spacer gif spacer gif spacer gif spacer gif spacer gif
 QUICK SEARCH:   [advanced]


spacer gif
     Home     Help     Feedback     Subscriptions     Archive     Search     Table of Contents    

First published online 13 May 2003
doi: 10.1242/jcs.00468


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Movies
Right arrow All Versions of this Article:
jcs.00468v1
116/13/2707    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Parton, R. M.
Right arrow Articles by Watahiki, M. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Parton, R. M.
Right arrow Articles by Watahiki, M. K.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?
Journal of Cell Science 116, 2707-2719 (2003)
Copyright © 2003 The Company of Biologists Limited
doi: 10.1242/jcs.00468


Research Article

Pollen tubes exhibit regular periodic membrane trafficking events in the absence of apical extension

Richard M. Parton*, Sabine Fischer-Parton, Anthony J. Trewavas and Masaaki K. Watahiki

Institute of Cell and Molecular Biology, University of Edinburgh, Mayfield Road, Edinburgh EH9 3JU, UK

* Author for correspondence (e-mail: richard.parton{at}ed.ac.uk)

Accepted 10 March 2003


    Summary
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 References
 
The growing pollen tube provides an excellent single cell model system in which to study the mechanisms determining growth regulation, polarity and periodic behaviour. Previously, using FM4-64, we identified periodic movements within the apical vesicle accumulation that were related to the period of oscillatory growth. This suggested a more complex interdependence between membrane traffic, apical extension and periodicity than previously thought. To investigate this a comparison was made between normally growing and Brefeldin-A-treated, non-growing, tubes. Brefeldin-A treatment established an intriguing, stable yet dynamic system of membrane aggregations in the pollen tube tip that exhibited regular movements of material with a 5-7 second period compared with the normal ~30 second periodicity observed in growing tubes. Heat treatment was found to reduce period length in both cases. After BFA treatment membrane was demonstrated to flow from the extreme pollen tube apex back through a distinct subapical Brefeldin-A-induced membrane accumulation. The effects of Brefeldin-A on the distribution of ER- and Golgi-targeted fluorescent proteins revealed that ER did not contribute directly to the system of membrane aggregations while only certain compartments of the Golgi might be involved. The involvement of membrane derived from the apical vesicle accumulation was strongly implicated. Calcium measurements revealed that Brefeldin-A abolished the typical tip-focused calcium gradient associated with growth and there were no obvious periodic fluctuations in apical calcium associated with the continued periodic Brefeldin-A membrane aggregation associated movements. Our experiments reveal an underlying periodicity in the pollen tube that is independent of secretion, apical extension and the oscillating tip-focused calcium gradient normally associated with growth, but requires an active actin cytoskeleton.

Key words: Oscillating growth, Pollen tube, Brefeldin A, Membrane trafficking


    Introduction
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 References
 
The angiosperm pollen tube, or male gametophyte, is a highly polarised, rapidly tip-growing plant cell, specialised to deliver genetic material from the site of pollination on the flower stigma to the site of fertilisation at the ovule (Heslop-Harrison, 1987Go). Combined with their relative ease of experimental manipulation, these features make the pollen tube a valuable model system for the study of processes associated with polarity and growth at the single cell level (Feijó et al., 2001Go; Hepler et al., 2001Go).

One of the most intriguing aspects of pollen tube growth, which is shared with tip-growing fungal hyphae and plant root hairs, is the phenomenon of periodicity or oscillation in growth rate (Lopez-Francó et al., 1994Go; Pierson et al., 1996Go; Wymer et al., 1997Go). Animal neurons, which also extend by tip growth, do not appear to exhibit such regular periodicity, although they do undergo growth rate fluctuations triggered by environmental cues and dependent upon apical fluctuations in intracellular calcium (Gomez and Spitzer, 1999Go). Pollen tube growth rate and orientation are also closely linked to intracellular calcium signals at the tip – most notably the oscillating tip-focused gradient that exhibits the same periodicity as growth rate (Malhó et al., 2000Go; Hepler et al., 2001Go). Several other growth associated periodic phenomenon in the pollen tube have been noted including other ion gradients and fluxes at the apex (Messerli and Robinson, 1998Go; Feijó et al., 2001Go; Zonia et al., 2002Go), cell wall banding patterns (Pierson et al., 1995Go; Li et al., 1996Go) and dynamics of the apical vesicle accumulation (Parton et al., 2001Go). Despite recent interest, the significance of growth rate periodicity, the underlying driving force, how it is integrated with the other mechanisms involved in tip growth as well as how widespread this phenomenon is in different pollen tube species are not well understood.

In our previous studies, using FM4-64 as a marker of the apical vesicle accumulation, we observed an apparent structural organisation and clear periodicity in the movements of labelled material comprising the apical vesicle accumulation that was closely related to the periodicity of growth rate fluctuation (Parton et al., 2001Go). These findings suggested the possibility of a regulated periodicity to membrane traffic and vesicle trafficking at the pollen tube tip and prompted us to question the relationship between the movements of the apical vesicle accumulation, apical extension and periodicity. Such movements of vesicles and endomembranes recorded by light microscopy, which may also include vesicle budding and fusion events, we have termed here `membrane traffic' distinct from `vesicle traffic' which here specifically implies the involvement of vesicle budding and fusion.

Like other tip-growing cells such as fungal hyphae (Fischer-Parton et al., 2000Go); growth neurones (Andersen and Bi, 2000Go); root hairs (Wymer et al., 1997Go) and rhizoids (Bartnik and Sievers, 1988Go; Parton et al., 2000Go), in pollen tubes the distinct localised apical vesicle accumulation is associated with exocytic delivery of material to the extending apex (Steer and Steer, 1989Go; Lancelle and Hepler, 1992Go; Cheung et al., 2002Go). In the pollen as well as root hairs and fungal hyphae there are also reports of endocytosis associated with tip growth (O'Driscoll et al., 1993Go; Derksen et al., 1995Go; Blackbourn and Jackson, 1996Go; Wymer et al., 1997Go; Fischer-Parton et al., 2000Go).

In living pollen tubes of Lilium longiflorum we showed that Brefeldin-A (BFA) reproducibly leads to the loss of the FM4-64 labelled apical vesicle accumulation which correlates with a rapid, BFA concentration dependent, decline in growth rate, inhibition of secretion and the subsequent appearance of an `undefined structure' which accumulated label [see Fig. 9 (Parton et al., 2001Go)]. Previous studies have established that BFA, a known inhibitor of vesicle production in plant and animal cells (Ritzenthaler et al., 2002Go), blocks secretion of cell wall material in tobacco pollen tubes resulting in growth arrest (Rutten and Knuiman, 1993Go; Geitmann et al., 1996Go; Ueda et al., 1996Go).



View larger version (36K):
[in this window]
[in a new window]
 
Fig. 9. Periodic growth fluctuations for different pollen species determined from bright field image sequences. Distance grown and interval growth rate (between consecutive images) are plotted against time.

 

In mammalian cells BFA has been shown to block COPI coatomer protein mediated vesicle trafficking by interfering in the complex between GTPase ADP ribosylation factor 1 (Arf1) and its guanine nucleotide exchange factor Sec7 domain by locking it in its inactive form with GDP (Robineau et al., 2000Go; Rohn et al., 2000Go).

In the present study we initially characterised the dynamic nature and origins of our previously undefined BFA-induced structure and noted an apparent periodicity in the membrane trafficking associated with it that had not been reported before. These observations of what appeared to be periodic behaviour associated with a non-growing tube prompted us to investigate this phenomenon in relation to the normal expression of periodicity in growth rate, membrane trafficking at the apex and the oscillating tip-focused gradient in intracellular calcium associated with growing tubes. Our findings lead us to propose that the periodicity exhibited in the vesicle cloud movements (Parton et al., 2001Go) during normal growth may be the expression of an underlying periodicity that contributes to periodicity in growth rates in pollen tubes rather than being dependent upon it.


    Materials and Methods
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 References
 
Chemicals and materials
Chemicals for culture media were obtained from BDH Chemicals (Poole, Dorset, UK) or Fisher Scientific (Loughborough, UK). Dyes and inhibitors were obtained from Molecular Probes Europe (Leiden, Netherlands) or Calbiochem-Novabiochem LTD (Nottingham, UK) and made up as recommended by the supplier. Solvent concentration was kept below 1% (v/v).

Plant material
Pollen of Nicotiana tabacum, N. plumbaginifolia and Arabidopsis thaliana was collected fresh from plants cultured under glass at the University of Edinburgh. L. longiflorum pollen was obtained from fresh cut flowers obtained locally.

Media used for pollen culture were: as described (Read et al., 1993Go) for the Nicotiana species; modified from that described (Feijó et al., 1999Go), by the addition of 2 mM CaCl2, for L. longiflorum, and modified to 0.01% Boric acid, 0.07% CaCl2, 3% PEG 6000, 10% sucrose (w/v) from that described (Hodgkin, 1983Go) for Arabidopsis thaliana. Growth media and conditions were selected for rapid growth rate and even, straight tube morphology. Batches of cultured tubes or individuals showing slow or irregular growth were not included for analysis.

