|
|
|
||||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 13 May 2003
doi: 10.1242/jcs.00468
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
Institute of Cell and Molecular Biology, University of Edinburgh, Mayfield Road, Edinburgh EH9 3JU, UK
* Author for correspondence (e-mail: richard.parton{at}ed.ac.uk)
Accepted 10 March 2003
| Summary |
|---|
|
|
|---|
30 second periodicity observed in growing tubes.
Heat treatment was found to reduce period length in both cases. After BFA
treatment membrane was demonstrated to flow from the extreme pollen tube apex
back through a distinct subapical Brefeldin-A-induced membrane accumulation.
The effects of Brefeldin-A on the distribution of ER- and Golgi-targeted
fluorescent proteins revealed that ER did not contribute directly to the
system of membrane aggregations while only certain compartments of the Golgi
might be involved. The involvement of membrane derived from the apical vesicle
accumulation was strongly implicated. Calcium measurements revealed that
Brefeldin-A abolished the typical tip-focused calcium gradient associated with
growth and there were no obvious periodic fluctuations in apical calcium
associated with the continued periodic Brefeldin-A membrane aggregation
associated movements. Our experiments reveal an underlying periodicity in the
pollen tube that is independent of secretion, apical extension and the
oscillating tip-focused calcium gradient normally associated with growth, but
requires an active actin cytoskeleton.
Key words: Oscillating growth, Pollen tube, Brefeldin A, Membrane trafficking
| Introduction |
|---|
|
|
|---|
One of the most intriguing aspects of pollen tube growth, which is shared
with tip-growing fungal hyphae and plant root hairs, is the phenomenon of
periodicity or oscillation in growth rate
(Lopez-Francó et al.,
1994
; Pierson et al.,
1996
; Wymer et al.,
1997
). Animal neurons, which also extend by tip growth, do not
appear to exhibit such regular periodicity, although they do undergo growth
rate fluctuations triggered by environmental cues and dependent upon apical
fluctuations in intracellular calcium
(Gomez and Spitzer, 1999
).
Pollen tube growth rate and orientation are also closely linked to
intracellular calcium signals at the tip most notably the oscillating
tip-focused gradient that exhibits the same periodicity as growth rate
(Malhó et al., 2000
;
Hepler et al., 2001
). Several
other growth associated periodic phenomenon in the pollen tube have been noted
including other ion gradients and fluxes at the apex
(Messerli and Robinson, 1998
;
Feijó et al., 2001
;
Zonia et al., 2002
), cell wall
banding patterns (Pierson et al.,
1995
; Li et al.,
1996
) and dynamics of the apical vesicle accumulation
(Parton et al., 2001
). Despite
recent interest, the significance of growth rate periodicity, the underlying
driving force, how it is integrated with the other mechanisms involved in tip
growth as well as how widespread this phenomenon is in different pollen tube
species are not well understood.
In our previous studies, using FM4-64 as a marker of the apical vesicle
accumulation, we observed an apparent structural organisation and clear
periodicity in the movements of labelled material comprising the apical
vesicle accumulation that was closely related to the periodicity of growth
rate fluctuation (Parton et al.,
2001
). These findings suggested the possibility of a regulated
periodicity to membrane traffic and vesicle trafficking at the pollen tube tip
and prompted us to question the relationship between the movements of the
apical vesicle accumulation, apical extension and periodicity. Such movements
of vesicles and endomembranes recorded by light microscopy, which may also
include vesicle budding and fusion events, we have termed here `membrane
traffic' distinct from `vesicle traffic' which here specifically implies the
involvement of vesicle budding and fusion.
Like other tip-growing cells such as fungal hyphae
(Fischer-Parton et al., 2000
);
growth neurones (Andersen and Bi,
2000
); root hairs (Wymer et
al., 1997
) and rhizoids
(Bartnik and Sievers, 1988
;
Parton et al., 2000
), in
pollen tubes the distinct localised apical vesicle accumulation is associated
with exocytic delivery of material to the extending apex
(Steer and Steer, 1989
;
Lancelle and Hepler, 1992
;
Cheung et al., 2002
). In the
pollen as well as root hairs and fungal hyphae there are also reports of
endocytosis associated with tip growth
(O'Driscoll et al., 1993
;
Derksen et al., 1995
;
Blackbourn and Jackson, 1996
;
Wymer et al., 1997
;
Fischer-Parton et al.,
2000
).
In living pollen tubes of Lilium longiflorum we showed that
Brefeldin-A (BFA) reproducibly leads to the loss of the FM4-64 labelled apical
vesicle accumulation which correlates with a rapid, BFA concentration
dependent, decline in growth rate, inhibition of secretion and the subsequent
appearance of an `undefined structure' which accumulated label [see
Fig. 9
(Parton et al., 2001
)].
Previous studies have established that BFA, a known inhibitor of vesicle
production in plant and animal cells
(Ritzenthaler et al., 2002
),
blocks secretion of cell wall material in tobacco pollen tubes resulting in
growth arrest (Rutten and Knuiman,
1993
; Geitmann et al.,
1996
; Ueda et al.,
1996
).
|
In mammalian cells BFA has been shown to block COPI coatomer protein
mediated vesicle trafficking by interfering in the complex between GTPase ADP
ribosylation factor 1 (Arf1) and its guanine nucleotide exchange factor Sec7
domain by locking it in its inactive form with GDP
(Robineau et al., 2000
;
Rohn et al., 2000
).
