|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
doi: 10.1242/10.1242/jcs.00448
Research Article |
,1,*
1 Inserm U540, Endocrinologie Moléculaire et Cellulaire des Cancers,
Montpellier, France
2 Dynamique Molèculaire des Interactions Membranaires, Université
Montpellier II, Unité Mixte de Recherche (UMR) CNRS 5539, Montpellier
Cedex 5, France.
* Author for correspondence (email: G.Bompard{at}bham.ac.uk)
Accepted 3 March 2003
| Summary |
|---|
|
|
|---|
Key words: Protein tyrosine phosphatase, FERM domain, PtdIns(4,5)P2-binding sites, Neomycin, Apical localization
| Introduction |
|---|
|
|
|---|
PTPL1/FAP-1/hPTP1E/PTP-BAS is the largest known cytoplasmic PTP (250 kDa)
and belongs to a family of PTPs characterized by the presence of a FERM (four
point-1, ezrin, radixin and moesin) domain
(Saras et al., 1994
;
Sato et al., 1995
;
Banville et al., 1994
;
Maekawa et al., 1994
). This
family comprises PTPH1 (Yang and Tonks,
1991
), PTPMEG (Gu et al.,
1991
), PTP36/PTPD2/Pez (Sawada
et al., 1994
; Moller et al.,
1994
; Smith et al.,
1995
) and PTPD1/PTP-RL10
(Moller et al., 1994
;
Higashitsuji et al., 1995
).
PTPL1 presents no characteristic feature in its far N-terminal end except for
a potential leucine zipper followed in the protein core by a FERM domain, five
PDZ domains and the C-terminal catalytic domain. FERM domains are commonly
found within a family of peripheral membrane proteins that mediate linkage of
the cytoskeleton to the plasma membrane (for reviews, see
Chishti et al., 1998
;
Bretscher, 1999
;
Mangeat et al., 1999
). This
family comprises the erythrocyte protein 4.1, ezrin, radixin, moesin, merlin
(product of Nf2, a tumor suppressor) and talin. The FERM domain has been well
characterized in ERM proteins, prototypes of membrane-cytoskeleton linkers.
ERMs harbor a major actin-binding site within their C-terminus and a FERM
domain at their N-terminal part, which binds a number of proteins (including
EBP 50/NHE3-RF, RhoGDI) some of which are transmembrane proteins such as CD44,
CD43, ICAM-2 and ICAM-3. Furthermore, ERM proteins can self-associate in an
intra- or inter-molecular manner through homotypic and heterotypic interaction
between their N-and C-terminal ends masking several sites involved in the
binding of membrane proteins and actin. Such interactions are regulated by
tyrosine or threonine phosphorylation but also by phosphatidylinositol
4,5-biphosphate [PtdIns(4,5)P2 (for a review, see
Bretscher, 1999
)]. Finally,
ezrin localization was recently shown to be altered by mutation of
PtdIns(4,5)P2-binding motifs found in its FERM domain
(Barret et al., 2000
).
We previously showed that the expression of PTPL1/FAP-1 was specifically
induced by anti-estrogens, such as hydroxytamoxifen (OH-Tam), in estrogen
receptor positive human breast cancer cells
(Freiss et al., 1998
). This
induction was correlated with an increase of PTP activity associated with the
insoluble fraction (membrane and cytoskeleton) and was involved in the early
steps of anti-growth factor action of OH-Tam
(Freiss and Vignon, 1994
;
Bompard et al., 2002
).
In the present study, we investigated PTPL1 localization and evaluated the role of its FERM domain in order to understand how its enzyme activity could be regulated. We showed that the FERM domain is necessary and sufficient to target PTPL1 to the apical cell membrane and to allow it to be enriched in dorsal microvilli in HeLa cells. Analysis of PTPL1-FERM sequence suggested the presence of two potential PtdIns(4,5)P2-binding sites. We showed that these two sites, involved in phosphatidylinositol phosphate lipid (PIP) binding in general, and PtdIns(4,5)P2 in particular, play a major role in PTPL1 cellular localization and association with the cytoskeletal fraction.
Collectively, our data bring the first indication for the importance of PtdIns(4,5)P2 binding through the FERM domain for the intracellular targeting and association with cytoskeleton of the human protein tyrosine phosphatase PTPL1.
| Materials and methods |
|---|
|
|
|---|
Construction of expression plasmids
All proteins encoded from pHM6 vector (Roche) are HA-tagged at their
N-terminus and 6His-tagged at their C-terminus. All constructs were verified
by sequencing.
The expression construct pHM6-PTPL1 encoding influenza virus hemagglutinin (HA)-epitope tagged PTPL1 (HA-PTPL1) was created as follows. Oligonucleotides carrying Bsu15I and Psp5II restriction sites were introduced in SacII-NotI sites of pHM6 vector. The cDNA encoding the N-terminal part of PTPL1 was cloned by PCR using pSV7d-PTPL1 (gift from C. H. Heldin, Ludwig Institute for Cancer Research, Uppsala, Sweden) as a template in SacII-Bsu15I sites of modified pHM6 vector. The SacII site was introduced by PCR in frame with the second coding codon (removal of start codon) and the Bsu15I was an endogenous PTPL1 site. By the same approach, the cDNA encoding the C-terminal part of PTPL1 was then inserted in Psp5II-NotI sites of modified pHM6 vector. The Psp5II was an endogenous PTPL1 site and the NotI site was introduced by PCR in order to remove PTPL1 stop codon. Finally, the remaining PTPL1 cDNA from pSV7d-PTPL1 was inserted in Bsu15I-Psp5II sites generating pHM6-PTPL1 (aa 2-2459, Fig. 1).
|
pHM6-FERM encoding HA-tagged FERM domain (aa 511-958) of PTPL1 (HA-FERM)
was cloned by PCR in EcoRI-SacII of pHM6
(Fig.1). pHM6-PTPL1
FERM
(deletion of aa 523-909, Fig.1)
was generated as followed. pBSK-FERM (aa 511-958) was digested by
BamHI and MscI, and the open reading frame was restored by
introducing double-stranded oligonucleotides (hybridized oligonucleotides)
generating pBSK-
FERM.
FERM was then excised by
StuI/PacI digestions and the fragment was cloned in
pBSK-PTPL1 (aa 2-2459) in order to generate pBSK-PTPL1
FERM.