Where culture medium was used at increased concentrations relative to normal strength (100%); this was diluted from double strength medium (200%) and quoted as percentage strength. Pollen was imbibed for 10 to 30 minutes in the appropriate liquid medium before transfer to thin layer growth chambers, as described (Parton et al., 2001Go) and incubated in a humid environment for 3 to 12 hours (at 20-25°C).

Targeting and expression of fluorescent proteins
Targeting of GFP to the ER was achieved by expression of mGFP5-ER [based upon the C-terminal `HDEL' ER retrieval signal and N-terminal ER transit peptide (Pelham, 1989Go; Haseloff et al., 1997Go; Ridge et al., 1999Go)] in pollen expression vector pART16. Golgi apparatus targeting was achieved by the expression of GT-EYFP [EYFP-Golgi: based upon the N-terminal 81 amino acid targeting sequence of the Golgi resident, type II membrane protein, human ß-1,4-galactosyltransferase (Roth and Berger, 1982Go; Palacpac et al., 1999Go), Clontech, Basingstoke, UK] in pART16. The Golgi apparatus was also targeted with the GONST1-YFP sequence [based upon the Arabidopsis Golgi localised GDP-mannose transporter, accession number AJ314836 (Baldwin et al., 2001Go)] in pART16. Cytoplasmic localised GFP expression was achieved with tandem linked soluble GFPs (smGFP) (Davis and Vierstra, 1998Go) in pART16.

The pART16 pollen expression vector was constructed on pT7Blue-3 cloning vector (Novagen, Darmstadt, Germany). The promoter region and 5'UTR were amplified by PCR using SC5-122SN (TAGAGCTCGCGGCCGCAATCGCATCTCATATGTC) and ASC5-1920XH (GGCCTCGAGTGCCCGCTAGCTTGTAGTTGAATC). The OCS terminator and multiple cloning site of pART7 (Gleave, 1992Go) were cut out with NotI and XhoI restriction enzymes. Fragments of ZmC5 promoter (Wakeley et al., 1998Go), 5' UTR, multiple cloning site, and OCS terminator were cloned into KpnI, NotI site of pT7Blue-3. The resulting construct was named pART16 and contained the same multiple cloning site as pART7 but also included kanamycin resistance.

Transient expression of fluorescent protein constructs in pollen was achieved by biolistic bombardment (with DNA-coated 1 or 1.6 µm gold particles) of wetted pollen as described (Kost et al., 1998Go).

Subcellular localisation of fluorescent protein tagged constructs was confirmed by transient expression in onion epidermis under the 35S promotor (biolistic bombardment), examined by confocal microscopy.

Microscopy and imaging
Differential interference contrast (DIC) video imaging at up to 1 image/400 millisecond was performed using a Nikon TMD inverted microscope, x40 DIC 0.85 NA objective and Orca-ER cooled CCD camera (Hamamatsu Photonics, Japan) driven by the Improvision Openlab software 3.04. Images were processed and quantitatively analysed in ImageJ V1.27z (National Institutes of Health, USA, http://rsb.info.nih.gov.ij).

Confocal microscopy was performed using a Leica TCS SP Confocal Microscope as described (Parton et al., 2001Go). x63 Leica water immersion plan apo (NA 1.2) and x20 multi-immersion (NA 0.75) objectives were used throughout. Images were imported into ImageJ for quantitative analysis or Adobe Premiere 5.1 for generation of video clips. Excitation and emission wavelengths for fluorochromes are given in Table 1. Loading of cells with stains was achieved by application during the imbibition of pollen grains in liquid medium or by direct addition of dye solutions in 115% liquid medium to growing tubes on thin gel layers. Inhibitors were applied directly to growing pollen tubes on thin gel layers in 70 µl of 115-120% liquid medium.


View this table:
[in this window]
[in a new window]
 
Table 1. Excitation and emission wavelengths of fluorochromes

 

Fluorescence-recovery-after-photobleaching experiments were performed on the confocal imaging system using the 514 nm laser line and the bleach protocol of the TCSNT software.

Heat treatments were imposed using a heated stage against a room temperature of 20±1°C; culture medium temperature was constantly monitored via a thermocouple (type T) temperature probe.

Simultaneous dual channel confocal ratio imaging of cytosolic [Ca2+] was carried out using a mixture of Texas Red (TR)-10,000 kDa Dextran (volume marker) and Oregon Green 488 BAPTA (OG-488)-10,000 kDa Dextran (Calcium sensor). A 1:1 (~1 mM each) dye mixture was injected into pollen tubes using a customised version of the pressure probe injection system (Oparka et al., 1991Go). Quantitative analysis and ratio image generation were done in ImageJ.


    Results
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 References
 
BFA treatment of pollen tubes gives rise to a distinct structure within the cytoplasm of the tip
As reported previously (Parton et al., 2001Go), BFA treatment results in a particular re-organisation of the cytoplasm at the pollen tube apex, easily seen with FM4-64 staining (Fig. 1A-D). In brief, 15-60 minutes after BFA application (depending upon concentration), the FM4-64 membrane-staining pattern at the pollen tube tip (Fig. 1A; Movie 1, http://jcs.biologists.org/supplemental) was disrupted such that the extreme apical staining was more diffuse and less well localised, no longer exhibiting the characteristic `V'-shaped pattern within the apical clear zone. Even more obvious was the emergence of a distinct, relatively large (5-10 µm diameter in L. longiflorum), intensely stained subapical structure or aggregation of membrane material (confirmed by Nile Red membrane labelling, not shown) which we have termed the BFA-induced aggregation or BIA (Fig. 1B; Movie 2). These events were remarkably consistent within populations of cells and for the different effective BFA concentrations used between 3.0 and 36 µM (concentrations leading to growth arrest and BIA structures in at least 50% of intact tubes). Similar reorganisation was also observed in BFA-treated N. plumbaginifolia pollen tubes (Fig. 1C,D).



View larger version (93K):
[in this window]
[in a new window]
 
Fig. 1. BFA effects the organisation of living pollen tube tips. Confocal images of FM4-64 distribution in L. longiflorum (A,B) and N. plumbaginifolia (C,D) before and 30-60 minutes after 3.6 µM BFA treatment. (E-F) Confocal images of mitofluor staining before and after BFA treatment in L. longiflorum. (G-H) Schematic of cytoplasmic movements in (G) growing and (H) BFA-treated pollen tube, based upon image sequences. (I) Projected time series of an FM4-64-stained, BFA-treated tube showing tracks of movement. Bars, 15 µm (A,B,E,F) or 10 µm (C,D); corresponding bright field images shown at one-third size.

 

Reversibility of BFA effects has previously been reported for plant cell culture (Ritzenthaler et al., 2002Go); however, in pollen tubes and fungal hyphae only partial reversal has been reported (Rutten and Knuiman, 1993Go; Cole et al., 2000Go). We found that when L. longiflorum pollen tubes that had been treated for 2-4 hours with BFA (10 µM) were subjected to 3 hours of continuous perfusion with fresh medium, the BFA-induced rearrangements became less distinct but growth did not resume.

Polarity and streaming are altered but not abolished by BFA treatment
In order to characterise how the dynamic organisation of the pollen tube tip was altered by BFA treatment, a picture of the apical zonation and streaming pathways of growing and BFA treated non-growing L. longiflorum pollen tubes was built up.

The `reverse-fountain' streaming path is well known for pollen tubes, different organelles can be observed to follow slightly different trajectories and there is an obvious `non streaming' region within a cone-shaped region of the apex corresponding to the apical vesicle accumulation (Heslop-Harrison, 1987Go; Parton et al., 2001Go). Mitofluor Green staining was used as a convenient marker of the streaming path followed by mitochondria (Fig. 1E; Movie 3). The structurally closely related dye Mitotracker Green has been used previously to label mitochondria in plant cells (Coelho et al., 2002Go) and the distribution of mitochondria in pollen tubes was independently confirmed by staining mitochondrial DNA with Syto 16 (not shown). The paths of lipid storage droplets and amyloplasts could easily be followed by DIC microscopy.

In BFA-treated tubes, although vigorous reverse-fountain cytoplasmic streaming continued it could be seen to have shifted further from the tube apex to behind the BIA. Mitochondria, which in growing tubes follow a streaming pathway very close to the tip, along the flanks of the apical clear zone (Fig. 1E,G; Movie 3), after BFA treatment showed a distribution restricted to no further than the site of the BIA (Fig. 1F,H; Movie 4). The situation was the same for lipid storage droplets and amyloplasts (Fig. 1H). Yet cytoplasmic movements in front of the BIA were not completely abolished. Within the region, which would in a growing tube (Fig. 1G; Movies 1, 3) be occupied by the apical vesicle accumulation, movement of clumped material could be seen associated with the BIA (Fig. 1I; Movies 2, 4, 5). These clumps of material (BIA-associated membrane aggregations) periodically `materialised' and migrated from the extreme apex towards the BIA with which they appeared to merge.