In the present study we initially characterised the dynamic nature and
origins of our previously undefined BFA-induced structure and noted an
apparent periodicity in the membrane trafficking associated with it that had
not been reported before. These observations of what appeared to be periodic
behaviour associated with a non-growing tube prompted us to investigate this
phenomenon in relation to the normal expression of periodicity in growth rate,
membrane trafficking at the apex and the oscillating tip-focused gradient in
intracellular calcium associated with growing tubes. Our findings lead us to
propose that the periodicity exhibited in the vesicle cloud movements
(Parton et al., 2001
) during
normal growth may be the expression of an underlying periodicity that
contributes to periodicity in growth rates in pollen tubes rather than being
dependent upon it.
| Materials and Methods |
|---|
|
|
|---|
Plant material
Pollen of Nicotiana tabacum, N. plumbaginifolia and
Arabidopsis thaliana was collected fresh from plants cultured under
glass at the University of Edinburgh. L. longiflorum pollen was
obtained from fresh cut flowers obtained locally.
Media used for pollen culture were: as described
(Read et al., 1993
) for the
Nicotiana species; modified from that described
(Feijó et al., 1999
),
by the addition of 2 mM CaCl2, for L. longiflorum, and
modified to 0.01% Boric acid, 0.07% CaCl2, 3% PEG 6000, 10% sucrose
(w/v) from that described (Hodgkin,
1983
) for Arabidopsis thaliana. Growth media and
conditions were selected for rapid growth rate and even, straight tube
morphology. Batches of cultured tubes or individuals showing slow or irregular
growth were not included for analysis.
Where culture medium was used at increased concentrations relative to
normal strength (100%); this was diluted from double strength medium (200%)
and quoted as percentage strength. Pollen was imbibed for 10 to 30 minutes in
the appropriate liquid medium before transfer to thin layer growth chambers,
as described (Parton et al.,
2001
) and incubated in a humid environment for 3 to 12 hours (at
20-25°C).
Targeting and expression of fluorescent proteins
Targeting of GFP to the ER was achieved by expression of mGFP5-ER [based
upon the C-terminal `HDEL' ER retrieval signal and N-terminal ER transit
peptide (Pelham, 1989
;
Haseloff et al., 1997
;
Ridge et al., 1999
)] in pollen
expression vector pART16. Golgi apparatus targeting was achieved by the
expression of GT-EYFP [EYFP-Golgi: based upon the N-terminal 81 amino acid
targeting sequence of the Golgi resident, type II membrane protein, human
ß-1,4-galactosyltransferase (Roth and
Berger, 1982
; Palacpac et al.,
1999
), Clontech, Basingstoke, UK] in pART16. The Golgi apparatus
was also targeted with the GONST1-YFP sequence [based upon the
Arabidopsis Golgi localised GDP-mannose transporter, accession number
AJ314836 (Baldwin et al.,
2001
)] in pART16. Cytoplasmic localised GFP expression was
achieved with tandem linked soluble GFPs (smGFP)
(Davis and Vierstra, 1998
) in
pART16.
The pART16 pollen expression vector was constructed on pT7Blue-3 cloning
vector (Novagen, Darmstadt, Germany). The promoter region and 5'UTR were
amplified by PCR using SC5-122SN (TAGAGCTCGCGGCCGCAATCGCATCTCATATGTC) and
ASC5-1920XH (GGCCTCGAGTGCCCGCTAGCTTGTAGTTGAATC). The OCS terminator and
multiple cloning site of pART7 (Gleave,
1992
) were cut out with NotI and XhoI
restriction enzymes. Fragments of ZmC5 promoter
(Wakeley et al., 1998
),
5' UTR, multiple cloning site, and OCS terminator were cloned into
KpnI, NotI site of pT7Blue-3. The resulting construct was
named pART16 and contained the same multiple cloning site as pART7 but also
included kanamycin resistance.
Transient expression of fluorescent protein constructs in pollen was
achieved by biolistic bombardment (with DNA-coated 1 or 1.6 µm gold
particles) of wetted pollen as described
(Kost et al., 1998
).
Subcellular localisation of fluorescent protein tagged constructs was confirmed by transient expression in onion epidermis under the 35S promotor (biolistic bombardment), examined by confocal microscopy.
Microscopy and imaging
Differential interference contrast (DIC) video imaging at up to 1 image/400
millisecond was performed using a Nikon TMD inverted microscope, x40 DIC
0.85 NA objective and Orca-ER cooled CCD camera (Hamamatsu Photonics, Japan)
driven by the Improvision Openlab software 3.04. Images were processed and
quantitatively analysed in ImageJ V1.27z (National Institutes of Health, USA,
http://rsb.info.nih.gov.ij).
Confocal microscopy was performed using a Leica TCS SP Confocal Microscope
as described (Parton et al.,
2001
). x63 Leica water immersion plan apo (NA 1.2) and
x20 multi-immersion (NA 0.75) objectives were used throughout. Images
were imported into ImageJ for quantitative analysis or Adobe Premiere 5.1 for
generation of video clips. Excitation and emission wavelengths for
fluorochromes are given in Table
1. Loading of cells with stains was achieved by application during
the imbibition of pollen grains in liquid medium or by direct addition of dye
solutions in 115% liquid medium to growing tubes on thin gel layers.
Inhibitors were applied directly to growing pollen tubes on thin gel layers in
70 µl of 115-120% liquid medium.
|
Fluorescence-recovery-after-photobleaching experiments were performed on the confocal imaging system using the 514 nm laser line and the bleach protocol of the TCSNT software.
Heat treatments were imposed using a heated stage against a room temperature of 20±1°C; culture medium temperature was constantly monitored via a thermocouple (type T) temperature probe.
