of PAK inhibited E. histolytica migration and motility. The
velocity and the trajectory of an E. histolytica strain overproducing
the full-length PAK were measured but no significant change compared to the
control strain was observed (data not shown).
|
Influence of EhPAK on the phagocytic activity of E.
histolytica
In E. histolytica, motility and phagocytosis of human cells are
two biological phenomena that require pseudopod extension. The fact that C-PAK
overproducing amoeba were not motile and displayed multiple nascent but
abortive pseudopodia prompted us to ask whether the phagocytosis pathogenic
maker for E. histolytica was affected by EhPAK. To analyse the
phagocytic activity, we incubated amoeba with human RBCs (10 minutes at
37°C with a ratio of 100 RBCs for 1 amoeba). The phagocytic efficiency was
measured by spectroscopy as a function of haem content. We compared
phagocytosis of C-PAK+ transfectant amoeba with the control strain
and a strain overexpressing myosin IB (MyoIB+), which is known to
be deficient in its phagocytic capacity
(Voigt et al., 1999
). We found
a significant increase in erythrophagocytosis rate with C-PAK-overproducing
amoeba (150%) compared with wild-type parasite (100%) and MyoIB+
strains, which displayed a reduction in erythrophagocytosis of 50% confirming
our previous data (Voigt et al.,
1999
). These results indicated that the lack of polarity of the
C-PAK+ strain did not inhibit phagocytosis and suggested that the
phagocytic process of E. histolytica could be enhanced by the
presence of multiple pseudopodia-like structures.
| Discussion |
|---|
|
|
|---|
Overexpression of C-terminal domain of PAK causes a deregulation of
pseudopod extension and inhibits E. histolytica migration
Constitutive overexpression of the DNA fragment encoding the C-terminal
domain of EhPAK induces a dramatic morphological change with simultaneous
formation of multiple membrane extensions and inhibition of cell polarisation.
This result suggests that, when overproduced, C-PAK deregulates the endogenous
enzyme EhPAK. By contrast, the overproduction of the full-length enzyme did
not alter the wild-type phenotype, indicating that the twofold excess of the
entire enzyme remains regulated probably by the function of the N-terminal
domain. With the help of a dedicated image analysis program that takes into
account the morphological changes of cells that move and deform rapidly. such
as E. histolytica, we showed that C-PAK overexpression inhibited
migration. These data indicate that the formation of a predominant polarised
pseudopod is a regulated phenomenon that requires the full-length EhPAK. Our
hypothesis is that the N-terminal domain of EhPAK could be a regulatory
element that coordinates morphological changes in E. histolytica even
in the absence of a CRIB motif. This phenotype is consistent with those
encountered with PAKa from D. discoideum, where cells expressing only
the kinase domain of PAKa present multiple membrane ruffles over the entire
cell, demonstrating that the N-terminal part of PAKa is required for
suppressing undesirable lateral pseudopod extensions
(Chung and Firtel, 1999
). In
addition, the N-terminal part of mammalian PAK, through its different protein
domains, is known to be involved in PAK cell localisation and to be necessary
for the development of polarised lamellipodia.
Several proteins have been identified as PAK-binding partners. The adaptor
protein Nck, known for its role in coupling activated receptor tyrosine kinase
to various signaling pathways (Pawson et
al., 1993
) and the PIX/Cool proteins are required to target PAK to
focal adhesion sites (Bagrodia et al.,
1998
; Bokoch et al.,
1996
; Manser et al.,
1998
; Oh et al.,
1997
). The fact that amoeba membrane extensions are formed and
recycle rapidly, as well as the localisation of EhPAK to the pseudopod of
migrating amoeba, would fit the model of de Curtis that links PAK to membranes
of the pseudopod during mammalian cell migration, via a complex of
Nck-PIX-paxillin-Rac (de Curtis,
2001
). For instance, after induction of receptor capping in E.