Flow of material can be tracked through the BFA-induced membrane aggregation
The movement of BIA associated aggregations was tracked, by FM4-64 staining, from the tip towards the BIA along `track-like' strands projecting out from the BIA itself (Fig. 1B,H,I; Movies 2, 5; and see below). Movement of material through the BIA itself was investigated by FRAP analysis (Fig. 2). Material was shown to be displaced from the anterior side of the BIA away from the tip by the subapical displacement of bleached spots (Fig. 2A). The recovery of fluorescence at the location of the bleached areas appeared to be by incorporation of new stained membrane from the BIA-associated aggregations into the BIA and displacement of bleached membrane away from the tip. The displaced bleached area also showed slight recovery in fluorescence, probably by diffusion (Fig. 2A'). Displacement of material through the BIA was distinguished from simply diffusion of free dye by following the progress of two separate but adjacent bleached spots, which remained distinctly separate as they migrated away from the tip. Recovery was slow, suggesting an absence of mixing and limited free diffusion of dye within the BIA (Fig. 2A).



View larger version (68K):
[in this window]
[in a new window]
 
Fig. 2. Movement of material into and through the BIA of L. longiflorum pollen tubes followed by confocal FRAP of FM4-64. (A) Bleaching within the BIA; (B) bleaching of the apical region. Sites of photobleaching indicated on bright field images. Time is in seconds after bleaching. (A') Fluorescence intensity at the original location of the bleach site and `following' the displaced region of bleached fluorescence (see insert diagrams). (B') Fluorescence intensity at an apical bleach site and within the BIA. Bars, 15 µm.

 

Photobleaching within the extreme apex supported the observation that this was the source of stained membrane trafficked through the BIA (Fig. 2B). Following the apical bleach and transient reduction in apical fluorescence there was a clear transient drop in the fluorescence of the BIA that subsequently showed a general increase. Superimposed upon the general increase in fluorescence there also appeared to be a periodic fluctuation in the brightness of the BIA (Fig. 2B'). It should also be noted at this point that the overall size of the BIA did not appear to steadily increase – suggesting that material was also lost (discussed later). The periodic movements were not halted by the bleach procedure.

Organisation and dynamics of the BIA are actin dependent
In pollen tube tip growth the actin cytoskeleton is involved in cytoplasmic streaming and vesicle transport (Hepler et al., 2001Go). The involvement of actin in the periodic movements of membrane (BIA-associated aggregations) between the extreme apex and subapical Brefeldin-A-induced structure was investigated with drugs known to affect the actin cytoskeleton.

Cytochalasin-D applied to normally growing L. longiflorum pollen tubes at relatively low concentrations (1.5 µM) rapidly arrests growth and disperses the apical FM4-64 staining pattern (Parton et al., 2001Go). A similar treatment with Cytochalasin D applied to BFA-treated cells had little effect on the staining pattern. Concentrations of 5.0 µM and higher were required before obvious effects were noticed. At these concentrations the movement of material to the subapical BIA was rapidly arrested and the structure itself dissipated (Fig. 3A).



View larger version (79K):
[in this window]
[in a new window]
 
Fig. 3. A functional actin cytoskeleton is required to maintain the BIA and associated movements. Effects of (A) 5.0 µM cytochalasin D and (B) 2.0 µM Jasplakinolide on BFA (3.6 µM)-treated L. longiflorum pollen tubes labeled with FM4-64. Times are in seconds. Bars, 15 µm.

 

The actin cytoskeleton `stabilising' drug Jasplakinolide (Ou et al., 2002Go) at only 2 µM rapidly blocked the periodic trafficking of material to the BIA and disrupted the general apical zonation but did not directly dissipate the membrane aggregation (Fig. 3B). Only with extended times after application of Jasplakinolide (>5 minutes) did there appear to be some dissociation of the BIA, by which time cytoplasmic streaming had effectively halted. At 2 µM Jasplakinolide also blocked tip growth of normally extending pollen tubes.

The BIA incorporates markers of the apical vesicle accumulation but not the ER
Having established the trafficking of material between the apex and BIA it was important to determine its nature. That BFA interferes in vesicle trafficking and secretion in animal and plant cells is now well documented, it was therefore reasonable to presume that the BFA induced apical reorganisation was the result of endomembrane system disruption.

Fluorescent labels of membranes (FM4-64), lipid (Nile Red, not shown) and the cytosol (targeted GFP; 10,000 kDa dextran-dye conjugates; Figs 1, 4) showed by dye accumulation, or in the case of the cytosolic markers, by dye exclusion, that the BIA consists of lipid as membranes. The associated aggregations appeared to be of similar nature as their movements could be followed with the various labels.



View larger version (34K):
[in this window]
[in a new window]
 
Fig. 4. Consecutive confocal images (interval 1.5 seconds) of a BFA (3.6 µM)-treated tube expressing cytoplasmic targeted GFP. Bar, 15 µm.

 

In previous studies into BFA effects on pollen tubes, a membrane re-organisation was described in the apical region and attributed to redistribution of ER and Golgi membranes on the basis of EM analysis (Rutten and Knuiman, 1993Go; Geitmann et al., 1996Go). The origins of the BFA-induced aggregations observed here in L. longiflorum pollen tubes were investigated in vivo using ER and Golgi-targeted fluorescent proteins (Figs 5, 6, 7).



View larger version (134K):
[in this window]
[in a new window]
 
Fig. 5. ER and Golgi localisation in growing L. longiflorum pollen tubes shown by targeted fluorescent protein expression. (A-B) mGFP5-ER in (A) growing tube, sequential images (image/3 seconds) showing the dynamic nature of ER; (B) onion epidermis, showing the typical reticulate ER structure. (C-E') GT-EYFP: (C) Sequential images (image/2 seconds) of a growing tube revealing movement of targeted structures; (D) high expression levels; (E) in onion epidermis; (E') effects of BFA on labeling in onion epidermis. (F-G) GONST1-YFP expressed in growing L. longiflorum pollen tubes: (F) Sequential images (as for C); (G) high expression levels showing labelling of the apical vesicle accumulation. Inserts show bright field images at one-third size. Bars, 15 µm (A,C,D,F,G); 100 µm (B,E).

 


View larger version (125K):
[in this window]
[in a new window]
 
Fig. 6. (A-C) Differences in ER and Golgi involvement in the BIA and associated aggregates revealed by fluorescein protein expression in living L. longiflorum pollen tubes treated with 3.6 µM BFA. (A) mGFP5-ER redistribution (times in minutes). Arrowheads indicate fine structures projecting into the apex in the main picture and contrast adjusted insert. (B-C) Redistribution of Golgi markers GT-EYFP and GONST1-YFP (times after applying BFA in minutes). In all cases, before the 15-minute time-point tubes were still extending so images have been aligned from the tips. Images for time-points 40 minutes and longer are contrast adjusted to increase brightness relative to earlier time points. Arrowheads in C indicate the BIA. Inserts show bright field images at one-third size. Bars, 15 µm.

 


View larger version (104K):
[in this window]
[in a new window]
 
Fig. 7. GT-EYFP distribution after 40 minutes BFA (3.6 µM) treatment shows similarity to BFA effects on mGFP5-ER. The zoomed region shows labeled `projections' extending from the site of the BIA towards the apex (arrowheads). Bar, 15 µm.

 

In untreated, rapidly growing tubes, mGFP5-ER (Haseloff et al., 1997Go) expression clearly marked a region extending from the periphery of the apex back into more subapical regions (Fig. 5A). In median section there was less dense labelling within the `V-shaped' apical clear zone and almost total exclusion from the extreme apical (~3 µm) lens-shaped region, which corresponds to the apical vesicle accumulation as labelled by FM4-64. More towards the apex, the mGFP5-ER does not label a clear tubular structural organisation, as has previously been encountered with ER labelling in tip-growing cells (McCauley and Hepler, 1990Go; Cheung et al., 2002Go). Further back, distinct interconnected strands could be seen. Time-course analysis and rapid focusing up and down showed that mGFP5-ER localised to a dynamic 3D organisation (not shown), very different from the peripheral ER normally encountered with ER labelling in epidermal cells, but in agreement with EM images of ER distribution in the pollen tube tip (Pierson and Cresti, 1992Go; Lancelle and Hepler, 1992Go), fungal hyphae (Grove, 1978Go) and fern protonemata (Dyer and Cran, 1976Go). Very similar mGFP5-ER localisation was observed in tobacco pollen tubes (not shown). Expression of mGFP5-ER in onion epidermis showed the typical reticulate cortical-ER distribution (Fig. 5B).

GT-EYFP (Clontech) expression (Fig. 5C) produced a bright punctate pattern corresponding to roughly 1-2 µm diameter structures associated with a weak background fluorescence of a similar distribution to mGFP5-ER. The brightly labelled structures were scattered throughout the subapical region of pollen tubes but were effectively excluded from the whole apical hemisphere. The distribution and movement of the bright structures differed significantly from the labelling of mitochondria by Mitofluor Green (Fig. 1E). Movement of the GT-EYFP structures was slower and more stilted (based upon examination of time-sequence data) than that of mitochondria. At high levels of GT-EYFP expression, growth was slightly reduced and more sensitive to laser scanning while the level of background `ER-like' localisation was much higher (Fig. 5D). Expressed in onion epidermis, GT-EYFP clearly localised to the ER and to small roughly spherical structures that correspond to the expected distribution of Golgi bodies (Fig. 5E-E'). Partial distribution of other Golgi-targeted fluorescent proteins into the ER has been reported previously (Brandizzi et al., 2002Go; Saint-Jore et al., 2002Go).