Simultaneous dual channel confocal ratio imaging of cytosolic
[Ca2+] was carried out using a mixture of Texas Red (TR)-10,000 kDa
Dextran (volume marker) and Oregon Green 488 BAPTA (OG-488)-10,000 kDa Dextran
(Calcium sensor). A 1:1 (
1 mM each) dye mixture was injected into pollen
tubes using a customised version of the pressure probe injection system
(Oparka et al., 1991
).
Quantitative analysis and ratio image generation were done in ImageJ.
| Results |
|---|
|
|
|---|
|
Reversibility of BFA effects has previously been reported for plant cell
culture (Ritzenthaler et al.,
2002
); however, in pollen tubes and fungal hyphae only partial
reversal has been reported (Rutten and
Knuiman, 1993
; Cole et al.,
2000
). We found that when L. longiflorum pollen tubes
that had been treated for 2-4 hours with BFA (10 µM) were subjected to 3
hours of continuous perfusion with fresh medium, the BFA-induced
rearrangements became less distinct but growth did not resume.
Polarity and streaming are altered but not abolished by BFA
treatment
In order to characterise how the dynamic organisation of the pollen tube
tip was altered by BFA treatment, a picture of the apical zonation and
streaming pathways of growing and BFA treated non-growing L.
longiflorum pollen tubes was built up.
The `reverse-fountain' streaming path is well known for pollen tubes,
different organelles can be observed to follow slightly different trajectories
and there is an obvious `non streaming' region within a cone-shaped region of
the apex corresponding to the apical vesicle accumulation
(Heslop-Harrison, 1987
;
Parton et al., 2001
).
Mitofluor Green staining was used as a convenient marker of the streaming path
followed by mitochondria (Fig.
1E; Movie 3). The structurally closely related dye Mitotracker
Green has been used previously to label mitochondria in plant cells
(Coelho et al., 2002
) and the
distribution of mitochondria in pollen tubes was independently confirmed by
staining mitochondrial DNA with Syto 16 (not shown). The paths of lipid
storage droplets and amyloplasts could easily be followed by DIC
microscopy.
In BFA-treated tubes, although vigorous reverse-fountain cytoplasmic streaming continued it could be seen to have shifted further from the tube apex to behind the BIA. Mitochondria, which in growing tubes follow a streaming pathway very close to the tip, along the flanks of the apical clear zone (Fig. 1E,G; Movie 3), after BFA treatment showed a distribution restricted to no further than the site of the BIA (Fig. 1F,H; Movie 4). The situation was the same for lipid storage droplets and amyloplasts (Fig. 1H). Yet cytoplasmic movements in front of the BIA were not completely abolished. Within the region, which would in a growing tube (Fig. 1G; Movies 1, 3) be occupied by the apical vesicle accumulation, movement of clumped material could be seen associated with the BIA (Fig. 1I; Movies 2, 4, 5). These clumps of material (BIA-associated membrane aggregations) periodically `materialised' and migrated from the extreme apex towards the BIA with which they appeared to merge.
Flow of material can be tracked through the BFA-induced membrane
aggregation
The movement of BIA associated aggregations was tracked, by FM4-64
staining, from the tip towards the BIA along `track-like' strands projecting
out from the BIA itself (Fig.
1B,H,I; Movies 2, 5; and see below). Movement of material through
the BIA itself was investigated by FRAP analysis
(Fig. 2). Material was shown to
be displaced from the anterior side of the BIA away from the tip by the
subapical displacement of bleached spots
(Fig. 2A). The recovery of
fluorescence at the location of the bleached areas appeared to be by
incorporation of new stained membrane from the BIA-associated aggregations
into the BIA and displacement of bleached membrane away from the tip. The
displaced bleached area also showed slight recovery in fluorescence, probably
by diffusion (Fig. 2A').
Displacement of material through the BIA was distinguished from simply
diffusion of free dye by following the progress of two separate but adjacent
bleached spots, which remained distinctly separate as they migrated away from
the tip. Recovery was slow, suggesting an absence of mixing and limited free
diffusion of dye within the BIA (Fig.
2A).
|
Photobleaching within the extreme apex supported the observation that this was the source of stained membrane trafficked through the BIA (Fig. 2B). Following the apical bleach and transient reduction in apical fluorescence there was a clear transient drop in the fluorescence of the BIA that subsequently showed a general increase. Superimposed upon the general increase in fluorescence there also appeared to be a periodic fluctuation in the brightness of the BIA (Fig. 2B'). It should also be noted at this point that the overall size of the BIA did not appear to steadily increase suggesting that material was also lost (discussed later). The periodic movements were not halted by the bleach procedure.
Organisation and dynamics of the BIA are actin dependent
In pollen tube tip growth the actin cytoskeleton is involved in cytoplasmic
streaming and vesicle transport (Hepler et
al., 2001
). The involvement of actin in the periodic movements of
membrane (BIA-associated aggregations) between the extreme apex and subapical
Brefeldin-A-induced structure was investigated with drugs known to affect the
actin cytoskeleton.
Cytochalasin-D applied to normally growing L. longiflorum pollen
tubes at relatively low concentrations (1.5 µM) rapidly arrests growth and
disperses the apical FM4-64 staining pattern
(Parton et al., 2001
). A
similar treatment with Cytochalasin D applied to BFA-treated cells had little
effect on the staining pattern. Concentrations of 5.0 µM and higher were
required before obvious effects were noticed. At these concentrations the
movement of material to the subapical BIA was rapidly arrested and the
structure itself dissipated (Fig.