histolytica, EhPAK is recruited to the accumulated folded membrane that
forms the uroid (Labruyère et al.,
2000
). The N-terminal domain of EhPAK does not possess a
conventional SH3-binding motif necessary to bind Nck nor the conserved
proline-rich PIX-binding sequence. Nevertheless, the N-terminal domain of
EhPAK exhibits a proline-rich sequence that could interact with amoebic
protein partners controlling EhPAK localisation. In that sense, the N-terminus
of EhPAK appears to have the minimal requirement to regulate pseudopod
extension independently of CRIB or SH3 motifs. However, whether the activity
of the N-terminal domain on cell polarisation depends on the PAK-Rac
interaction via a parasite protein is under investigation. In addition, it
will be interesting to evaluate whether the formation of new adhesion sites is
altered in E. histolytica expressing the constitutive kinase,
indicating a potential role for EhPAK in site adhesion formation.
Overexpression of a C-terminal domain of PAK enhances E.
histolytica red blood cells phagocytic activity
Cortical actin polymerisation and the subsequent extension of pseudopodia
are important components of the phagocytic mechanism of E.
histolytica (Voigt and
Guillén, 1999
). Activation of the E. histolytica
surface by the adhesion of RBCs leads to cytoskeleton rearrangements that are
central to the process of phagocytosis. These rearrangements involve the
action of small GTPases such as Rac A
(Lohia and Samuelson, 1993
)
and the activity of the mechanoenzyme myosin IB
(Voigt et al., 1999
). In this
work, we demonstrate that the increase in C-PAK in E. histolytica
leads to the formation of multiple nascent pseudopod-like structures that
concentrate EhPAK. Increase in the content of the catalytic domain of EhPAK
has a major impact on parasite phagocytosis capacities since the
C-PAK+ strain displays a higher rate of RBC phagocytosis compared
with the wild-type strain. This result raises the question of how pseudopodia
extension is driven during the phagocytic process of E. histolytica.
The phagocytic hyper-reactive phenotype of C-PAK+ contrasts with
the behaviour of E. histolytica strain overexpressing myosin IB,
which has a reduced rate of phagocytosis and displays a normal motility and
cell polarisation. Interestingly, among the substrates of PAK the regulatory
light chain of myosin II (Chew et al.,
1998
), the myosin light chain kinase
(Sanders et al., 1999
) and the
myosin IB heavy chain (Lee et al.,
1996
) have been described, suggesting a direct link between PAK
and actin-myosin complexes. Two myosins have been reported in E.
histolytica, the conventional myosin II and the non-conventional myosin
IB. The last one was involved in phagocytosis
(Voigt et al., 1999
) and is
similar to myosin IB from D. discoideum and A. castellanii,
which are involved in pseudopodia formation. There is a striking difference
between E. histolytica myosin IB and those from other amoebae: the
heavy chain does not contain the serine/threonine amino acid at the usual PAK
target phosphorylation site (Vargas et
al., 1997a
; Vargas et al.,
1997b
). Nevertheless, we do not know whether myosin IB in E.
histolytica is the substrate of EhPAK even in the absence of a consensus
phosphorylation site. E. histolytica also presents a conventional
myosin II similar to those present in A. castellanii, D. discoideum
and chicken smooth cells (Raymond-Denise
et al., 1993
). E. histolytica myosin II is involved in
receptor capping, uroid formation and motility, and like EhPAK, is enriched at
the rear of the parasite during these activities
(Arhets et al., 1995
;
Arhets et al., 1998
;
Labruyère et al.,
2000
). The relationship between EhPAK and myosin II during capping
of surface receptors is a matter under investigation.