The GONST1-YFP fusion protein, which targets to the Golgi in plant cells (Baldwin et al., 2001Go), produced a very similar punctate fluorescence to GT-EYFP in L. longiflorum pollen tubes (Fig. 5F). GONST1-YFP expression lacked the ER-like background of GT-EYFP but included a faint labelling of the V-shaped region of the apical vesicle accumulation. Labelling associated with the apical vesicle accumulation region was much clearer with high levels of expression (Fig. 5G). Growth rate and morphology were generally unaffected by this construct.

BFA treatment resulted in drastic redistribution of the mGFP5-ER (Fig. 6A) leaving no sign of the labelling at the periphery of the extreme apex. Redistribution correlated with the change in apical zonation observed in brightfield and with FM4-64 staining. The redistributed mGFP5-ER was largely restricted to behind the site of the BIA. No labelling of either the BIA or associated aggregations by mGFP5-ER was seen (Fig. 6A, >30 minutes). This was confirmed by co-labelling with FM4-64 that showed these aggregations to be present (not shown). However, it was generally possible to make out the staining of two fine strands originating from the extended region of dense subapical staining and projecting towards the apex (Fig. 6A, 40 minute time point). These strands corresponded to the tracking lanes of material passing from the apex to the BIA previously described (Fig. 1H). Little clear indication of periodic trafficking events occurring could be seen from the mGFP5-ER labelling; however, there was some evidence of periodic extension and retraction of the labelled `arm like' projections, described above, which correlated with the movements of FM4-64-stained material.

BFA treatment of GT-EYFP-expressing pollen tubes led to changes in the distribution, size and apparent numbers of the bright 1-2 µm structures, but even after growth arrest did not result in their complete disappearance (Fig. 6B). Soon after BFA application the bright structures could be seen to clump; subsequently, individual structures appeared enlarged. Redistribution of the weak background `ER-like' labelling was identical to that observed with the mGFP5-ER. As with mGFP5-ER, no clear labelling of the apical membrane aggregations or the BIA was seen, yet staining was again seen in fine strands that extended from the region of dense subapical staining towards the apex (Fig. 7).

The effects of BFA on the punctate structures of GONST1-YFP expressing pollen tubes were the same as for GT-EYFP (Fig. 6C). However with the GONST1-YFP construct, label appeared to be redistributed to the BIA and associated aggregations. From examination of time-series images material was seen to track between these compartments as described for FM4-64 labelling (Fig. 6C; 60 minute time point).

Movements associated with the BIA exhibit a regular periodicity
Following the characterisation of the BFA-induced phenomenon, in which we established that there is trafficking of membranes from the apex to a subapical membrane aggregation dependent upon an active actin cytoskeleton, we investigated the intriguing periodicity apparent in the trafficking of material.

Rapid time-course imaging using DIC confirmed that events occurred with a definite period (Fig. 8A; Movie 5). With imaging rates of 0.5-1 frames per second (FPS) it was possible to show that in non-growing BFA-treated L. longiflorum pollen tubes material entered the BIA with a period of 5-7 seconds (Table 2) sustained for at least 6 hours after their initial observation 30 minutes to 1 hour after BFA treatment (Fig. 8A').



View larger version (61K):
[in this window]
[in a new window]
 
Fig. 8. Periodic `trafficking events' at the tip of BFA-treated (1 hour, 3.6 µM) L. longiflorum pollen tubes. (A-A') DIC bright field image sequence and corresponding plot recording movement of material along the pollen tube axis as pixel intensity changes in a `sampling window' (highlighted in A). A single trafficking event is indicated in red. (B) As in A but with FM4-64 labelling. (B') Periodic movements of FM4-64-stained material along the pollen tube axis plotted as pixel intensity changes (gray circles) in a `sampling window' highlighted in the insert (white rectangle) over time, each movement event is marked with a vertical bar. The insert image is false-coloured to reveal the pattern of relative staining intensity: red, high fluorescence; blue, low fluorescence intensity. FM4-64 signal intensity within the BIA (black rectangle in insert image) is also plotted (black squares). The two plots were aligned by a -2.5 second shift in the BIA intensity plot. Bars, 15 µm.

 

View this table:
[in this window]
[in a new window]
 
Table 2. Periodic behaviour of BFA-treated pollen tubes

 

Having established the sampling rate required to report the periodicity, BFA-treated L. longiflorum pollen tubes stained with FM4-64 were imaged by low resolution confocal microscopy (1.5-3 FPS; Fig. 8B) in order to quantify fluorescence intensity within the BIA. This approach revealed that staining intensity of the BFA structure increased with fusion of the incoming membrane from the trafficking events but subsequently dropped between fusion events giving rise to a periodic fluctuation in signal. The rise in signal in the BIA appeared to be concurrent with the fusion event; however, the way in which the two parameters were measured, with regions of interest at two different locations, introduced an apparent lag in fluorescence increase relative to the recording of the movement of material (Fig. 8B' and insert diagram). In the example shown in Fig. 8B', the plot of movement was shifted by 2.5 seconds relative to the plot of intensity to compensate for this artefact. Note in some places the occurrence of shouldered peaks on the intensity trace. This is due to the two `sides' of the approaching loop of material (Fig. 8B) arriving slightly out of sync. Throughout, the BIA did not visibly increase in size with increasing numbers of fusion events. Coupled with the fluctuating fluorescence intensity (above) and FRAP data (Fig. 2) this confirms the loss of stained membrane from, or passage through the BIA.

Growth rate fluctuations are consistently of longer period than that associated with the BIA
The period of trafficking events after BFA treatment was not comparable with the regular growth fluctuations exhibited by L. longiflorum pollen tubes (~30 second period), which are of similar magnitude to growth fluctuations recorded for other species we tested under optimised growth conditions (Table 3; Fig. 9; see Materials and Methods) or the periodic movements of ~25-40 seconds of the apical vesicle accumulation within the cytoplasm of the tip (Parton et al., 2001Go).


View this table:
[in this window]
[in a new window]
 
Table 3. Periodic growth behaviour of pollen tubes

 

We investigated ways of perturbing the period of growth rate fluctuation without arresting growth and found that while moderate temperature shift had no significant effect, an increment of 10°C could reproducibly raise growth rate and reduce period duration in L. longiflorum pollen tubes (paired data t-test, P=0.05; Table 3; Fig. 10A). Heat treatment consistently increased apical diameter (Fig. 10B) and the tendency to apical rupture. Applying similar heat treatment to BFA-treated tubes also decreased period duration (paired data t-test, P=0.005; Table 2; Fig. 10C; Movie 6). The effects of different BFA concentrations, between 3.0 and 35 µM, were also directly compared; however no significant difference in period was found (t-test, P=0.05; Table 2).



View larger version (43K):
[in this window]
[in a new window]
 
Fig. 10. Temperature alters periodic behaviour in L. longiflorum pollen tubes. (A) A 10°C rise shortens the period of growth pulses and (B) increases tube diameter. (C) A 10°C rise shortens the period of trafficking events associated with the BIA. Bar, 20 µm.

 

The periodic movements associated with the BIA are not dependent upon a corresponding calcium signal
As has been previously reported (Feijó et al., 2001Go), in normally growing cells a clear tip-focused gradient in [Ca2+]c could be observed that fluctuated with the same period as the growth rate oscillation, whereas in BFA-treated cells, calcium imaging failed to show an obvious tip-focused calcium gradient (n=5) (Fig. 11). There was also no obvious fluctuation in [Ca2+]c at the extreme apex or more globally within the apex that we could relate to either the ~30 second periodicity seen with normal growth or the 5-7 second periodicity in BIA-associated aggregation movement (which continued as normal in the presence of dye; Fig. 11A; Movie 7). Note that regions of interest were sampled and ratios calculated for time-course data at different locations within the apical region, but avoiding areas corresponding directly to the BIA and associated aggregates where dye signal was poor due to exclusion (see insert image in Fig. 11A).



View larger version (56K):
[in this window]
[in a new window]
 
Fig. 11. Calcium ratio imaging of non-growing, BFA-treated (A) and growing (B) L. longiflorum pollen tubes. (A) Plots show the typical movement of material into the subapical membrane aggregation (closed circles; c.f. Fig. 2) and the apical intracellular calcium concentration (open squares: ratio OG 488/TR). Images are (top to bottom): a Texas Red fluorescence image (the BIA and associated aggregates appears dark); the corresponding projected TR image time-series displayed as a single `negative' image to show the path of movement of material; the corresponding ratio image. The areas sampled to produce the plots (rectangles) and location of the BIA (circled) and associated aggregates (arrowhead) are indicated. (B) Untreated pollen tube: plots show the typical oscillatory fluctuation in apical intracellular calcium concentration during growth (open squares: ratio OG 488/TR; the area sampled is shown on the insert image) and corresponding fluctuation in growth rate (closed circles). Insert images show OG 488/TR ratios corresponding to a consecutive minima and maxima in the tip-focused cytosolic calcium gradient. Bars, 10 µm.

 


    Discussion
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 References
 
At present it is not fully understood how growth processes are organised at the pollen tube tip to produce rapid growth with periodic fluctuations in rate. Our previous work (Parton et al., 2001Go) suggested that determination of periodicity in growth rate fluctuation perhaps involves regulated membrane and regulated vesicle trafficking rather than exclusively the fluctuating ion movements that have received most attention. Here we have addressed this hypothesis by interfering with the normal processes of vesicle trafficking and apical extension to determine whether periodicity in membrane trafficking is merely a consequence of periodic fluctuations in apical extension.