3A).
|
The actin cytoskeleton `stabilising' drug Jasplakinolide
(Ou et al., 2002
) at only 2
µM rapidly blocked the periodic trafficking of material to the BIA and
disrupted the general apical zonation but did not directly dissipate the
membrane aggregation (Fig. 3B).
Only with extended times after application of Jasplakinolide (>5 minutes)
did there appear to be some dissociation of the BIA, by which time cytoplasmic
streaming had effectively halted. At 2 µM Jasplakinolide also blocked tip
growth of normally extending pollen tubes.
The BIA incorporates markers of the apical vesicle accumulation but
not the ER
Having established the trafficking of material between the apex and BIA it
was important to determine its nature. That BFA interferes in vesicle
trafficking and secretion in animal and plant cells is now well documented, it
was therefore reasonable to presume that the BFA induced apical reorganisation
was the result of endomembrane system disruption.
Fluorescent labels of membranes (FM4-64), lipid (Nile Red, not shown) and the cytosol (targeted GFP; 10,000 kDa dextran-dye conjugates; Figs 1, 4) showed by dye accumulation, or in the case of the cytosolic markers, by dye exclusion, that the BIA consists of lipid as membranes. The associated aggregations appeared to be of similar nature as their movements could be followed with the various labels.
|
In previous studies into BFA effects on pollen tubes, a membrane
re-organisation was described in the apical region and attributed to
redistribution of ER and Golgi membranes on the basis of EM analysis
(Rutten and Knuiman, 1993
;
Geitmann et al., 1996
). The
origins of the BFA-induced aggregations observed here in L.
longiflorum pollen tubes were investigated in vivo using ER and
Golgi-targeted fluorescent proteins (Figs
5,
6,
7).
|
|
|
In untreated, rapidly growing tubes, mGFP5-ER
(Haseloff et al., 1997
)
expression clearly marked a region extending from the periphery of the apex
back into more subapical regions (Fig.
5A). In median section there was less dense labelling within the
`V-shaped' apical clear zone and almost total exclusion from the extreme
apical (
3 µm) lens-shaped region, which corresponds to the apical
vesicle accumulation as labelled by FM4-64. More towards the apex, the
mGFP5-ER does not label a clear tubular structural organisation, as has
previously been encountered with ER labelling in tip-growing cells
(McCauley and Hepler, 1990
;
Cheung et al., 2002
). Further
back, distinct interconnected strands could be seen. Time-course analysis and
rapid focusing up and down showed that mGFP5-ER localised to a dynamic 3D
organisation (not shown), very different from the peripheral ER normally
encountered with ER labelling in epidermal cells, but in agreement with EM
images of ER distribution in the pollen tube tip
(Pierson and Cresti, 1992
;
Lancelle and Hepler, 1992
),
fungal hyphae (Grove, 1978
)
and fern protonemata (Dyer and Cran,
1976
). Very similar mGFP5-ER localisation was observed in tobacco
pollen tubes (not shown). Expression of mGFP5-ER in onion epidermis showed the
typical reticulate cortical-ER distribution
(Fig. 5B).
GT-EYFP (Clontech) expression (Fig.
5C) produced a bright punctate pattern corresponding to roughly
1-2 µm diameter structures associated with a weak background fluorescence
of a similar distribution to mGFP5-ER. The brightly labelled structures were
scattered throughout the subapical region of pollen tubes but were effectively
excluded from the whole apical hemisphere. The distribution and movement of
the bright structures differed significantly from the labelling of
mitochondria by Mitofluor Green (Fig.
1E). Movement of the GT-EYFP structures was slower and more
stilted (based upon examination of time-sequence data) than that of
mitochondria. At high levels of GT-EYFP expression, growth was slightly
reduced and more sensitive to laser scanning while the level of background
`ER-like' localisation was much higher
(Fig. 5D). Expressed in onion
epidermis, GT-EYFP clearly localised to the ER and to small roughly spherical
structures that correspond to the expected distribution of Golgi bodies
(Fig. 5E-E'). Partial
distribution of other Golgi-targeted fluorescent proteins into the ER has been
reported previously (Brandizzi et al.,
2002
; Saint-Jore et al.,
2002
).
The GONST1-YFP fusion protein, which targets to the Golgi in plant cells
(Baldwin et al., 2001
),
produced a very similar punctate fluorescence to GT-EYFP in L.
longiflorum pollen tubes (Fig.
5F). GONST1-YFP expression lacked the ER-like background of
GT-EYFP but included a faint labelling of the V-shaped region of the apical
vesicle accumulation. Labelling associated with the apical vesicle
accumulation region was much clearer with high levels of expression
(Fig. 5G). Growth rate and
morphology were generally unaffected by this construct.
BFA treatment resulted in drastic redistribution of the mGFP5-ER (Fig. 6A) leaving no sign of the labelling at the periphery of the extreme apex. Redistribution correlated with the change in apical zonation observed in brightfield and with FM4-64 staining. The redistributed mGFP5-ER was largely restricted to behind the site of the BIA. No labelling of either the BIA or associated aggregations by mGFP5-ER was seen (Fig. 6A, >30 minutes). This was confirmed by co-labelling with FM4-64 that showed these aggregations to be present (not shown). However, it was generally possible to make out the staining of two fine strands originating from the extended region of dense subapical staining and projecting towards the apex (Fig. 6A, 40 minute time point). These strands corresponded to the tracking lanes of material passing from the apex to the BIA previously described (Fig. 1H). Little clear indication of periodic trafficking events occurring could be seen from the mGFP5-ER labelling; however, there was some evidence of periodic extension and retraction of the labelled `arm like' projections, described above, which correlated with the movements of FM4-64-stained material.