In conclusion, our results of the analysis of the strain accumulating the C-terminal domain of EhPAK, C-PAK+ strain, indicate that in E. histolytica, the protein kinase EhPAK is implicated in cell polarisation, motility and phagocytosis, processes dependent on actin cytoskeleton dynamics. A new challenge is to elucidate the nature of protein complexes associated with EhPAK, with the goal to determine key elements for the regulation of actin dynamics in the parasite. This will contribute to our understanding of the crucial steps for E. histolytica motility and phagocytosis that are necessary to invade and destroy human tissues during amoebiasis.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Abo, A., Qu, J., Cammarano, M. S., Dan, C., Fritsch, A., Baud, V., Belisle, B. and Minden, A. (1998). PAK4, a novel effector for Cdc42Hs, is implicated in the reorganization of the actin cytoskeleton and in the formation of filopodia. EMBO J. 17,6527 -6540.[CrossRef][Medline]
Arhets, P., Gounon, P., Sansonetti, P. and Guillén, N. (1995). Myosin II is involved in capping and uroid formation in the human pathogen Entamoeba histolytica. Infect. Immun. 63,4358 -4367.[Abstract]
Arhets, P., Olivo, J. C., Gounon, P., Sansonetti, P. and Guillén, N. (1998). Virulence and functions of myosin II are inhibited by overexpression of light meromyosin in Entamoeba histolytica. Mol. Biol. Cell 8,1537 -1547.
Bagrodia, S., Taylor, S. J., Jordon, K. A., van Aelst, L. and
Cerione, R. A. (1998). A novel regulator of p21-activated
kinases. J. Biol Chem.
273,23633
-23636.
Bagrodia, S. and Cerione, R. (1999). PAK to the future. Trends Cell Biol. 9, 350-355.[CrossRef][Medline]
Barylko, B., Binns, D. D. and Albanesi, J. P. (2000). Regulation of the enzymatic and motor activities of myosin I. Biochim. Biophys. Acta. 1496,23 -35.[Medline]
Bokoch, G. M., Wang, Y., Bohl, B. P., Sells, M. A., Quilliam, L.
A. and Knaus, U. G. (1996). Interaction of the Nck adapter
protein with p21-activated kinase (PAK1). J. Biol
Chem. 271,25746
-25749.
Brzeska, H., Szczepanowska, J., Hoey, J. and Korn, E. D.
(1996). The catalytic domain of Acanthamoeba myosin I
heavy chain kinase. II. Expression of active catalytic domain and sequence
homology to p21-activated kinase (PAK). J. Biol. Chem.
271,27056
-27062.
Burbelo, P. D., Dreschsel, D. and Hall, A.
(1995). A conserved binding motif defines numerous candidate
target proteins for both Cdc42 and Rac GTPases. J. Biol.
Chem. 270,29071
-29074.
Chew, T. L., Masaracchia, R. A., Goeckeler, Z. M. and Wysolmerski, R. B. (1998). Phosphorylation of non-muscle myosin II regulatory light chain by p21-activated kinase (gamma-PAK). J. Muscle Res. Cell Motil. 19,839 -854.[CrossRef][Medline]
Chung, C. Y. and Firtel, R. A. (1999). PAKa, a
putative PAK family member, is required for cytokinesis and the regulation of
the cytoskeleton in Dictyostelium discoideum cells during chemotaxis.
J. Cell Biol. 147,559
-576.
Coppolino, M. G., Krause, M., Hagendorff, P., Monner, D. A.,
Trimble, W., Grinstein, S., Wehland, J. and Sechi, A. S.
(2001). Evidence for a molecular complex consisting of Fyb/SLAP,
SLP-76, NcK, VASP and WASP that links the actin cytoskeleton to Fc
receptor signalling during phagocytosis. J. Cell Sci.
114,4307
-4318.
de Curtis, I. (2001). Cell migration: GAPs between membrane traffic and the cytoskeleton. EMBO Rep. 2,277 -281.[CrossRef][Medline]
Diamond, L. S., Harlow, D. R. and Cunnick, C. C. (1978). A new medium for the axenic cultivation of Entamoeba histolytica and other Entamoeba. Trans. R. Soc. Trop. Med. Hyg. 72,431 -432.[CrossRef][Medline]
Eby, J. J., Holly, S. P., van Drogen, F., Grishin, A. V., Peter, M., Drubin, D. G. and Blumer, K. J. (1998). Actin cytoskeleton organization regulated by the PAK family of protein kinases. Curr. Biol. 8,967 -970.[CrossRef][Medline]
Galisteo, M. L., Chernoff, J., Su, Y. C., Skolnik, E. Y. and
Schlessinger, J. (1996). The adaptor protein Nck links
receptor tyrosine kinases with the serine-threonine kinase Pak1. J.