Full-length PTPL1
FERM was then subcloned in pHM6 through
SacII/NotI sites. Mutagenesis of potential
PtdIns(4,5)P2-binding sites was performed with
oligonucleotides using QuickChangeTM Site-Directed Mutagenesis Kit
(Stratagene, St Quentin en Yvelines, France). The changed bases are underlined
and only sequences of the forward oligonucleotides are given. The
oligonucleotide (5'-3') used for introducing K645,646,647N
mutations (KN1 mutant) in pHM6-FERM was GGAAAGAAGAACCAAACAACAACACCAAAGCCACTG
(16 cycles, 95°C, 30 seconds; 55°C, 1 minute; 68°C, 15 minutes).
K824,825,830,831,832N mutations (KN2 mutant) were introduced in two steps.
First, the following oligonucleotide,
GAAAATATCTTTTTCTAACAACAACATCACATTGCAAAATAC was used to mutate lysines 830, 831
and 832 to asparagines (K830, 831, 832N, same conditions described above),
generating an intermediate mutant. This intermediate mutant was used as a
template to introduce the K824,825N mutations with the following
oligonucleotide CCATGGAGGGAAACCAACAACATATCTTTTTCTAACAAC (same conditions
described above) generating KN2 mutant. KN1-2 mutant was generated using
oligonucleotide carrying K645,646,647N mutations described above and using
pHM6-FERM KN2 as template. pHM6-PTPL1 KN1-2 construct was generated using the
same approach as described above for pHM6-PTPL1
FERM.
The in vitro expression construct pRSET-FERM encoding 6His-tagged FERM domain (aa 519-958) was created by subcloning BamHI-HindIII fragment from pHM6-FERM in pRSET vector (Invitrogen). pRSET-FERM KN1, KN2 and KN1-2 were created by the same approach using respective BamHI-HindIII fragments from pHM6-FERM-KN1, pHM6-FERM-KN2 and pHM6-FERM-KN1-2.
pCB6 Nt-Ezrin (aa 1-310) expressing VSV-G epitope tagged FERM domain of ezrin was a generous gift from M. Arpin (Institut Curie, Paris, France).
Cell culture
HeLa and COS1 cells were cultured in Dulbecco's Modified Eagle's medium
(DMEM) supplemented with 10% fetal calf serum (FCS), 2.5 units/ml penicillin
and 2.5 µg/ml streptomycin (Invitrogen). Cells were transfected either with
the calcium phosphate precipitation method or using LipofectAMINE
PLUSTM reagents (Invitrogen) according to the manufacturer.
Cell fractionation
COS1 cells were seeded 24 hours before transfection at a density of 125,000
cells per 35 mm dish. As indicated, cells were treated with 10 mM neomycin
(Sigma) for 24 hours. Forty hours after transfection, cells were washed two
times with ice cold PBS and lysed in fractionation buffer [10 mM PIPES, pH
6.8, 250 mM sucrose, 3 mM MgCl2, 120 mM KCl, 1 mM EGTA, 0.15%
Triton X-100, 1mM Na3VO4, 25 mM NaF, 5 mM sodium
pyrophosphate, 1mM PMSF and 0.02-0.04 trypsin inhibitor unit (TIU) of
aprotinin] for 5 minutes at 4°C. The total lysate was centrifuged at
25,000 g for 15 minutes at 4°C yielding a supernatant
containing depolymerized tubulin and monomeric actin, and a pellet containing
polymerized cytoskeletons (microfilaments and intermediate filaments)
resuspended in fractionation buffer (volume comparable to supernatant) and
sonicated.
Immunoblotting analysis
Equal volumes of each fraction were separated on SDS/polyacrylamide gel and
electrotransferred onto PVDF membrane. Blots were then stained with Coomassie
blue (R250, Sigma) to ensure that protein amounts were comparable. Membranes
were blocked with TBST (50 mM Tris, pH 7.5, 150 mM NaCl, 0.1% Tween 20)
containing 5% nonfat milk and immunoblotted with anti-HA, anti-actin,
anti-vimentin and anti-tubulin monoclonal or polyclonal antibodies. Primary
antibodies were detected using horseradish peroxydase-conjugated goat
anti-mouse IgG or anti-rabbit IgG, and Western Lighting (PerkinElmer Life
Sciences, Courtaboeuf, France).
Immunofluorescence study
Twenty hours after transfection, cells were fixed in medium with 3.7%
formaldehyde for 20 minutes and permeabilized in TBS buffer (50 mM Tris, pH
7.5, 150 mM NaCl) containing 0.2% Triton X-100 for 4 minutes. Cells were
incubated with anti-HA mAb for 60 minutes at room temperature, washed and
incubated with FITC-conjugated anti-mouse IgG for 30 minutes at room
temperature. After final wash and mounting in Gel/Mount (Biomeda, Hayward,
CA), cells were examined with a laser scanning confocal microscope (Bio-Rad
Laboratories) using a 63x1.4 oil immersion objective or a DMR A
microscope PL APO 63x oil immersion objective (1.32 NA) with appropriate
filters (Leica) and images were recorded with a cooled CCD Micromax camera
(1,300x1,030 pixels, RS; Princeton Instruments, Monmouth Junction,
NJ).
Protein-lipid overlays
35S-labeled PTPL1-FERM domain and its derived mutants, generated
by the TnT in vitro transcription-coupled translation system (Promega) from
pRSET-FERM vector, were incubated with Ni-NTA agarose column (Qiagen) for 1
hour at room temperature. After two washes with S buffer [50 mM
NaH2PO4, 20 mM Tris, 300 mM NaCl, 5 mM imidazole, 1 mM
PMSF and 0.02-0.04 trypsin inhibitor unit (TIU) of aprotinin, pH 8] and W
buffer (20 mM Tris, 150 mM NaCl, 30 mM imidazole), recombinants proteins were
eluted in the E buffer (20 mM Tris, 100 mM NaCl, 300 mM imidazole). 40,000 cpm
of 35S-labeled PTPL1-FERM domain and its derived mutants were
incubated for 2 hours at room temperature in 5 ml TBST, 3% BSA with PIP-Strips
(Echelon Biosciences, Salt Lake City, Utah) pre-saturated with TBST, 3% BSA.