BFA treatment of GT-EYFP-expressing pollen tubes led to changes in the distribution, size and apparent numbers of the bright 1-2 µm structures, but even after growth arrest did not result in their complete disappearance (Fig. 6B). Soon after BFA application the bright structures could be seen to clump; subsequently, individual structures appeared enlarged. Redistribution of the weak background `ER-like' labelling was identical to that observed with the mGFP5-ER. As with mGFP5-ER, no clear labelling of the apical membrane aggregations or the BIA was seen, yet staining was again seen in fine strands that extended from the region of dense subapical staining towards the apex (Fig. 7).
The effects of BFA on the punctate structures of GONST1-YFP expressing pollen tubes were the same as for GT-EYFP (Fig. 6C). However with the GONST1-YFP construct, label appeared to be redistributed to the BIA and associated aggregations. From examination of time-series images material was seen to track between these compartments as described for FM4-64 labelling (Fig. 6C; 60 minute time point).
Movements associated with the BIA exhibit a regular periodicity
Following the characterisation of the BFA-induced phenomenon, in which we
established that there is trafficking of membranes from the apex to a
subapical membrane aggregation dependent upon an active actin cytoskeleton, we
investigated the intriguing periodicity apparent in the trafficking of
material.
Rapid time-course imaging using DIC confirmed that events occurred with a definite period (Fig. 8A; Movie 5). With imaging rates of 0.5-1 frames per second (FPS) it was possible to show that in non-growing BFA-treated L. longiflorum pollen tubes material entered the BIA with a period of 5-7 seconds (Table 2) sustained for at least 6 hours after their initial observation 30 minutes to 1 hour after BFA treatment (Fig. 8A').
|
|
Having established the sampling rate required to report the periodicity, BFA-treated L. longiflorum pollen tubes stained with FM4-64 were imaged by low resolution confocal microscopy (1.5-3 FPS; Fig. 8B) in order to quantify fluorescence intensity within the BIA. This approach revealed that staining intensity of the BFA structure increased with fusion of the incoming membrane from the trafficking events but subsequently dropped between fusion events giving rise to a periodic fluctuation in signal. The rise in signal in the BIA appeared to be concurrent with the fusion event; however, the way in which the two parameters were measured, with regions of interest at two different locations, introduced an apparent lag in fluorescence increase relative to the recording of the movement of material (Fig. 8B' and insert diagram). In the example shown in Fig. 8B', the plot of movement was shifted by 2.5 seconds relative to the plot of intensity to compensate for this artefact. Note in some places the occurrence of shouldered peaks on the intensity trace. This is due to the two `sides' of the approaching loop of material (Fig. 8B) arriving slightly out of sync. Throughout, the BIA did not visibly increase in size with increasing numbers of fusion events. Coupled with the fluctuating fluorescence intensity (above) and FRAP data (Fig. 2) this confirms the loss of stained membrane from, or passage through the BIA.
Growth rate fluctuations are consistently of longer period than that
associated with the BIA
The period of trafficking events after BFA treatment was not comparable
with the regular growth fluctuations exhibited by L. longiflorum
pollen tubes (
30 second period), which are of similar magnitude to growth
fluctuations recorded for other species we tested under optimised growth
conditions (Table 3;
Fig. 9; see Materials and
Methods) or the periodic movements of
25-40 seconds of the apical vesicle
accumulation within the cytoplasm of the tip
(Parton et al., 2001
).
|
We investigated ways of perturbing the period of growth rate fluctuation without arresting growth and found that while moderate temperature shift had no significant effect, an increment of 10°C could reproducibly raise growth rate and reduce period duration in L. longiflorum pollen tubes (paired data t-test, P=0.05; Table 3; Fig. 10A). Heat treatment consistently increased apical diameter (Fig. 10B) and the tendency to apical rupture. Applying similar heat treatment to BFA-treated tubes also decreased period duration (paired data t-test, P=0.005; Table 2; Fig. 10C; Movie 6). The effects of different BFA concentrations, between 3.0 and 35 µM, were also directly compared; however no significant difference in period was found (t-test, P=0.05; Table 2).
|
The periodic movements associated with the BIA are not dependent upon
a corresponding calcium signal
As has been previously reported
(Feijó et al., 2001
),
in normally growing cells a clear tip-focused gradient in
[Ca2+]c could be observed that fluctuated with the same
period as the growth rate oscillation, whereas in BFA-treated cells, calcium
imaging failed to show an obvious tip-focused calcium gradient (n=5)
(Fig. 11). There was also no
obvious fluctuation in [Ca2+]c at the extreme apex or
more globally within the apex that we could relate to either the
30
second periodicity seen with normal growth or the 5-7 second periodicity in
BIA-associated aggregation movement (which continued as normal in the presence
of dye; Fig. 11A; Movie 7).
Note that regions of interest were sampled and ratios calculated for
time-course data at different locations within the apical region, but avoiding
areas corresponding directly to the BIA and associated aggregates where dye
signal was poor due to exclusion (see insert image in
Fig. 11A).
|
| Discussion |
|---|
|
|
|---|
BFA as a tool to dissociate tip growth, vesicle trafficking and
periodicity
This study has made use of the ability of BFA to block tip growth and
secretory activity in pollen tubes in a rapid and reproducible manner at
relatively low concentrations (Rutten and
Knuiman, 1993
; Geitmann et
al., 1996
; Ueda et al.,
1996
; Parton et al.,
2001
) while allowing other activities to continue. We did not find
any significant difference in the final BFA-induced membrane aggregations over
an
10-fold concentration range (Table
2). Unlike previous work on BFA effects in pollen tubes, we have
focused upon the dynamic behaviour of living treated tubes in comparison with
that of normal growing tubes.