Biol Chem. 271,20997
-21000.
Gangopadhyay, S., Sankar-Ray, S., Sinha, P. and Lohia, A. (1997). Unusual genome organisation in Entamoeba histolytica leads to two overlapping transcripts. Mol. Biochem. Parasitol. 89,73 -83.[CrossRef][Medline]
Guillén, N. (1996). Role of signalling and cytoskeletal rearrangements in the pathogenesis of Entamoeba histolytica. Trends Microbiol. 4, 191-196.[CrossRef][Medline]
Guillén, N., Boquet, P. and Sansonetti, P. (1998). The small GTP-binding protein RacG regulates uroid formation in the protozoan parasite Entamoeba histolytica. J. Cell Sci. 111,1729 -1739.[Abstract]
Hall, A. (1998). Rho GTPases and the actin
cytoskeleton. Science
279,509
-514.
Hamann, L., Nickel, R. and Tannich, E. (1995).
Transfection and continuous expression of heterologous genes in the protozoan
parasite Entamoeba histolytica. Proc. Natl. Acad. Sci.
USA 92,8975
-8979.
Kass, M., Witkin, A. and Terzopoulos, D. (1988). Snakes: active contour models. Internat. J. Computer Vision 1,321 -331.[CrossRef]
Kiosses, W. B., Daniels, R. H., Otey, C., Bokoch, G. M. and
Schwartz, M. A. (1999). A role for p21-activated kinase in
endothelial cell migration. J. Cell Biol.
147,831
-844.
Knaus, U. G., Wang, Y., Reilly, A. M., Warnock, D. and Jackson,
J. H. (1998). Structural requirements for PAK activation by
Rac GTPases. J. Biol. Chem.
273,21512
-21518.
Labruyère, E., Galy, V., Sansonetti, P. and Guillén, N. (2000). Distribution of a potential p21-activated serine/threonine kinase (PAK) in Entamoeba histolytica. Arch. Med. Res. 31,S128 -S130.[CrossRef][Medline]
Lee, S. F., Egelhoff, T. T., Manesh, A. and Cote, G. P.
(1996). Cloning and characterization of a Dictyostelium
myosin I heavy chain kinase activated by Cdc42 and Rac. J. Biol.
Chem. 271,27044
-27048.
Lohia, A. and Samuelson, J. (1993). Molecular cloning of a rho family gene of Entamoeba histolytica. Mol. Biochem. Parasitol. 58,177 -180.[CrossRef][Medline]
Manser, E., Leung, T., Salihuddin, H., Zhao, Z. S. and Lim, L. (1994). A brain serine/threonine protein kinase activated by Cdc42 and Rac1. Nature 367, 40-46.[CrossRef][Medline]
Manser, E., Loo, T. H., Koh, C. G., Zhao, Z. S., Chen, X. Q., Tan, L., Tan, I., Leung, T. and Lim, L. (1998). PAK kinases are directly coupled to the PIX family of nucleotide exchange factors. Mol. Cell 1,183 -192.[CrossRef][Medline]
Meza, I. (2000). Extracellular matrix-induced signaling in Entamoeba histolytica: its role in invasiveness. Parasitol. Today 16,23 -28.[CrossRef][Medline]
Mitchison, T. J. and Cramer, L. P. (1996). Actin-based cell motility and cell locomotion. Cell 84,371 -379.[CrossRef][Medline]
Nobes, C. D. and Hall, A. (1999). Rho GTPases
control polarity, protrusion, and adhesion during cell movement. J.