After three washes with TBST, binding of FERM domain was quantified with a
Fuji BAS1000 Bioimaging Analyzer (Raytest, Paris la Défense,
France).
| Results |
|---|
|
|
|---|
FERM). The FERM domain, similarly to the full-length
PTPL1, localized to the apical cell membrane and was enriched in microvilli
(Fig. 2D-F). Furthermore, the
FERM domain also induced cell extensions
(Fig. 2D) as observed with the
ezrin FERM domain (Martin et al.,
1997
FERM was found mainly cytosolic
with little accumulation at the plasma membrane or in microvilli
(Fig. 2G-I). These results
clearly demonstrate that the FERM domain is necessary and sufficient for
apical localization of PTPL1.
|
Mutation of two potential PtdIns(4,5)P2-binding sites
altered PTPL1 localization
FERM domains of ERM family proteins are known to bind transmembrane
proteins such CD44, CD43, ICAM-1, -2, -3 and also
PtdIns(4,5)P2 (for reviews, see
Bretscher, 1999
;
Mangeat et al., 1999
).
Furthermore, ERM-CD44 binding is enhanced, in vitro, by
PtdIns(4,5)P2 (Hirao
et al., 1996
). Recently, it has been shown that mutation of
PtdIns(4,5)P2-binding motifs in the FERM domain of ezrin
altered its intracellular localization
(Barret et al., 2000
). Sequence
analysis of the PTPL1-FERM domain revealed the presence of two potential
PtdIns(4,5)P2-binding sites
(Fig. 3, bold bars).
PtdIns(4,5)P2-binding motifs are characterized by a
cluster of basic amino acids [e.g. KKXXXXXX(K/R)K in FERM domains of ERM]. The
first potential PtdIns(4,5)P2-binding motif found in
PTPL1-FERM domain, KEEPKKK, was located at amino acids 641-647 and the second,
KKISFSKKK, at amino acids 824-832 (Fig.
3). In order to evaluate the role of such motifs in PTPL1
localization, several mutations of the lysine residues located in the presumed
sites were introduced in the FERM domain. Lysines 645, 646 and 647 in the
first site and lysines 824, 825, 830, 831, 832 in the second site were mutated
to asparagines generating, respectively, KN1 and KN2 mutants. KN1-2 mutant was
obtained by combining both sets of mutations.
|
As in HeLa cells, when expressed in COS1 fibroblasts PTPL1-FERM domain
localized in apical microvilli and was able to induce membrane extensions in
many cells (Fig. 4A). Such
effect has also been reported with the ezrin FERM domain
(Martin et al., 1997
) and has
been shown to be lost by preventing PtdIns(4,5)P2 binding
(Barret et al., 2000
). On the
basis of this result, we evaluated the effect of mutations of potential
PtdIns(4,5)P2-binding sites within the PTPL1-FERM domain on its
cellular localization (cell extensions, membrane and microvilli). KN1 and KN2
mutants partly inhibited cell extension processes but had few effects on the
localization of the FERM domain at the membrane and microvilli
(Fig. 4B,C). However,
combination of both sets of mutations strongly altered the cellular
localization of the FERM domain, and KN1-2 mutant presented in most cells a
diffuse cytosolic staining (Fig.
4D). It is important to note that in some cells the KN2 mutant
also presented a localization comparable to the KN1-2 mutant (data not shown).
Thus, both potential PtdIns(4,5)P2-binding sites seemed to
cooperate for proper intracellular targeting of the FERM domain of PTPL1.
|
Because the most drastic effect on FERM domain localization was obtained by
mutating both potential PtdIns(4,5)P2-binding motifs,
KN1-2 mutations were secondarily introduced in the full-length enzyme to
evaluate their roles on PTPL1 localization in HeLa cells. As shown with COS1
cells, KN1-2 mutations abrogated membrane and microvilli localization of FERM
domain as well as cell extensions (compare
Fig. 2D with
Fig. 5A). Similarly, HA-epitope
tagged PTPL1 KN1-2 localization was strongly altered compared with the
wild-type protein, presenting a diffuse cytosolic staining around the nucleus
(compare Fig. 2A with
Fig. 5D). Such a
mislocalization was comparable to that observed for the PTPL1
FERM
mutant (Fig. 2G). Similar
effects were obtained in COS1 cells (data not shown).
|
In summary, these results demonstrated that the two potential PtdIns(4,5)P2-binding sites found within the PTPL1-FERM domain are crucial for FERM and PTPL1 localization. It finally suggested that PTPL1 localization could be regulated by phosphoinositide metabolism.
PTPL1-FERM domain binds PtdIns(4,5)P2 in vitro
To directly assess the PtdIns(4,5)P2 binding property
of the FERM domain of PTPL1, we carried out protein-lipid overlays. In vitro
labeled transcribed and translated 6His-tagged PTPL1-FERM domains (wt, KN1,
KN2 and KN1-2) were used to probe nitrocellulose membrane containing various
immobilized phosphoinositides (PIPs), after their purification on and elution
from nickel-agarose columns. Fig.
6A shows such eluted proteins separated on SDS-PAGE and visualized
by autoradiography. Using this assay, 6His-FERM domain was found to
specifically bind 4' and/or 5' phosphorylated PIPs, that is,
PtdIns(4)P, PtdIns(5)P, PtdIns(3,4)P2,
PtdIns(3,5)P2, PtdIns(4,5)P2 and
PtdIns(3,4,5)P3 (Fig.
6B). A very weak interaction with
PtdIns(3,4,5)P3 was sometimes observed, whereas no
interaction was detected with nonphosphorylated phosphatidylinositol and other
control phospholipids (PA, PS, LPA, LPC, PE, PE, S1P). The KN1 mutation
slightly affects PIPs binding of the 6His-FERM domain
(Fig. 6B). This effect was more
pronounced with the KN2 mutation (Fig.
6B). However, KN1-2 mutation abolishes the binding of 6His-FERM
domain to immobilized PIPs by 70% to 80%
(Fig. 6B).
|
These results clearly demonstrate that the FERM domain of PTPL1 directly binds PtdIns(4,5)P2 in vitro through the two binding sites located between amino acids 641-647 and 824-832.