While the mode of action of BFA in mammals is generally accepted, the
situation in plants is more contentious (see Introduction) with variation
observed in BFA effects in different studies of plant cells. One major
argument is that BFA has multiple sites of action or non-specific effects with
higher concentrations and longer treatment times
(Driouich and Staehelin, 1997
;
Satiat-Jeunemaitre et al.,
1996
; Ritzenthaler et al.,
2002
; Saint-Jore et al.,
2002
). A recent re-analysis of BFA effects
(Ritzenthaler et al., 2002
) in
tobacco culture cells suggests similar effects to those on mammalian cells. It
is possible that exact BFA effects depend upon the predominant vesicle
trafficking processes operating, for example, in tip-growing pollen tubes this
would be the secretion of materials for growth. In this respect it is
significant that pollen tubes of both dicots and monocots show similar BFA
effects. Geldner et al. discuss multiple ARF-GEF's in Arabidopsis,
some of which are predicted to be BFA insensitive, some sensitive
(Geldner et al., 2003
). They
speculate that the overall BFA effect on a cell is dependent upon the relative
involvement of BFA sensitive and insensitive ARF-GEF's.
In our pollen tube work the low concentrations required, fast action,
reproducibility (Parton et al.,
2001
) and species independence of BFA effects all argue that we
are dealing with a fairly specific mode of action.
Non-growing pollen tubes can still exhibit polarised organisation and
periodicity
A distinctly polar cytological organisation and periodic growth rate
fluctuations appear to be features exhibited by several tip-growing cell types
(López-Franco et al.,
1994
; Wymer et al.,
1997
; Hepler et al.,
2001
). However, it is not understood exactly how or why
periodicity might be important or the mechanism by which periodicity is
established and maintained (Feijó
et al., 2001
). Indeed, regular periodicity is not established in
Lilium (Messerli and Robinson,
1997
) or N. tabacum
(Zonia et al., 2002
) pollen
tubes until a certain age or length is achieved and has not been recorded for
all pollen species (Pierson et al.,
1995
). Nevertheless, periodicity in growth rate is clearly
apparent during the rapid growth phase of several pollen species, including
Lilium, Nicotiana, Agapanthus
(Camacho et al., 2000
) and
Arabidopsis. Most research on pollen tube periodicity has focused
upon how fluctuating ion entry and concentrations (most notably of calcium)
relates to growth rate (Messerli et al.,
2000
; Holdaway-Clarke et al.,
1997
). Less attention has been paid to the periodic nature of
cytoplasmic movements (Zonia et al.,
2002
; Parton et al.,
2001
).
With BFA treatment we have a situation where, although apical extension is
halted, expression of both polarised and periodic behaviour continues. The
periodic movements we observe within the apical cytoplasm are clearly not a
direct consequence of the periodic fluctuations in apical extension.
Furthermore, our findings show that periodicity in the pollen tube is not
dependent upon rounds of active secretion of cell wall materials or
weakening/tightening of the cell wall as the tip is extended, which are
associated with cycles of stretching of the PM
(Holdaway-Clarke et al., 1997
;
Messerli et al., 2000
). It is
possible that periodic trafficking of membrane may actually underlie the
expression of growth rate periodicity. While Golgi-derived material is clearly
implicated and plasma membrane might be involved we were unable to determine
whether the phenomenon we have found has any links to endocytic activity.
Intriguingly, the periodicity of membrane trafficking exhibited by
BFA-treated pollen tubes is of a significantly different frequency from the
periodicity associated with normal tip growth, in apical extension rate and
the movements of the apical vesicle cloud (5-7 seconds compared with
30
seconds). However, we find it hard to imagine that the establishment of the
observed periodicity is purely an artefact of BFA treatment. We think it more
likely that the movements we see are related to those exhibited by the apical
vesicle accumulation during normal growth and that BFA treatment has led to
disruption of feed back mechanisms by which the normal period length is
regulated (Feijó et al.,
2001
).
We have determined that period length in the pollen tube can be modified
experimentally. With a 10°C raise in temperature we were able to
convincingly reduce the period length of growth rate fluctuation in L.
longiflorum pollen tubes and similar experimental manipulation also
reduced period length in the BFA-associated phenomenon. These findings are
significant in that they prove that we are dealing with a `simple' oscillatory
mechanism, rather than a timing or `clock mechanism'
(Kippert and Hunt, 2001
) that
would need to be temperature compensated (i.e. not perturbed by changes in
temperature).
BFA-treated tubes exhibit dynamic activities that can be related to
features of normal growth
Our investigations of the BIA and movement of associated aggregates by
time-lapse and FRAP analysis show that we are not observing simply the cycling
of membrane aggregates in the cytoplasmic flow but are following the
occurrence of both bulk membrane translocation and some degree of vesicle
trafficking between membrane pools features that we can relate to the
vesicle cloud movements observed during normal growth.
The path followed by the BIA-associated aggregates corresponds to the bulk
membrane flow seen with FM4-64 staining of the apical vesicle accumulation of
growing tubes (Parton et al.,
2001
). Furthermore this movement from the extreme apex in
BFA-treated tubes was actin dependent (cytochalasin and jasplakinolide
sensitive), as are the apical vesicle accumulation movements of growing tubes
(Hepler et al., 2001
). The
organisation and movement of the BIA and associated material are consistent
with our proposal of a structural organisation to the apical vesicle
accumulation occupying that region in a growing tube. Previous reports suggest
that BFA does not affect the actin cytoskeleton in plant cells
(Satiat-Jeunemaitre et al.,
1996
).