BFA as a tool to dissociate tip growth, vesicle trafficking and periodicity
This study has made use of the ability of BFA to block tip growth and secretory activity in pollen tubes in a rapid and reproducible manner at relatively low concentrations (Rutten and Knuiman, 1993Go; Geitmann et al., 1996Go; Ueda et al., 1996Go; Parton et al., 2001Go) while allowing other activities to continue. We did not find any significant difference in the final BFA-induced membrane aggregations over an ~10-fold concentration range (Table 2). Unlike previous work on BFA effects in pollen tubes, we have focused upon the dynamic behaviour of living treated tubes in comparison with that of normal growing tubes.

While the mode of action of BFA in mammals is generally accepted, the situation in plants is more contentious (see Introduction) with variation observed in BFA effects in different studies of plant cells. One major argument is that BFA has multiple sites of action or non-specific effects with higher concentrations and longer treatment times (Driouich and Staehelin, 1997Go; Satiat-Jeunemaitre et al., 1996Go; Ritzenthaler et al., 2002Go; Saint-Jore et al., 2002Go). A recent re-analysis of BFA effects (Ritzenthaler et al., 2002Go) in tobacco culture cells suggests similar effects to those on mammalian cells. It is possible that exact BFA effects depend upon the predominant vesicle trafficking processes operating, for example, in tip-growing pollen tubes this would be the secretion of materials for growth. In this respect it is significant that pollen tubes of both dicots and monocots show similar BFA effects. Geldner et al. discuss multiple ARF-GEF's in Arabidopsis, some of which are predicted to be BFA insensitive, some sensitive (Geldner et al., 2003Go). They speculate that the overall BFA effect on a cell is dependent upon the relative involvement of BFA sensitive and insensitive ARF-GEF's.

In our pollen tube work the low concentrations required, fast action, reproducibility (Parton et al., 2001Go) and species independence of BFA effects all argue that we are dealing with a fairly specific mode of action.

Non-growing pollen tubes can still exhibit polarised organisation and periodicity
A distinctly polar cytological organisation and periodic growth rate fluctuations appear to be features exhibited by several tip-growing cell types (López-Franco et al., 1994Go; Wymer et al., 1997Go; Hepler et al., 2001Go). However, it is not understood exactly how or why periodicity might be important or the mechanism by which periodicity is established and maintained (Feijó et al., 2001Go). Indeed, regular periodicity is not established in Lilium (Messerli and Robinson, 1997Go) or N. tabacum (Zonia et al., 2002Go) pollen tubes until a certain age or length is achieved and has not been recorded for all pollen species (Pierson et al., 1995Go). Nevertheless, periodicity in growth rate is clearly apparent during the rapid growth phase of several pollen species, including Lilium, Nicotiana, Agapanthus (Camacho et al., 2000Go) and Arabidopsis. Most research on pollen tube periodicity has focused upon how fluctuating ion entry and concentrations (most notably of calcium) relates to growth rate (Messerli et al., 2000Go; Holdaway-Clarke et al., 1997Go). Less attention has been paid to the periodic nature of cytoplasmic movements (Zonia et al., 2002Go; Parton et al., 2001Go).

With BFA treatment we have a situation where, although apical extension is halted, expression of both polarised and periodic behaviour continues. The periodic movements we observe within the apical cytoplasm are clearly not a direct consequence of the periodic fluctuations in apical extension. Furthermore, our findings show that periodicity in the pollen tube is not dependent upon rounds of active secretion of cell wall materials or weakening/tightening of the cell wall as the tip is extended, which are associated with cycles of stretching of the PM (Holdaway-Clarke et al., 1997Go; Messerli et al., 2000Go). It is possible that periodic trafficking of membrane may actually underlie the expression of growth rate periodicity. While Golgi-derived material is clearly implicated and plasma membrane might be involved we were unable to determine whether the phenomenon we have found has any links to endocytic activity.

Intriguingly, the periodicity of membrane trafficking exhibited by BFA-treated pollen tubes is of a significantly different frequency from the periodicity associated with normal tip growth, in apical extension rate and the movements of the apical vesicle cloud (5-7 seconds compared with ~30 seconds). However, we find it hard to imagine that the establishment of the observed periodicity is purely an artefact of BFA treatment. We think it more likely that the movements we see are related to those exhibited by the apical vesicle accumulation during normal growth and that BFA treatment has led to disruption of feed back mechanisms by which the normal period length is regulated (Feijó et al., 2001Go).

We have determined that period length in the pollen tube can be modified experimentally. With a 10°C raise in temperature we were able to convincingly reduce the period length of growth rate fluctuation in L. longiflorum pollen tubes and similar experimental manipulation also reduced period length in the BFA-associated phenomenon. These findings are significant in that they prove that we are dealing with a `simple' oscillatory mechanism, rather than a timing or `clock mechanism' (Kippert and Hunt, 2001Go) that would need to be temperature compensated (i.e. not perturbed by changes in temperature).

BFA-treated tubes exhibit dynamic activities that can be related to features of normal growth
Our investigations of the BIA and movement of associated aggregates by time-lapse and FRAP analysis show that we are not observing simply the cycling of membrane aggregates in the cytoplasmic flow but are following the occurrence of both bulk membrane translocation and some degree of vesicle trafficking between membrane pools – features that we can relate to the vesicle cloud movements observed during normal growth.

The path followed by the BIA-associated aggregates corresponds to the bulk membrane flow seen with FM4-64 staining of the apical vesicle accumulation of growing tubes (Parton et al., 2001Go). Furthermore this movement from the extreme apex in BFA-treated tubes was actin dependent (cytochalasin and jasplakinolide sensitive), as are the apical vesicle accumulation movements of growing tubes (Hepler et al., 2001Go). The organisation and movement of the BIA and associated material are consistent with our proposal of a structural organisation to the apical vesicle accumulation occupying that region in a growing tube. Previous reports suggest that BFA does not affect the actin cytoskeleton in plant cells (Satiat-Jeunemaitre et al., 1996Go).

The possibility of vesicle trafficking in the presence of BFA is supported by the occurrence of BFA-independent trafficking (Klausner et al., 1992Go) and coat protein activity (Jackson and Casanova, 2000Go). The fact that cytochalasin D effectively dissipated the subapical BFA-induced structure suggests that it is not simply a mass of fused membrane but a gathering of smaller components with a structural organisation maintained by actin cytoskeleton.

The nature of the trafficked material links the periodic trafficking of the BIA to the periodic movements of the apical vesicle accumulation
Studies of BFA-effects on plant cells generally describe endomembrane rearrangements or `BFA compartments'. The term BFA compartment was first used to describe the re-organisation of the Golgi, without ER involvement, that occurs in maize and onion roots after BFA treatment (Satiat-Jeunemaitre et al., 1996Go). However, a range of endomembrane re-arrangements have been recorded that include various combinations between the ER, Golgi, secretory vesicles or endocytic vesicles (Driouich and Staehelin, 1997Go; Farquhar and Hauri, 1997Go; Sanderfoot and Raikhel, 1999Go; Batoko et al., 2000Go; Geldner et al., 2001Go; Ritzenthaler et al., 2002Go). Membrane aggregations noted from previous studies on BFA in pollen tubes have generally been attributed to ER:Golgi fusions with complete loss of the Golgi (Rutten and Knuiman, 1993Go; Geitmann et al., 1996Go).

While what we report here appears to be similar to the above, in that there is re-organisation of the Golgi, without ER involvement, we continue to see a punctate distribution of Golgi markers after BFA-treatments, which suggests Golgi are not completely dissipated (Fig. 6B,C). In fact, the effects of BFA on our membrane labels FM4-64 and GONST1-YFP suggest that the membrane aggregations of BFA-treated pollen tubes involve membranes contributing to the vesicle accumulation of the pollen tube tip. In untreated cells, FM4-64, which labels neither the ER nor Golgi to any obvious extent, preferentially locates at the site of the apical vesicle accumulation that is dissipated by BFA (Parton et al., 2001Go). The GONST1-YFP fusion protein appears to label the Golgi, in agreement with GT-EYFP, and additionally associates with the apical vesicle accumulation (Fig. 5F,G), even reporting fluctuating movements similar to those of FM4-64 during growth. GT-EYFP, while labelling both the Golgi and ER, does not associate with the apical vesicle accumulation, suggesting that this construct is restricted to earlier Golgi compartments than GONST1-YFP. After BFA treatment, of the two Golgi markers, GONST1-YFP alone labels the BIA. An origin from secretory vesicle membranes is not inconsistent with previous studies in pollen tubes (Geitmann et al., 1996Go; Ueda et al., 1996Go) that report pectin-containing membrane aggregates.

The likely development of the BIA from secretory vesicles and membranes of the apical vesicle accumulation provides a further plausible link between the behaviour of the BIA and that of the apical vesicle cloud. Taken together with the parallels in what we see with the apical vesicle accumulation movements of growing tubes and the trafficking events of BFA-treated tubes – despite the difference in the actual period of movement this suggests that in BFA-treated cells we are indeed seeing a periodicity in membrane trafficking pathways, related to the movements of the apical vesicle accumulation during growth, which is revealed not to be simply a consequence of the periodicity in apical extension rate. It seems far less likely that the ~7 second period represents periodic behaviour normally occurring in growing tubes yet unrelated to tip growth and `masked' in the absence of BFA. What our experiments are unable to distinguish is whether we are dealing with membrane components of endocytic or exocytotic traffic.