Subcellular distribution of PTPL1 correlates with
PtdIns(4,5)P2 binding
Having established that the FERM domain of PTPL1 binds
PtdIns(4,5)P2 in vitro, the subcellular distributions of
wild-type, KN1, KN2, KN1-2 HA-tagged FERM domains, as well as wild-type,
KN1-2,
FERM HA-tagged PTPL1 were compared, upon cell fractionation of
COS1 cells, in order to provide biochemical evidence for the differences in
localization observed by immunofluorescence. Following cell fractionation,
wild-type FERM domain was found to be strongly associated with the Triton
X-100 insoluble fraction containing polymerized actin (F-actin) and vimentin
(Fig. 7A). The KN1 mutant
displayed a comparable distribution even if the amount present in the soluble
fraction, containing depolymerized tubulin and actin (G-actin), was more
significant than that observed with the wild-type FERM
(Fig. 7A). By contrast, KN2 and
KN1-2 mutants were only found to be associated with the soluble fraction
(Fig. 7A) in accordance with
the poor affinity of these proteins for PtdIns(4,5)P2
(Fig. 6B). Following the same
approach, effects of KN1-2 mutations and FERM deletion on full-length PTPL1
subcellular distribution were analyzed. As for its FERM domain, wild-type
PTPL1 showed a marked association with the cytoskeletal fraction that is
abolished in KN1-2 or
FERM mutants
(Fig. 7B). 35% of total
HA-PTPL1 was associated with Triton X-100 insoluble fraction versus 3.6% and
1.9% for HA-PTPL1 KN1-2 and HA-PTPL1
FERM, respectively
(Fig. 8). The subcellular
distribution of full-length PTPL1 did not require its catalytic activity since
the localization of an inactive mutant (C2389S) was indistinguishable from
that of the native enzyme (data not shown). Our data demonstrated that
association of PTPL1 with Triton X-100 insoluble fraction depended on its FERM
domain and on the integrity of at least the second
PtdIns(4,5)P2-binding site.
|
|
|
FERM mutants was not affected by such a
treatment (Fig. 9D). Those data
strongly support the necessity of PtdIns(4,5)P2 binding
for cytoskeletal association of PTPL1 through motifs within its FERM
domain.
| Discussion |
|---|
|
|
|---|
PTPL1 belongs to the FERM-domain-containing PTP superfamily comprising
several mammalian enzymes PTPH1, PTPMEG, PTP36/Pez and PTPD1/PTP-RL10 as well
as the recently identified worm PTP-FERM. In this report, we demonstrate by
immunofluorescence using different tagged-constructs that the FERM domain of
human PTPL1 is necessary and sufficient to target the enzyme at the apical
face of cell membrane and in microvilli in HeLa epithelial cells. In
accordance with our findings, PTP36, PTPH1, and PTPMEG have been reported to
associate with the cell membrane (Ogata et
al., 1999
; Gjorloff-Wingren et
al., 2000
). The FERM domains of PTP-BL, the mouse homologue of
PTPL1, and of the worm PTP-FERM were shown to be sufficient for their
submembranous distribution (Cuppen et al.,
1999
; Uchida et al.,
2002
). Furthermore, deletion of the FERM domain from PTPH1, PTPMEG
and PTP-FERM altered their intracellular targeting
(Gjorloff-Wingren et al.,
2000
; Uchida et al.,
2002
). However, it does not seem to be a general feature for all
family members since PTPD1 whose FERM domain is known to interact with KIF1C,
a kinesin-like protein, was shown to be mainly localized in the cytoplasm
(Dorner et al., 1998
;
Cuppen et al., 1999
), whereas
FERM domain of Pez was involved in the nuclear localization of this enzyme in
HEK 293 cells at low density (Wadham et
al., 2000
).
The membraneous PTPL1 localization raises the question of its association with the cell cytoskeleton. By COS1 cell fractionation, we show that the FERM domain of PTPL1 is mainly recovered in the particulate fraction containing polymerized actin and vimentin. Moreover 35% of total full-length PTPL1 is also found to be associated with cytoskeletal fraction in a FERM-domain-dependent manner. Having established that the FERM domain was involved in PTPL1 intracellular targeting and required for its association with cytoskeletal fraction, we next investigated how its localization could be regulated in order to identify physiological mechanisms controlling PTPL1 activity.
FERM domains of ERM proteins, composed of three subdomains (A, B and C),
are known to bind transmembrane proteins such as CD44, CD43, ICAM-1, -3 and
also PtdIns(4,5)P2
(Hamada et al., 2000
) (for a
review, see Bretscher, 1999
).
Ezrin binding to CD44 is increased by PtdIns(4,5)P2 in
vitro (Hirao et al., 1996
).
Recently, it has been demonstrated that ezrin localization was altered by
mutation of PtdIns(4,5)P2-binding motifs found in
subdomains A and C (Barret et al.,
2000
). PTPL1 sequence alignment with ezrin points to two potential
PtdIns(4,5)P2-binding sites in its FERM domain sequence in
the same A and C subdomains (Fig.
3). The first site located at amino acids 641-647 corresponds to a
KXXXKKK motif and resembles the consensus sequence in villin,
(K/R)XXXX(K/R)(K/R). The second site, KKXXXXKKK, located at amino acids
824-832, is similar but not identical to the first consensus sequence in ERM,
KKXXXXXX(K/R)K. By introducing mutations in these sites, we presently found
that lysine to asparagine mutations of both sites (K644, 645, 646, 824, 825,
830, 831, 832N) altered the subcellular localization of the PTPL1-FERM domain
as well as the full-length enzyme. Furthermore PTPL1 KN1-2 localization was
similar to that observed with PTPL1
FERM. In addition, we demonstrated
that association of the FERM domain or full-length PTPL1 with cytoskeletal
fraction was abrogated by mutation of both potential
PtdIns(4,5)P2-binding motifs or FERM domain deletion. In
fact, only 4% and 2% of PTPL1 KN1-2 and PTPL1
FERM mutants,
respectively, remained associated to the particulate fraction, whereas 35% of
total wild-type PTPL1 is found in that fraction. Our results altogether
indicate that the two domains, located in regions 641-647 and 824-832, were
responsible for PTPL1-FERM domain, and therefore for PTPL1, localization and
association with the cytoskeletal fraction.