The possibility of vesicle trafficking in the presence of BFA is supported
by the occurrence of BFA-independent trafficking
(Klausner et al., 1992
) and
coat protein activity (Jackson and
Casanova, 2000
). The fact that cytochalasin D effectively
dissipated the subapical BFA-induced structure suggests that it is not simply
a mass of fused membrane but a gathering of smaller components with a
structural organisation maintained by actin cytoskeleton.
The nature of the trafficked material links the periodic trafficking
of the BIA to the periodic movements of the apical vesicle accumulation
Studies of BFA-effects on plant cells generally describe endomembrane
rearrangements or `BFA compartments'. The term BFA compartment was first used
to describe the re-organisation of the Golgi, without ER involvement, that
occurs in maize and onion roots after BFA treatment
(Satiat-Jeunemaitre et al.,
1996
). However, a range of endomembrane re-arrangements have been
recorded that include various combinations between the ER, Golgi, secretory
vesicles or endocytic vesicles (Driouich
and Staehelin, 1997
; Farquhar
and Hauri, 1997
; Sanderfoot
and Raikhel, 1999
; Batoko et
al., 2000
; Geldner et al.,
2001
; Ritzenthaler et al.,
2002
). Membrane aggregations noted from previous studies on BFA in
pollen tubes have generally been attributed to ER:Golgi fusions with complete
loss of the Golgi (Rutten and Knuiman,
1993
; Geitmann et al.,
1996
).
While what we report here appears to be similar to the above, in that there
is re-organisation of the Golgi, without ER involvement, we continue to see a
punctate distribution of Golgi markers after BFA-treatments, which suggests
Golgi are not completely dissipated (Fig.
6B,C). In fact, the effects of BFA on our membrane labels FM4-64
and GONST1-YFP suggest that the membrane aggregations of BFA-treated pollen
tubes involve membranes contributing to the vesicle accumulation of the pollen
tube tip. In untreated cells, FM4-64, which labels neither the ER nor Golgi to
any obvious extent, preferentially locates at the site of the apical vesicle
accumulation that is dissipated by BFA
(Parton et al., 2001
). The
GONST1-YFP fusion protein appears to label the Golgi, in agreement with
GT-EYFP, and additionally associates with the apical vesicle accumulation
(Fig. 5F,G), even reporting
fluctuating movements similar to those of FM4-64 during growth. GT-EYFP, while
labelling both the Golgi and ER, does not associate with the apical vesicle
accumulation, suggesting that this construct is restricted to earlier Golgi
compartments than GONST1-YFP. After BFA treatment, of the two Golgi markers,
GONST1-YFP alone labels the BIA. An origin from secretory vesicle membranes is
not inconsistent with previous studies in pollen tubes
(Geitmann et al., 1996
;
Ueda et al., 1996
) that report
pectin-containing membrane aggregates.
The likely development of the BIA from secretory vesicles and membranes of
the apical vesicle accumulation provides a further plausible link between the
behaviour of the BIA and that of the apical vesicle cloud. Taken together with
the parallels in what we see with the apical vesicle accumulation movements of
growing tubes and the trafficking events of BFA-treated tubes despite
the difference in the actual period of movement this suggests that in
BFA-treated cells we are indeed seeing a periodicity in membrane trafficking
pathways, related to the movements of the apical vesicle accumulation during
growth, which is revealed not to be simply a consequence of the periodicity in
apical extension rate. It seems far less likely that the
7 second period
represents periodic behaviour normally occurring in growing tubes yet
unrelated to tip growth and `masked' in the absence of BFA. What our
experiments are unable to distinguish is whether we are dealing with membrane
components of endocytic or exocytotic traffic.
Oscillatory behaviour in the pollen tube tip appears to be
independent of the oscillating tip-focused intracellular calcium gradient
normally associated with growth
Calcium imaging revealed that BFA abolished the typical oscillating
tip-focused calcium gradient normally associated with growth. Although it has
already been established that disruption of the tip-focused oscillating
calcium gradient accompanies tip growth arrest in pollen tubes
(Pierson et al., 1996
), our
findings are interesting in that, in the absence of both the typical
tip-focused calcium gradient or any obvious detectable periodic fluctuation in
apical calcium, there should still occur regular periodic movements associated
with the BIA.
The results from BFA treatment suggest that the normally observed
oscillating tip-focused calcium gradient is not the underlying basis of
periodicity but possibly a consequence of a more fundamental oscillator, yet
they do not contradict the understanding of the strong relationship between
secretion and the calcium signal (Roy et
al., 1999
) or the effects of calcium on growth orientation
(Malhó and Trewavas,
1996
). Our measurements do not, however, eliminate the possibility
of continued calcium fluxes at the apex or of intracellular calcium signals of
lower magnitude or confined more closely to the membrane that we were unable
to detect. Previously, Li et al. showed the dependence of tip growth, calcium
entry and the tip-focused gradient upon a Rop-GTPase in the Rho family of
small GTP-binding proteins (Li et al.,
1999
). Rho-GTPases are known to interact with the cytoskeleton but
also affect vesicle trafficking (Farquhar
and Hauri, 1997
). The importance of Rop-GTPase in pollen tube tip
growth provides an indication of a molecular mechanism by which periodicity in
cytoplasmic movements or vesicle trafficking could underlie oscillatory
calcium signalling and oscillatory growth fluctuation.
| Conclusion |
|---|
|
|
|---|
| Acknowledgments |
|---|
| Footnotes |
|---|
| References |
|---|
|
|
|---|
Andersen, S. S. L. and Bi, G. (2000). Axon formation: a molecular model for the generation of neural polarity. Bioessays 22,172 -179.[CrossRef][Medline]
Baldwin, T. C., Handford, M. G., Yuseff, M.-I., Orellana, A. and
Dupree, P. (2001). Identification and characterisation of
GONST1: a Golgi-localised GDP-mannose transporter in Arabidopsis.