Oscillatory behaviour in the pollen tube tip appears to be independent of the oscillating tip-focused intracellular calcium gradient normally associated with growth
Calcium imaging revealed that BFA abolished the typical oscillating tip-focused calcium gradient normally associated with growth. Although it has already been established that disruption of the tip-focused oscillating calcium gradient accompanies tip growth arrest in pollen tubes (Pierson et al., 1996Go), our findings are interesting in that, in the absence of both the typical tip-focused calcium gradient or any obvious detectable periodic fluctuation in apical calcium, there should still occur regular periodic movements associated with the BIA.

The results from BFA treatment suggest that the normally observed oscillating tip-focused calcium gradient is not the underlying basis of periodicity but possibly a consequence of a more fundamental oscillator, yet they do not contradict the understanding of the strong relationship between secretion and the calcium signal (Roy et al., 1999Go) or the effects of calcium on growth orientation (Malhó and Trewavas, 1996Go). Our measurements do not, however, eliminate the possibility of continued calcium fluxes at the apex or of intracellular calcium signals of lower magnitude or confined more closely to the membrane that we were unable to detect. Previously, Li et al. showed the dependence of tip growth, calcium entry and the tip-focused gradient upon a Rop-GTPase in the Rho family of small GTP-binding proteins (Li et al., 1999Go). Rho-GTPases are known to interact with the cytoskeleton but also affect vesicle trafficking (Farquhar and Hauri, 1997Go). The importance of Rop-GTPase in pollen tube tip growth provides an indication of a molecular mechanism by which periodicity in cytoplasmic movements or vesicle trafficking could underlie oscillatory calcium signalling and oscillatory growth fluctuation.


    Conclusion
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 References
 
The complexity of tip-growth is evident and the significance of periodicity intriguing (Feijó et al., 2001Go). Although periodic growth rate fluctuations do not appear to be essential to pollen tube apical extension, they are more wide spread than first thought. The `conventional' model for pollen tube growth has centred upon the tip-focused calcium gradient co-ordinating and directing polarity, orientation and growth rate (Pierson et al., 1996Go; Malhó and Trewavas, 1996Go). Recent work has begun to question this (Hepler et al., 2001Go; Zonia et al., 2001Go). Our current hypothesis, to explain how the periodicity in the apical vesicle accumulation and the periodicity associated with the BIA are related to the periodicity of growth, is that there is an underlying structure to the apical vesicle accumulation and its movements that could in some way be involved in organising or regulating vesicle traffic and consequently extension at the tip (Parton et al., 2001Go). Here we have presented a novel perspective on the periodicity of pollen tube tip growth by demonstrating the existence of periodic behaviour in cytoplasmic movements and membrane trafficking, and in the absence of an obvious tip focused [Ca2+]c gradient, secretion or apical extension. These findings highlight the need to further investigate the significance of periodic movements of the apical vesicle accumulation – the contribution of the elusive endocytic component of membrane traffic to these movements still remains to be determined.


    Acknowledgments
 
This work was supported by BBSRC postdoctoral fellowships (to R.M.P., M.K.W. and S.F.-P.) and funding from the COSMIC imaging facility, University of Edinburgh (to R.M.P.). Thanks to Paul Dupree and Michael Handford (University of Cambridge, UK), and Patrick J. Hussey (University of Durham, UK) for providing constructs. Thanks also to Chris Hawes for useful advice, to Chiang-Shiong Loh (University of Singapore) for measurements of Nicotiana growth rates and Tony Collins (Babraham Institute, Cambridge) for advice on ImageJ.


    Footnotes
 
This article is dedicated to Allan Gillies (1947-2003), who died recently. His work in organisation and administration within the University of Edinburgh has over many years contributed much to the advancement of science through his maintenance of a productive research environment.

Movies available online


    References
 Top
 Summary
 Introduction
 Materials and Methods
 Results
 Discussion
 Conclusion
 References
 

Andersen, S. S. L. and Bi, G. (2000). Axon formation: a molecular model for the generation of neural polarity. Bioessays 22,172 -179.[CrossRef][Medline]

Baldwin, T. C., Handford, M. G., Yuseff, M.-I., Orellana, A. and Dupree, P. (2001). Identification and characterisation of GONST1: a Golgi-localised GDP-mannose transporter in Arabidopsis. Plant Cell 13,2283 -2295.[Abstract/Free Full Text]

Bartnik, E. and Sievers, A. (1988). In vivo observations of a spherical aggregate of endoplasmic reticulum and of Golgi vesicles in the tip of fast growing Chara rhizoids. Planta 176,1 -9.

Batoko, H., Zheng, H. Q., Hawes, C. and Moore, I. (2000). A Rab1 GTPase is required for transport between the endoplasmic reticulum and Golgi apparatus and for normal Golgi movement in plants. Plant Cell 12,2201 -2217.[Abstract/Free Full Text]

Blackbourn, H. D. and Jackson, A. P. (1996). Plant clathrin heavy chain: Sequence analysis and restricted localisation in growing pollen tubes. J. Cell Sci. 109,777 -786.[Abstract]

Brandizzi, F., Snapp, E., Roberts, A., Lippincott-Schwartz, J. and Hawes, C. (2002). Membrane protein transport between the ER and Golgi in tobacco leaves is energy dependent but cytoskeleton independent: evidence from selective photobleaching. Plant Cell 14,1293 -1309.[Abstract/Free Full Text]

Camacho, L., Parton, R. M., Trewavas, A. J. and Malhó, R. (2000). [Ca2+]c distribution and oscillations in pollen tubes: comparison of different dyes, dye forms and loading methods using confocal imaging. Protoplasma 212,162 -173.[CrossRef]

Cheung, A. Y., Chen, Y.-h., Glaven, R. H., de Graaf, B. H. J., Vidali, L., Hepler, P. K. and Wu, H.-m. (2002). Rab2 GTPase regulates vesicle trafficking between the endoplasmic reticulum and the Golgi bodies and is important to pollen tube growth. Plant Cell 14,945 -962.[Abstract/Free Full Text]

Coelho, S. M., Taylor, A. R., Ryan, K. P., Sousa-Pinto, I., Brown, M. T. and Brownlee, C. (2002). Spatiotemporal patterning of reactive oxygen production and Ca2+ wave propagation in fucus rhizoid cells. Plant Cell 14,2369 -2381.[Abstract/Free Full Text]

Cole, L., Davies, D., Hyde, G. J. and Ashford, A. E. (2000). Brefeldin A affects growth, endoplasmic reticulum, Golgi bodies, tubular vacuole system, and secretory pathway in Pisolithus tinctorius. Fungal Genetics Biol. 29, 95-106.[CrossRef]

Davis, S. J. and Vierstra, R. D. (1998). Soluble, highly fluorescent variants of green fluorescent protein (GFP) for use in higher plants. Plant Mol. Biol. 36,521 -528.[CrossRef][Medline]

Derksen, J., Rutten, T., Lichtscheidl, I. K., Dewin, A. H. N., Pierson, E. S. and Rongen, G. (1995). Quantitative analysis of the distribution of organelles in tobacco pollen tubes: implications for exocytosis and endocytosis. Protoplasma 188,267 -276.[CrossRef]

Driouich, A. and Staehelin, L. A. (1997). The plant Golgi apparatus: Structural organization and functional properties. In The Golgi Apparatus (ed. E. G. Berger and J. Roth), pp. 276-299. Basel, Switzerland: Birkhäuser.

Dyer, A. F. and Cran, D. G. (1976). The formation and ultrastructure of rhizoids on protonemata of Dryopteris borreri Newm. Ann. Bot. 40,757 -765.[Abstract/Free Full Text]

Farquhar, M. G. and Hauri, H.-P. (1997). Protein sorting and vesicular traffic in the Golgi apparatus. In The Golgi Apparatus (ed. E. G. Berger and J. Roth), pp. 65-116. Basel, Switzerland: Birkhäuser.

Feijó, J. A., Sainhas, J., Hackett, G. R., Kunkel, J. G. and Hepler, P. K. (1999). Growing pollen tubes possess a constitutive alkaline band in the clear zone and a growth-dependent acidic tip. J. Cell Biol. 144,483 -496.[Abstract/Free Full Text]

Feijó, J. A., Sainhas, J., Holdaway-Clarke, T., Cordeiro, M. S., Kunkel, J. G. and Hepler, P. K. (2001). Cellular oscillations and the regulation of growth: the pollen tube paradigm. BioEssays 23,86 -95.[CrossRef][Medline]

Fischer-Parton, S., Parton, R. M., Hickey, P. C., Dijksterhuis, H. A., Atkinson, H. A. and Read, N. D. (2000). Confocal microscopy of FM4-64 as a tool for analysing endocytosis and vesicle trafficking in living fungal hyphae. J. Microsc. 198,246 -259.[Medline]

Geitmann, A., Wojciechowicz, K. and Cresti, M. (1996). Inhibition of intracellular pectin transport in pollen tubes by monensin, brefeldin A and cytochalasin D. Bot. Acta 109,373 -381.