By similarity to what has been described for ezrin
(Barret et al., 2000
), we
hypothesized that these two domains do cooperate in
PtdIns(4,5)P2 binding and we investigated the direct
binding of PTPL1-FERM domain to PtdIns(4,5)P2 in vitro.
Our first attempt using FERM domains expressed in bacteria failed to give us
results because of the strong insolubility of this protein in absence of
PtdIns(4,5)P2 (data not shown). However, labeled
6His-epitope tagged PTPL1-FERM domains obtained by coupled
transcription/translation in vitro permitted the purification of low amounts
of tracer proteins that remain soluble at these concentrations and thus
allowed us to probe nitrocellulose membrane containing immobilized PIPs. Using
such protein-lipid overlays, we showed that the FERM domain of PTPL1 binds
specifically 4' and/or 5' phosphorylated PIPs. KN2 mutation and,
to a lesser extent, KN1 mutation were found to affect PIPs binding which is
almost completely abolished by combination of both mutations (KN1-2). This
result clearly demonstrates that the two suspected
PtdIns(4,5)P2-binding sites are functional and cooperate
for PIPs binding in vitro. The in vitro ERM-FERM domain binding selectivity
for PIPs is largely unknown. Among PIPs bound by the FERM domain of PTPL1,
PtdIns(4,5)P2 and PtdIns(4)P are the most
abundant in mammal cells (for a review, see
Payrastre et al., 2001
).
PtdIns(5)P, which represents with PtdIns(3)P around 0.25% of
cellular phosphoinositides, is absent in certain cell lines, among them COS1
cells (Shisheva, 2001
). As for
higher 3' phosphorylated species known to be localized at the plasma
membrane, as PtdIns(3,4)P2 and
PtdIns(3,4,5)P3, their rates are generally low or absent
and are strongly regulated by extracellular stimuli
(Payrastre et al., 2001
).
Moreover, we showed that serum starvation of COS1 cells, known to reduce PI
3-kinase activity and thus PtdIns(3,4)P2 and
PtdIns(3,4,5)P3 levels, does not affect the localization
and subcellular distribution of PTPL1 (data not shown). The nature of PIPs
could affect binding affinity and selectivity. Our preliminary results on
different protein-lipid overlays show that the binding of PTPL1-FERM domain to
natural PtdIns(4,5)P2 is stronger than to synthetic
PtdIns(4,5)P2, which displays shorter fatty acid chains
than in natural PtdIns(4,5)P2 (data not shown). Data on
PIPs binding, associated to the prevalent rate of
PtdIns(4,5)P2 and its proper cellular localization,
strongly favor PtdIns(4,5)P2 being responsible for PTPL1
localization and subcellular distribution.
Our data suggest that the association of PTPL1 with the particulate fraction depends on PtdIns(4,5)P2 binding and that at least the second motif within its FERM domain is essential. This first evidence was strongly reinforced by the demonstration that COS1 cell treatment with neomycin (10 mM), a polycation that binds to the polar heads of PtdIns(4,5)P2 in the cell membrane and inhibits PTPL1-FERM domain interaction with PtdIns(4,5)P2 in overlay experiments, had similar effect on PTPL1 subcellular distribution as did the KN1-2 mutations. Indeed, the association of PTPL1 with the cytoskeletal fraction was reduced by 50% after neomycin treatment.
Our studies on PTPL1 bring the first argument for
PtdIns(4,5)P2 binding being primarily responsible for PTP
cellular targeting and subcellular distribution. It is interesting to note
that among PTPs containing a FERM domain and known to localize at the plasma
membrane PTPH1 and PTP-FERM also possess two potential
PtdIns(4,5)P2 binding sites situated in same regions to
those of PTPL1 (Fig. 3). However, PTPL1 intracellular localization is much more limited than that of
PtdIns(4,5)P2, and the PH domains of PLC
1 and
oxysterol-binding protein (OSBP) known to specifically interact with
PtdIns(4,5)P2 in vitro displayed different localizations
when expressed in cells (for a review, see
Balla et al., 2000
). These data
therefore suggest the existence of additional anchoring proteins that might
contribute to membrane localization of
PtdIns(4,5)P2-binding domains by restricting and
stabilizing their recruitment into membrane specific compartments. We showed
that the FERM domain as well as PTPL1 co-localized with F-actin at plasma
membrane (cortical actin) and in microvilli. PTPMEG and PTP36 were reported to
associate with cytoskeletal fraction (Gu
and Marjerus, 1996
; Ogata et
al., 1999
; Aoyama et al.,
1999
). Furthermore, many proteins interacting with PDZ domains of
human PTPL1 or mouse PTP-BL have been shown to be associated with cytoskeleton
such as PARG1, a Rho-GAP protein (Saras et
al., 1997
), ZRP-1, a zyxin-related protein
(Murthy et al., 1999
), or RIL,
a LIM-domain-containing protein co-localizing with F-actin
(Cuppen et al., 1998
)
suggesting a potential role of PTPL1 in the dynamic of actin cytoskeleton. It
has recently been shown that PTP-BL associates with midbody during the cell
cycle and is involved in cytokinesis in HeLa cells
(Herrmann et al., 2003
). In
this study, the FERM domain of PTP-BL was found to co-localize with F-actin at
the contractile ring and to bind, directly or indirectly, F-actin in vitro.
Moreover, the FERM domain of ezrin has been shown to bind G-actin as well as
F-actin in vitro (Roy et al.,
1997
). Altogether those data suggest that the association of PTPL1
with the particulate fraction could be due to a direct or indirect binding to
the actin cytoskeleton through its FERM domain. However, depletion of F-actin
by treatment of COS1 cells with latrunculin A does not affect the subcellular
distribution of PTPL1-FERM domain or full-length enzyme (data not shown). This
discrepancy in PTPL1/PTP-BL localization could be explained by the PTPL1 gene
structure, which was recently described and revealed the existence of 47 exons
raising many isoform possibilities (Ensembl gene ID, ENSG00000163629). Indeed,
Herrmann et al. (Herrmann et al.,
2003
) demonstrated differential localizations of some different
isoforms of PTP-BL during the cell cycle.