Plant Cell 13,2283
-2295.
Bartnik, E. and Sievers, A. (1988). In vivo observations of a spherical aggregate of endoplasmic reticulum and of Golgi vesicles in the tip of fast growing Chara rhizoids. Planta 176,1 -9.
Batoko, H., Zheng, H. Q., Hawes, C. and Moore, I.
(2000). A Rab1 GTPase is required for transport between the
endoplasmic reticulum and Golgi apparatus and for normal Golgi movement in
plants. Plant Cell 12,2201
-2217.
Blackbourn, H. D. and Jackson, A. P. (1996). Plant clathrin heavy chain: Sequence analysis and restricted localisation in growing pollen tubes. J. Cell Sci. 109,777 -786.[Abstract]
Brandizzi, F., Snapp, E., Roberts, A., Lippincott-Schwartz, J.
and Hawes, C. (2002). Membrane protein transport between the
ER and Golgi in tobacco leaves is energy dependent but cytoskeleton
independent: evidence from selective photobleaching. Plant
Cell 14,1293
-1309.
Camacho, L., Parton, R. M., Trewavas, A. J. and Malhó, R. (2000). [Ca2+]c distribution and oscillations in pollen tubes: comparison of different dyes, dye forms and loading methods using confocal imaging. Protoplasma 212,162 -173.[CrossRef]
Cheung, A. Y., Chen, Y.-h., Glaven, R. H., de Graaf, B. H. J.,
Vidali, L., Hepler, P. K. and Wu, H.-m. (2002). Rab2 GTPase
regulates vesicle trafficking between the endoplasmic reticulum and the Golgi
bodies and is important to pollen tube growth. Plant
Cell 14,945
-962.
Coelho, S. M., Taylor, A. R., Ryan, K. P., Sousa-Pinto, I.,
Brown, M. T. and Brownlee, C. (2002). Spatiotemporal
patterning of reactive oxygen production and Ca2+ wave propagation
in fucus rhizoid cells. Plant Cell
14,2369
-2381.
Cole, L., Davies, D., Hyde, G. J. and Ashford, A. E. (2000). Brefeldin A affects growth, endoplasmic reticulum, Golgi bodies, tubular vacuole system, and secretory pathway in Pisolithus tinctorius. Fungal Genetics Biol. 29, 95-106.[CrossRef]
Davis, S. J. and Vierstra, R. D. (1998). Soluble, highly fluorescent variants of green fluorescent protein (GFP) for use in higher plants. Plant Mol. Biol. 36,521 -528.[CrossRef][Medline]
Derksen, J., Rutten, T., Lichtscheidl, I. K., Dewin, A. H. N., Pierson, E. S. and Rongen, G. (1995). Quantitative analysis of the distribution of organelles in tobacco pollen tubes: implications for exocytosis and endocytosis. Protoplasma 188,267 -276.[CrossRef]
Driouich, A. and Staehelin, L. A. (1997). The plant Golgi apparatus: Structural organization and functional properties. In The Golgi Apparatus (ed. E. G. Berger and J. Roth), pp. 276-299. Basel, Switzerland: Birkhäuser.
Dyer, A. F. and Cran, D. G. (1976). The
formation and ultrastructure of rhizoids on protonemata of Dryopteris
borreri Newm. Ann. Bot.
40,757
-765.
Farquhar, M. G. and Hauri, H.-P. (1997). Protein sorting and vesicular traffic in the Golgi apparatus. In The Golgi Apparatus (ed. E. G. Berger and J. Roth), pp. 65-116. Basel, Switzerland: Birkhäuser.
Feijó, J. A., Sainhas, J., Hackett, G. R., Kunkel, J. G.
and Hepler, P. K. (1999). Growing pollen tubes possess a
constitutive alkaline band in the clear zone and a growth-dependent acidic
tip. J. Cell Biol. 144,483
-496.
Feijó, J. A., Sainhas, J., Holdaway-Clarke, T., Cordeiro, M. S., Kunkel, J. G. and Hepler, P. K. (2001). Cellular oscillations and the regulation of growth: the pollen tube paradigm. BioEssays 23,86 -95.[CrossRef][Medline]
Fischer-Parton, S., Parton, R. M., Hickey, P. C., Dijksterhuis, H. A., Atkinson, H. A. and Read, N. D. (2000). Confocal microscopy of FM4-64 as a tool for analysing endocytosis and vesicle trafficking in living fungal hyphae. J. Microsc. 198,246 -259.[Medline]
Geitmann, A., Wojciechowicz, K. and Cresti, M. (1996). Inhibition of intracellular pectin transport in pollen tubes by monensin, brefeldin A and cytochalasin D. Bot. Acta 109,373 -381.
Geldner, N., Friml, J., Stierhof, Y.-D., Jürgens, G. and Palme, K. (2001). Auxin transport inhibitors block PIN1 cycling and visicle trafficking. Nature 431,425 -428.
Geldner, N., Anders, N., Wolters, H., Keicher, J., Kornberger, W., Muller, P., Delbarre, A., Ueda, T., Nakano, A. and Jürgens, G. (2003). The Arabidopsis GNOM ARF-GEF mediates endosomal recycling, auxin t