Cell Biol. 144,1235
-1244.
Oh, W. K., Yoo, J. C., Jo, D., Song, Y. H., Kim, M. G. and Park, D. (1997). Cloning of a SH3 domain-containing proline-rich protein, p85SPR, and its localization in focal adhesion. Biochem. Biophys. Res. Commun. 235,794 -798.[CrossRef][Medline]
Pawson, T., Olivier, P., Rozakis-Adcock, M., McGlade, J. and Henkemeyer, M. (1993). Proteins with SH2 and SH3 domains couple receptor tyrosine kinases to intracellular signalling pathways. Philos. Trans. R Soc. Lond. B Biol. Sci. 340,279 -285.[Medline]
Press, W. H., Teukolsky, S. A., Vetterling, W. T. and Flannery, B. P. (1992) Numerical recipes in C. Cambridge: Cambridge University Press.
Que, X., Samuelson, J. and Reed, S. (1993). Molecular cloning of a rac family protein kinase and identification of a serine/threonine protein kinase gene family of Entamoeba histolytica. Mol. Biochem. Parasitol. 60,161 -170.[CrossRef][Medline]
Raymond-Denise, A., Sansonetti, P. and Guillén, N. (1993). Identification and characterization of a myosin heavy chain gene (mhcA) from the human parasitic pathogen Entamoeba histolytica. Mol. Biochem. Parasitol. 59,123 -131.[CrossRef][Medline]
Sambrook, K. J., Fritsch, E. T. and Manniatis, T. (1989). Molecular cloning: a laboratory manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.
Sanders, L. C., Matsumura, F., Bokoch, G. M. and de Lanerolle,
P. (1999). Inhibition of myosin light chain kinase by
p21-activated kinase. Science
283,2083
-2085.
Sells, M. A., Boyd, J. T. and Chernoff, J.
(1999). p21-activated kinase 1 (Pak1) regulates cell motility in
mammalian fibroblasts. J. Cell Biol.
145,837
-849.
Vargas, M., Voigt, H., Sansonetti, P. and Guillén, N. (1997a). Molecular characterization of myosin IB from the lower eukaryote Entamoeba histolytica, a human parasite. Mol. Biochem. Parasitol. 86,61 -73.[Medline]
Vargas, M. A., Voigt, H., Sansonetti, P. and Guillén, N. (1997b). The tail domain of Entamoeba histolytica myosin IB bind F-actin. Arch. Med. Res. 28,137 -138.[Medline]
Voigt, H. and Guillén, N. (1999). New insights into the role of the cytoskeleton in phagocytosis of Entamoeba histolytica. Cell. Microbiol. 1, 195-203.[CrossRef][Medline]
Voigt, H., Olivo, J.-C., Sansonetti, P. and Guillén, N. (1999). Myosin IB is involved in phagocytosis of human erythrocytes by Entamoeba histolytica. J. Cell Sci. 112,1191 -1201.[Abstract]
Zimmer, C., Meas-Yedid, V., Glory, E., Labruyère, E., Guillén, N. and Olivo-Marin, J.-C. (2001). Active contours applied to the shape and motion analysis of amoeba. Proc. SPIE's 46th annual meeting, Vision Geometry X. 4476,124 -134.
Zimmer, C., Labruyère, E., Meas-Yedid, V., Guillén, N. and Olivo-Marin, J.-C. (2002). Segmentation and tracking of migration cells in videomicroscopy with parametric active contours: a tool for cell-based drug testing. IEEE. Trans. Medical Imaging (in press).
This article has been cited by other articles:
![]() |
S. Majumder, G. Schmidt, A. Lohia, and K. Aktories EhRho1, a RhoA-Like GTPase of Entamoeba histolytica, Is Modified by Clostridial Glucosylating Cytotoxins Appl. Envir. Microbiol., December 1, 2006; 72(12): 7842 - 7848. [Abstract] [Full Text] [PDF] |
||||
![]() |
|