In this report, we have discovered two main characteristics of human PTPL1
localization. First of all, we outlined the crucial role of the FERM domain
for its submembraneous addressing. Second, we demonstrated that its
association with the particulate fraction is a phenomenon driven by
PtdIns(4,5)P2 interaction with specific binding motifs
within this domain. Our major goal is now to reconcile this regulated
subcellular localization with the potential functions of this enzyme in
different cellular contexts. FERM-domain deletion of PTPH1 was shown to block
its inhibitory effect on T-cell antigen receptor signaling pointing that a
proper localization is crucial for its physiologic effect
(Han et al., 2000
). In MCF7
human breast cancer cells, we previously showed that PTPL1 was involved in the
inhibition of IGF-1 survival activity by blocking PI3-kinase (PI3-K) pathway
and this inhibitory action occurs at early steps of IGF-I signaling
(Freiss et al., 1998
;
Bompard et al., 2002
). PTP-BL
has recently been shown to localize in lipid rafts in mouse embryo and
cortical neurons (Palmer et al.,
2002
). Futhermore, PtdIns(4,5)P2 has been
demonstrated to accumulate within such lipid microdomains
(Laux et al., 2000
). The
association of PTPL1 with the particulate fraction, not driven by F-actin
binding, could thus result from its presence in lipid rafts since these
domains are recovered in Triton X-100 insoluble fraction. In MCF7 cells, the
IGF-I receptor (IGF-IR), as well as PI3-K, have been shown to transiently
associate with lipid rafts after IGF-I stimulation
(Manes et al., 1999
). This
transient localization could allow PTPL1, associated with lipid rafts, to
inhibit the IGF-I survival pathway in human breast tumors where it could
represent an interesting new therapeutic tool.
| Acknowledgments |
|---|
| Footnotes |
|---|
Present address: School of Biosciences, University of Birmingham,
Birmingham, UK | References |
|---|
|
|
|---|
Aoyama, K., Matsuda, T. and Aoki, N. (1999). Characterization of newly identified four isoforms for a putative cytosolic protein tyrosine phosphatase PTP36. Biochem. Biophys. Res. Commun. 266,523 -531.[CrossRef][Medline]
Balla, T., Bondeva, T. and Varnai, P. (2000). How accurately can we image inositol in living cells? Trends Pharmacol. Sci. 21,238 -241.[CrossRef][Medline]
Banville, D., Ahmad, S., Stocco, R. and Shen, S. H.
(1994). A novel protein-tyrosine phosphatase with homology to
both the cytoskeletal proteins of the band 4.1 family and junction-associated
guanylate kinases [published erratum appears in J. Biol. Chem. (1995) 270,
10359]. J. Biol. Chem.
269,22320
-22327.
Barret, C., Roy, C., Montcourrier, P., Mangeat, P. and Niggli,
V. (2000). Mutagenesis of the phosphatidylinositol
4,5-bisphosphate (PIP(2)) binding site in the NH(2)-terminal domain of ezrin
correlates with its altered cellular distribution. J. Cell
Biol. 151,1067
-1080.
Bompard, G., Prebois, C., Puech, C., Vignon, F. and Freiss,
G. (2002). Protein-tyrosine phosphatase PTPL1/FAP-1 triggers
apoptosis in human breast cancer cells. J. Biol. Chem.
277,47861
-47869.
Bretscher, A. (1999). Regulation of cortical structure by the ezrin-radixin-moesin protein family. Curr. Opin. Cell Biol. 11,109 -116.[CrossRef][Medline]
Chishti, A. H., Kim, A. C., Marfatia, S. M., Lutchman, M., Hanspal, M., Jindal, H., Liu, S. C., Low, P. S., Rouleau, G. A., Mohandas N. et al. (1998). The FERM domain: a unique module involved in the linkage of cytoplasmic proteins to the membrane. Trends Biochem. Sci. 23,281 -282.[CrossRef][Medline]
Cuppen, E., Gerrits, H., Pepers, B., Wieringa, B. and Hendriks,
W. (1998). PDZ motifs in PTP-BL and RIL bind to internal
protein segments in the LIM domain protein RIL. Mol. Biol.
Cell 9,671
-683.
Cuppen, E., Wijers, M., Schepens, J., Fransen, J., Wieringa, B. and Hendriks, W. (1999). A FERM domain governs apical confinement of PTP-BL in epithelial cells. J. Cell Sci. 112,3299 -3308.[Abstract]
Dorner, C., Ciossek, T., Muller, S., Moller, P. H., Ullrich A.
and Lammers, R. (1998). Characterization of KIF1C, a new
kinesin-like protein involved in vesicle transport from the Golgi apparatus to
the endoplasmic reticulum. J. Biol. Chem.
273,20267
-20275.
Fischer, E. H. (1999). Cell signaling by protein tyrosine phosphorylation. Adv. Enzyme Regul. 39,359 -369.[CrossRef][Medline]
Flint, A. J., Tiganis, T., Barford, D. and Tonks, N. K.
(1997). Development of "substrate-trapping" mutants
to identify physiological substrates of protein tyrosine phosphatases.
Proc. Natl. Acad. Sci. USA
94,1680
-1685.
Freiss, G. and Vignon, F. (1994). Antiestrogens
increase protein tyrosine phosphatase activity in human breast cancer cells.
Mol. Endocrinol. 8,1389
-1396.
Freiss, G., Puech, C. and Vignon, F. (1998).
Extinction of insulin-like growth factor-I mitogenic signaling by
antiestrogen-stimulated Fas-associated protein tyrosine phosphatase-1 in human
breast cancer cells. Mol. Endocrinol.
12,568
-579.
Garton, A. J., Flint, A. J. and Tonks, N. K. (1996). Identification of p130(cas) as a substrate for the cytosolic protein tyrosine phosphatase PTP-PEST. Mol. Cell. Biol. 16,6408 -6418.[Abstract]
Gjorloff-Wingren, A., Saxena, M., Han, S., Wang, X., Alonso, A., Renedo, M., Oh, P., Williams, S., Schnitzer, J. and Mustelin, T. (2000). Subcellular localization of intracellular protein tyrosine phosphatases in T cells. Eur. J. Immunol. 30,2412 -2421.[CrossRef][Medline]
Gu, M. and Majerus, P. W. (1996). The
properties of the protein tyrosine phosphatase PTPMEG. J. Biol.
Chem. 271,27751
-27759.
Gu, M. X., York, J. D., Warshawsky, I. and Majerus, P. W.