Geldner, N., Friml, J., Stierhof, Y.-D., Jürgens, G. and Palme, K. (2001). Auxin transport inhibitors block PIN1 cycling and visicle trafficking. Nature 431,425 -428.

Geldner, N., Anders, N., Wolters, H., Keicher, J., Kornberger, W., Muller, P., Delbarre, A., Ueda, T., Nakano, A. and Jürgens, G. (2003). The Arabidopsis GNOM ARF-GEF mediates endosomal recycling, auxin transport, and auxin-dependent plant growth. Cell 112,219 -230.[CrossRef][Medline]

Gleave, A. P. (1992). A versatile binary vector system with a t-DNA organizational-structure conducive to efficient integration of cloned DNA into the plant genome. Plant Mol. Biol. 20,1203 -1207.[CrossRef][Medline]

Gomez, T. M. and Spitzer, N. C. (1999). In vivo regulation of axon extension and pathfinding by growth-cone calcium transients. Nature 397,350 -355.[CrossRef][Medline]

Grove, S. N. (1978). The cytology of hyphal tip growth. In The Filamentous Fungi, Vol. 3, Developmental Mycology (ed. J. E. Smith and D. R. Berry), pp. 28-50. New York: Wiley.

Haseloff, J., Siemering, K. R., Prasher, D. C. and Hodge, S. (1997). Removal of a cryptic intron and subcellular localization of green fluorescent protein are required to mark transgenic Arabidopsis plants brightly. Proc. Natl. Acad. Sci. USA 94,2122 -2127.[Abstract/Free Full Text]

Hepler, P. K., Vidali, L. and Cheung, A. Y. (2001). Polarized cell growth in higher plants. Annu. Rev. Cell Dev. Biol. 17,159 -187.[CrossRef][Medline]

Heslop-Harrison, J. (1987). Pollen germination and pollen-tube growth. Int. Rev. Cytol. 107, 1-76.[CrossRef]

Hodgkin, T. (1983). A medium for germinating Brassica pollen in vitro. Eucarpia, Cruciferae Newsletter 8,62 -63.

Holdaway-Clarke, T. L., Feijó, J. A., Hackett, G. R., Kunkel, J. G. and Hepler, P. K. (1997). Pollen tube growth and the intracellular cytosolic calcium gradient oscillate in phase while extracellular calcium influx is delayed. Plant Cell 9,1999 -2010.[Abstract]

Jackson, C. L. and Casanova, J. E. (2000). Turning on ARF: the Sec7 family of guanine-nucleotide-exchange factors. Trends Cell Biol. 10,60 -67.[CrossRef][Medline]

Kippert, F. and Hunt, P. (2001). Ultradian clocks in eukaryotic microbes: from behavioural observation to functional genomics. Bioessays 22,16 -22.

Klausner, R. D., Donaldson, J. G. and Lippincott-Schwartz, J. (1992). Brefeldin A: Insights into the control of membrane traffic and organelle structure. J. Cell Biol. 116,1071 -1080.[Free Full Text]

Kost, B., Spielhofer, P. and Chua, N. H. (1998). A GFP-mouse talin fusion protein labels plant actin filaments in vivo and visualizes the actin cytoskeleton in growing pollen tubes. Plant J. 16,393 -401.[CrossRef][Medline]

Lancelle, S. A. and Hepler, P. H. (1992). Ultrastructure of freeze-substituted pollen tubes of Lilium longiflorum. Protoplasma 167,215 -230.[CrossRef]

Li, Y.-Q., Zhang, H.-Q., Pierson, E. S., Huang, F.-Y., Linskens, H. F., Hepler, P. K. and Cresti, M. (1996). Enforced growth-rate fluctuation causes pectin ring formation in the cell wall of Lilium longiflorum pollen tubes. Planta 200, 41-49.

Li, H., Lin, Y., Heath, R. M., Zhu, M. X. and Yang, Z. (1999). Control of pollen tube tip growth by a Rop GTPase-dependent pathway that leads to tip-localised calcium influx. Plant Cell 11,1731 -1742.[Abstract/Free Full Text]

López-Franco, R., Bartnicki-Garcia, S. and Bracker, C. E. (1994). Pulsed growth of fungal hyphal tips. Proc. Natl. Acad. Sci. USA 91,12228 -12232.[Abstract/Free Full Text]

Malhó, R. and Trewavas, A. J. (1996). Localised apical increases of cytosolic free calcium control pollen tube orientation. Plant Cell 8,1935 -1949.[Abstract]

Malhó, R., Camacho, L. and Moutinho, A. (2000). Signalling pathways in pollen tube growth and reorientation. Ann. Bot. 89, 59-68.[CrossRef]

McCauley, M. M. and Hepler, P. K. (1990). Visualisation of the endoplasmic reticulum in living buds and branches of the moss Funaria hygrometrica by confocal laser scanning microscopy. Development 109,753 -764.[Abstract/Free Full Text]

Messerli, M. A. and Robinson, K. R. (1997). Tip localized Ca2+ pulses are coincident with peak pulsatile growth rates in pollen tubes of Lillium longiflorum. J. Cell Sci. 110,1269 -1278.[Abstract]

Messerli, M. A. and Robinson, K. R. (1998). Cytoplasmic acidification and current influx follow growth pulses of Lilium longiflorum pollen tubes. Plant J. 16, 87-91.

Messerli, M. A., Creton, R., Jaffe, L. F. and Robinson, K. R. (2000). Periodic increases in elongation rate precede increases in cytosolic Ca2+ during pollen tube growth. Dev. Biol. 222,84 -98.[CrossRef][Medline]

O'Driscoll, D., Hann, C., Read, S. M. and Steer, M. W. (1993). Endocytotic uptake of fluorescent dextrans by pollen tubes grown in vitro. Protoplasma 175,126 -130.[CrossRef]

Oparka, K. J., Murphy, R., Derrick, P. H. and Prior, D. A. M. (1991). Modification of the pressure-probe technique permits controlled intracellular microinjection of fluorescent probes. J. Cell Sci. 98,539 -544.[Abstract/Free Full Text]

Ou, G. S., Chen, Z. L. and Yuan, M. (2002). Jasplakinolide reversibly disrupts actin filaments in suspension-cultured tobacco BY-2 cells. Protoplasma 219,168 -175.[CrossRef][Medline]

Palacpac, N. Q., Yoshida, S., Sakai, H., Kimura, Y., Fujiyama, K., Yoshida, T. and Seki, T. (1999). Stable expression of human beta 1,4-galactosyltransferase in plant cells modifies N-linked glycosylation patterns. Proc. Natl. Acad. Sci. 96,4692 -4697.[Abstract/Free Full Text]

Parton, R. M., Dyer, A. F., Read, N. D. and Trewavas, A. J. (2000). Apical structure of actively growing fern rhizoids examined by DIC and confocal microscopy. Ann. Bot. 85,233 -245.[Abstract/Free Full Text]

Parton, R. M., Fischer-Parton, S., Watahiki, M. K. and Trewavas, A. J. (2001). Dynamics of the apical vesicle accumulation and the rate of growth are related in individual pollen tubes. J. Cell Sci. 114,2685 -2695.[Medline]

Pelham, H. R. B. (1989). Control of protein exit from the endoplasmic reticulum. Ann. Rev. Cell Biol. 5,1 -23.[CrossRef]

Pierson, E. S. and Cresti, M. (1992). Cytoskeleton and cytoplasmic organisation of pollen and pollen tubes. Int. Rev. Cytol. 140,73 -125.[CrossRef]

Pierson, E. S., Li, Y. Q., Zhang, H. Q., Willemse, M. T. M., Linskens, H. F. and Cresti, M. (1995). Pulsatory growth of pollen tubes: Investigation of a possible relationship with the periodic distribution of cell wall components. Acta Bot. Neerl. 44,121 -128.

Pierson, E. S., Miller, D. D., Callaham, D. A., van Aken, J., Hackett, G. and Hepler, P. K. (1996). Tip-localized calcium entry fluctuates during pollen tube growth. Dev. Biol. 174,160 -173.[CrossRef][Medline]

Read, S. M., Clarke, A. E. and Basic, A. (1993). Stimulation of growth of cultured Nicotiana tabacum W38 pollen tubes by poly ethylene glycol and Cu(II) salts. Protoplasma 177,1 -14.[CrossRef]

Ridge, R. W., Uozumi, Y., Plazinski, J., Hurley, U. A. and Williamson, R. E. (1999). Developmental transitions and dynamics of the cortical ER of Arabidopsis cells seen with green fluorescent protein. Plant Cell Physiol. 40,1253 -1261.[Abstract/Free Full Text]

Ritzenthaler, C., Nebenführ, A., Movafeghi, A., Stussi-Garaud, C., Behnia, L, Staehelin, L. A. and Robinson, D. G. (2002). Reevaluation of the effects of brefeldin A on plant cells using tobacco bright yellow 2 cells expressing Golgi-targeted green fluorescent protein and COP1 antisera. Plant Cell 14,237 -261.[Abstract/Free Full Text]

Robineau, S., Chabre, M. and Antonny, B. (2000). Binding site of Brefeldin-A at the interface between the small G protein ADP-ribosylation factor 1 (ARF-1) and the nucleotide-exchange factor Sec7 domain. Proc. Natl. Acad. Sci. USA 97,9913 -9918.[Abstract/Free Full Text]