(1991). Identification, cloning, and expression of a cytosolic
megakaryocyte protein-tyrosine-phosphatase with sequence homology to
cytoskeletal protein 4.1. Proc. Natl. Acad. Sci. USA
88,5867
-5871.
Hamada, K., Shimizu, T., Matsui, T., Tsukita, S. and Hakoshima, T. (2000). Structural basis of the membrane-targeting and unmasking mechanisms of the radixin FERM domain. EMBO J. 19,4449 -4462.[CrossRef][Medline]
Han, S., Williams, S. and Mustelin, T. (2000). Cytoskeletal protein tyrosine phosphatase PTPH1 reduces T cell antigen receptor signaling. Eur. J. Immunol. 30,1318 -1325.[CrossRef][Medline]
Herrmann, L., Dittmar, T. and Erdmann, K. S.
(2003). The protein tyrosine phosphatase PTP-BL associates with
midbody and is involved in the regulation of cytokinesis. Mol.
Biol. Cell 14,230
-240.
Higashitsuji, H., Arii, S., Furutani, M., Imamura, M., Kaneko, Y., Takenawa, J., Nakayama, H. and Fujita, J. (1995). Enhanced expression of multiple protein tyrosine phosphatases in the regenerating mouse liver: isolation of PTP-RL10, a novel cytoplasmic-type phosphatase with sequence homology to cytoskeletal protein 4.1. Oncogene 10,407 -414.[Medline]
Hirao, M., Sato, N., Kondo, T., Yonemura, S., Monden, M.,
Sasaki, T., Takai, Y., Tsukita, S. and Tsukita, S. (1996).
Regulation mechanism of ERM (ezrin/radixin/moesin) protein/plasma membrane
association: possible involvement of phosphatidylinositol turnover and
Rho-dependent signaling pathway. J. Cell Biol.
135, 37-51.
Hunter, T. (1997). Oncoprotein networks. Cell 88,333 -346.[CrossRef][Medline]
Laux, T., Fukami, K., Thelen, M., Golub, T., Frey, D. and
Caroni, P. (2000). GAP43, MARKS, and CAP23 modulate
PI(4,5)P2 at plasmalemmal rafts, and regulate cell cortex actin
dynamics through a common mechanism. J. Cell Biol.
149,1455
-1471.
Maekawa, K., Imagawa, N., Nagamatsu, M. and Harada, S. (1994). Molecular cloning of a novel protein-tyrosine phosphatase containing a membrane-binding domain and GLGF repeats. FEBS Lett. 337,200 -206.[CrossRef][Medline]
Manes, S., Mira, E., Gomez-Mouton, C., Lacalle, R. A., Keller, P., Labrador, J. P. and Martinez-A, C. (1999). Membrane raft microdomains mediate front-rear polarity in migrating cells. EMBO J. 18,6211 -6220.[CrossRef][Medline]
Mangeat, P., Roy, C. and Martin, M. (1999). ERM proteins in cell adhesion and membrane dynamics. Trends Cell Biol. 9,187 -192.[CrossRef][Medline]
Martin, M., Roy, C., Montcourrier, P., Sahuquet, A. and Mangeat, P. (1997). Three determinants in ezrin are responsible for cell extension activity. Mol. Biol. Cell 8,1543 -1557.[Abstract]
Mauro, L. J. and Dixon, J. E. (1994). `Zip codes' direct intracellular protein tyrosine phosphatases to the correct cellular `address'. Trends Biochem. Sci. 19,151 -155.[CrossRef][Medline]
Moller, N. P., Moller, K. B., Lammers, R., Kharitonenkov, A.,
Sures, I. and Ullrich, A. (1994). Src kinase associates with
a member of a distinct subfamily of protein-tyrosine phosphatases containing
an ezrin-like domain. Proc. Natl. Acad. Sci. USA
91,7477
-7481.
Murthy, K. K., Clark, K., Fortin, Y., Shen, S. H. and Banville,
D. (1999). ZRP-1, a zyxin-related protein, interacts with the
second PDZ domain of the cytosolic protein tyrosine phosphatase hPTP1E.
J. Biol. Chem. 274,20679
-20687.
Neel, B. G. and Tonks, N. K. (1997). Protein tyrosine phosphatases in signal transduction. Curr. Opin. Cell Biol. 9,193 -204.[CrossRef][Medline]
Niggli, V., Andreoli, C., Roy, C. and Mangeat, P. (1995). Identification of a phosphatidylinositol-4,5-bisphosphate-binding domain in the N-terminal region of ezrin. FEBS Lett. 376,172 -176.[CrossRef][Medline]
Ogata, M., Takada, T., Mori, Y., Oh-hora, M., Uchida, Y.,
Kosugi, A., Miyake, K. and Hamaoka, T. (1999). Effects of
overexpression of PTP36, a putative protein tyrosine phosphatase, on cell
adhesion, cell growth, and cytoskeletons in HeLa cells. J. Biol.
Chem. 274,12905
-12909.
Palmer, A., Zimmer, M., Erdmann, K. S., Eulenburg, V., Porthin, A., Heumann, R., Deutsch, U. and Klein, R. (2002). EphrinB phosphorylation and reverse signaling: regulation by src kinases and PTP-BL phosphatase. Mol. Cell 9, 724-737.
Payrastre, B., Missy, K., Giuriato, S., Bodin, S., Plantavid, M. and Gratacap, M. P. (2001). Phosphoinositides: key players in cell signalling, in time and space. Cell. Signal. 13,377 -387.[CrossRef][Medline]
Roy, C., Martin, M. and Mangeat, P. (1997). A
dual involvement of the amino-terminal domain of ezrin in F- and G-actin
binding. J. Biol. Chem.
272,20088
-20095.
Saras, J., Claesson-Welsh, L., Heldin, C. H. and Gonez, L.
J. (1994). Cloning and characterization of PTPL1, a protein
tyrosine phosphatase with similarities to cytoskeletal-associated proteins.
J. Biol. Chem. 269,24082
-24089.
Saras, J., Franzen, P., Aspenstrom, P., Hellman, U., Gonez, L.
J. and Heldin, C. H. (1997). A novel GTPase-activating
protein for Rho interacts with a PDZ domain of the protein-tyrosine
phosphatase PTPL1. J. Biol. Chem.
272,24333
-24338.
Sato, T., Irie, S., Kitada, S. and Reed, J. C.
(1995). FAP-1: a protein tyrosine phosphatase that associates
with Fas. Science 268,411
-415.
Sawada, M., Ogata, M., Fujino, Y. and Hamaoka, T. (1994). cDNA cloning of a novel protein tyrosine phosphatase with homology to cytoskeletal protein 4.1 and its expression in T-lineage cells. Biochem. Biophys. Res. Commun. 203,479 -484.[CrossRef][Medline]
Shisheva, A. (2001). PIKfyve: the road to PtdIns 5-P and PtdIns 3,5-P2. Cell Biol. Int. 25,1201 -1206.[CrossRef][Medline]
Smith, A. L., Mitchell, P. J., Shipley, J., Gusterson, B. A., Rogers, M. V. and Crompton, M. R. (1995). Pez: a novel human cDNA encoding protein tyrosine phosphatase- and ezrin-like domains. Biochem. Biophys. Res. Commun. 209,959 -965.[CrossRef][Medline]
Tonks, N. K., Diltz, C. D. and Fischer, E. H.
(1988). Purification of the major protein-tyrosine-phosphatases
of human placenta. J. Biol. Chem.
263,6722
-6730.
Tonks, N. K. and Neel, B. G. (2001). Combinatorial control of the specificity of protein tyrosine phosphatases. Curr. Opin. Cell Biol. 13,182 -195.[CrossRef][Medline]
Uchida, Y., Ogata, M., Mori, Y., Oh-hora, M., Hatano, N. and Hamaoka, T. (2002). Localization of PTP-FERM in nerve processes through its FERM domain. Biochem. Biophys. Res. Commun. 292,13 -19.[CrossRef][Medline]
Wadham, C., Gamble, J. R., Vadas, M. A. and Khew-Goodall, Y. (2000). Translocation of protein tyrosine phosphatase Pez/PTPD2/PTP36 to the nucleus is associated with induction of cell proliferation. J. Cell Sci. 113,3117 -3123.[Abstract]
Wallace, M. J., Fladd, C., Batt, J. and Rotin, D.
(1998). The second catalytic domain of protein tyrosine
phosphatase delta (PTP delta) binds to and inhibits the first catalytic domain
of PTP sigma. Mol. Cell. Biol.
18,2608
-2616.
Wang, B. M., Weiner, N. D., Takada, A. and Schacht, J. (1984). Characterization of aminoglycoside-lipid interactions and development of a refined model for ototoxicity testing. Biochem. Pharmacol. 33,3257 -3262.[CrossRef][Medline]
Yang, Q. and Tonks, N. K. (1991). Isolation of
a cDNA clone encoding a human protein-tyrosine phosphatase with homology to
the cytoskeletal-associated proteins band 4.1, ezrin, and talin.
Proc. Natl. Acad. Sci. USA
88,5949
-5953.
Yonemura, S., Matsui, T., Tsukita, S. and Tsukita, S.
(2002). Rho-dependent and -independent activation mechanisms of
ezrin/radixin/moesin proteins: an essential role for polyphosphoinositides in
vivo. J. Cell Sci. 115,2569
-2580.
Zhang, Z. Y. (2001). Protein tyrosine phosphatases: prospects for therapeutics. Curr. Opin. Chem. Biol. 5,416 -423.[CrossRef][Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
N. Stenzel, C. P. Fetzer, R. Heumann, and K. S. Erdmann PDZ-domain-directed basolateral targeting of the peripheral membrane protein FRMPD2 in epithelial cells J. Cell Sci., September 15, 2009; 122(18): 3374 - 3384. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Ghiran, A. M. Glodek, G. Weaver, L. B. Klickstein, and A. Nicholson-Weller Ligation of erythrocyte CR1 induces its clustering in complex with scaffolding protein FAP-1 Blood, October 15, 2008; 112(8): 3465 - 3473. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. An, J. B. Blumer, M. L. Bernard, and S. M. Lanier The PDZ and Band 4.1 Containing Protein Frmpd1 Regulates the Subcellular Location of Activator of G-protein Signaling 3 and Its Interaction with G-proteins J. Biol. Chem., September 5, 2008; 283(36): 24718 - 24728. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. J Welters, A. Oknianska, K. S Erdmann, G. U Ryffel, and N. G Morgan The protein tyrosine phosphatase-BL, modulates pancreatic {beta}-cell proliferation by interaction with the Wnt signalling pathway J. Endocrinol., June 1, 2008; 197(3): 543 - 552. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Dromard, G. Bompard, M. Glondu-Lassis, C. Puech, D. Chalbos, and G. Freiss The Putative Tumor Suppressor Gene PTPN13/PTPL1 Induces Apoptosis through Insulin Receptor Substrate-1 Dephosphorylation Cancer Res., July 15, 2007; 67(14): 6806 - 6813. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. F. J. Ceccarelli, H. K. Song, F. Poy, M. D. Schaller, and M. J. Eck Crystal Structure of the FERM Domain of Focal Adhesion Kinase J. Biol. Chem., January 6, 2006; 281(1): 252 - 259. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Balla Inositol-lipid binding motifs: signal integrators through protein-lipid and protein-protein interactions J. Cell Sci., May 15, 2005; 118(10): 2093 - 2104. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Villa, M. Deak, G. B. Bloomberg, D. R. Alessi, and D. M. F. van Aalten Crystal Structure of the PTPL1/FAP-1 Human Tyrosine Phosphatase Mutated in Colorectal Cancer: EVIDENCE FOR A SECOND PHOSPHOTYROSINE SUBSTRATE RECOGNITION POCKET J. Biol. Chem., March 4, 2005; 280(9): 8180 - 8187. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. G. Wansink, W. Peters, I. Schaafsma, R. P. M. Sutmuller, F. Oerlemans, G. J. Adema, B. Wieringa, C. E. E. M. van der Zee, and W. Hendriks Mild impairment of motor nerve repair in mice lacking PTP-BL tyrosine phosphatase activity Physiol Genomics, September 16, 2004; 19(1): 50 - 60. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. P. DiNitto, T. C. Cronin, and D. G. Lambright Membrane Recognition and Targeting by Lipid-Binding Domains Sci. Signal., December 16, 2003; 2003(213): re16 - re16. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||