Rohn, W. M., Rouille, Y., Waguri, S. and Hoflack, B. (2000). Bi-directional trafficking between the trans-Golgi network and the endosomal/lysosomal system. J. Cell Sci. 113,2093 -2101.[Abstract]

Roth, J. and Berger, E. G. (1982). Immunocytochemical localisation of galactosyle transferase in HeLa cells: codistribution with thiamine pyrophosphatase intrans-Golgi cisternae. J. Cell Biol. 93,223 -229.[Abstract/Free Full Text]

Roy, S. J., Holdaway-Clarke, T. L., Hackett, G. R., Kunkel, J. G., Lord, E. M. and Hepler, P. K. (1999). Uncoupling secretion and tip growth in lily pollen tubes: evidence for the role of calcium in exocytosis. Plant J. 19,379 -386.[CrossRef][Medline]

Rutten, T. and Knuiman, B. (1993). Brefeldin A effects on tobacco pollen tubes. Eur. J. Cell Biol. 61,247 -255.[Medline]

Saint-Jore, C. M., Evins, J., Batoko, H., Brandizzi, F., Moore, I. and Hawes, C. (2002). Redistribution of membrane proteins between the Golgi apparatus and endoplasmic reticulum in plants is reversible and not dependent on cytoskeletal networks. Plant J. 29,661 -678.[CrossRef][Medline]

Sanderfoot, A. A. and Raikhel, N. V. (1999). The specificity of vesicle trafficking: Coat proteins and SNAREs. Plant Cell 11,629 -641.[Free Full Text]

Satiat-Jeunemaitre, B., Cole, L., Bourett, T., Howard, R. and Hawes, C. (1996). Brefeldin A effects in plant and fungal cells: something new about vesicle trafficking? J. Micros. 181,162 -177.

Steer, M. W. and Steer, J. M. (1989). Tansley review no 16: Pollen tube tip growth. New Phytol. 111,323 -358.[CrossRef]

Ueda, T., Tsukaya, H., Anai, T., Hirata, A., Hasegawa, K. and Uchimiya, H. (1996). Brefeldin A induces the accumulation of unusual membrane structures in elongating pollen tubes of Niciotiana tabacum L. J. Plant Physiol. 149,683 -689.

Wakeley, P. R., Rogers, H. J., Rozycka, M., Greenland, A. J. and Hussey, P. J. (1998). A maize pectin methylesterase-like gene, ZmC5, specifically expressed in pollen. Plant Mol. Biol. 37,187 -192.[CrossRef][Medline]

Wymer, C. L., Bibikova, T. N. and Gilroy, S. (1997). Cytoplasmic free calcium distributions during the development of root hairs of Arabidopsis thaliana. Plant J. 12,427 -439.[CrossRef][Medline]

Zonia, L., Cordeiro, S. and Feijó, J. A. (2001). Ion dynamics and hydrodynamics in the regulatin of pollen tube growth. Sex. Plant Reprod. 14,111 -116.

Zonia, L., Cordeiro, S., Tupy, J. and Feijó, J. A. (2002). Oscillatory chloride efflux at the pollen tube apex has a role in growth and cell volume regulation and is targeted by inositol 3,4,5,6-tetrakisphosphate. Plant Cell 14,2233 -2249.[Abstract/Free Full Text]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:


Home page
Plant Physiol.Home page
M. Iwano, T. Entani, H. Shiba, M. Kakita, T. Nagai, H. Mizuno, A. Miyawaki, T. Shoji, K. Kubo, A. Isogai, et al.
Fine-Tuning of the Cytoplasmic Ca2+ Concentration Is Essential for Pollen Tube Growth
Plant Physiology, July 1, 2009; 150(3): 1322 - 1334.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
G. Cai and M. Cresti
Organelle motility in the pollen tube: a tale of 20 years
J. Exp. Bot., February 1, 2009; 60(2): 495 - 508.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
E. Sousa, B. Kost, and R. Malho
Arabidopsis Phosphatidylinositol-4-Monophosphate 5-Kinase 4 Regulates Pollen Tube Growth and Polarity by Modulating Membrane Recycling
PLANT CELL, November 1, 2008; 20(11): 3050 - 3064.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
A. Klima and I. Foissner
FM Dyes Label Sterol-Rich Plasma Membrane Domains and are Internalized Independently of the Cytoskeleton in Characean Internodal Cells
Plant Cell Physiol., October 1, 2008; 49(10): 1508 - 1521.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
J. Bove, B. Vaillancourt, J. Kroeger, P. K. Hepler, P. W. Wiseman, and A. Geitmann
Magnitude and Direction of Vesicle Dynamics in Growing Pollen Tubes Using Spatiotemporal Image Correlation Spectroscopy and Fluorescence Recovery after Photobleaching
Plant Physiology, August 1, 2008; 147(4): 1646 - 1658.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
S. Yamaoka and C. J. Leaver
EMB2473/MIRO1, an Arabidopsis Miro GTPase, Is Required for Embryogenesis and Influences Mitochondrial Morphology in Pollen
PLANT CELL, March 1, 2008; 20(3): 589 - 601.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
A. C. Certal, R. B. Almeida, L. M. Carvalho, E. Wong, N. Moreno, E. Michard, J. Carneiro, J. Rodriguez-Leon, H.-M. Wu, A. Y. Cheung, et al.
Exclusion of a Proton ATPase from the Apical Membrane Is Associated with Cell Polarity and Tip Growth in Nicotiana tabacum Pollen Tubes
PLANT CELL, March 1, 2008; 20(3): 614 - 634.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Bot.Home page
L. L. Ge, H. Q. Tian, and S. D. Russell
Calcium function and distribution during fertilization in angiosperms
Am. J. Botany, June 1, 2007; 94(6): 1046 - 1060.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
S. Romagnoli, G. Cai, C. Faleri, E. Yokota, T. Shimmen, and M. Cresti
Microtubule- and Actin Filament-Dependent Motors are Distributed on Pollen Tube Mitochondria and Contribute Differently to Their Movement
Plant Cell Physiol., February 1, 2007; 48(2): 345 - 361.
[Abstract] [Full Text] [PDF]


Home page
J Exp BotHome page
A. Y. Cheung and H.-M. Wu
Structural and functional compartmentalization in pollen tubes
J. Exp. Bot., January 1, 2007; 58(1): 75 - 82.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
D. Helling, A. Possart, S. Cottier, U. Klahre, and B. Kost
Pollen Tube Tip Growth Depends on Plasma Membrane Polarization Mediated by Tobacco PLC3 Activity and Endocytic Membrane Recycling
PLANT CELL, December 1, 2006; 18(12): 3519 - 3534.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
U. Klahre and B. Kost
Tobacco RhoGTPase ACTIVATING PROTEIN1 Spatially Restricts Signaling of RAC/Rop to the Apex of Pollen Tubes
PLANT CELL, November 1, 2006; 18(11): 3033 - 3046.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
X. Wang, Y. Teng, Q. Wang, X. Li, X. Sheng, M. Zheng, J. Samaj, F. Baluska, and J. Lin
Imaging of Dynamic Secretory Vesicles in Living Pollen Tubes of Picea meyeri Using Evanescent Wave Microscopy
Plant Physiology, August 1, 2006; 141(4): 1591 - 1603.
[Abstract] [Full Text] [PDF]


Home page
GeneticsHome page
Z. Xu and H. K. Dooner
The Maize aberrant pollen transmission 1 Gene Is a SABRE/KIP Homolog Required for Pollen Tube Growth
Genetics, February 1, 2006; 172(2): 1251 - 1261.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
Q. Wang, L. Kong, H. Hao, X. Wang, J. Lin, J. Samaj, and F. Baluska
Effects of Brefeldin A on Pollen Germination and Tube Growth. Antagonistic Effects on Endocytosis and Secretion
Plant Physiology, December 1, 2005; 139(4): 1692 - 1703.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
J.-U. Hwang, Y. Gu, Y.-J. Lee, and Z. Yang
Oscillatory ROP GTPase Activation Leads the Oscillatory Polarized Growth of Pollen Tubes
Mol. Biol. Cell, November 1, 2005; 16(11): 5385 - 5399.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
B. H.J. de Graaf, A. Y. Cheung, T. Andreyeva, K. Levasseur, M. Kieliszewski, and H.-m. Wu
Rab11 GTPase-Regulated Membrane Trafficking Is Crucial for Tip-Focused Pollen Tube Growth in Tobacco
PLANT CELL, September 1, 2005; 17(9): 2564 - 2579.
[Abstract] [Full Text] [PDF]


Home page
Plant Physiol.Home page
M. Bosch, A. Y. Cheung, and P. K. Hepler
Pectin Methylesterase, a Regulator of Pollen Tube Growth
Plant Physiology, July 1, 2005; 138(3): 1334 - 1346.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Summary Freely available
Right arrow Figures Only
Right arrow Full Text (PDF)
Right arrow Movies
Right arrow All Versions of this Article:
jcs.00468v1
116/13/2707    most recent
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Parton, R. M.
Right arrow Articles by Watahiki, M. K.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Parton, R. M.
Right arrow Articles by Watahiki, M. K.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?