|
|
![]() |
|
|||
| Home Help Feedback Subscriptions Archive Search Table of Contents | |||||
First published online 27 May 2003
doi: 10.1242/jcs.00480
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Research Article |
1 Unité INSERM U590, Centre Léon Bérard, 69373 Lyon Cedex
08, France
2 Laboratoire de Cytogénétique Moléculaire, Hôpital
Edouard Herriot, 69373 Lyon Cedex 03, France
* Author for correspondence (e-mail: corbo{at}lyon.fnclcc.fr)
Accepted 14 March 2003
| Summary |
|---|
|
|
|---|
1.9 MDa,
1 MDa and
650 kDa, and that BTG2, a member of a
protein family with antiproliferative functions, can associate with these
complexes. Immunoprecipitation and gel filtration experiments established that
BTG2 interacts in vivo with hCCR4 protein via hCAF1 and hPOP2. Moreover, we
show that hCCR4, as well as hCAF1 and BTG2, modulate the transcription
regulation mediated by ER
. Finally, we demonstrate that the cellular
localization of hCAF1 and the cell content in hCAF1-containing complexes
change as cells progress from quiescence to S phase. These findings suggest
that the different regulatory pathways in which hCAF1 is involved, notably
transcription regulation and mRNA turnover, may occur through distinct CCR4
complexes in the course of cell-cycle progression.
Key words: BTG family, hCAF1/POP2, hCCR4, Multiprotein complex, Cell cycle, ER
| Introduction |
|---|
|
|
|---|
(Prévôt et al.,
2001
in
vitro (Prévôt et al.,
2001
-mediated transcription via a CCR4-like complex.
Mouse CAF1 was shown to interact with yCCR4
(Draper et al., 1995
), a
component of the general transcription multi-subunit complex CCR4/NOT that, in
yeast, positively or negatively regulates the expression of genes involved in
non fermentative processes, cell-wall integrity, and cell-cycle regulation and
progression (Bai et al., 1999
;
Collart and Struhl, 1994
;
Liu et al., 1998
;
Liu et al., 1997
). The yeast
CCR4-NOT proteins exist in two complexes, of 1.0 and 1.9 MDa, sharing the
subunits CCR4, CAF1, and the five NOT proteins (NOT1-5) constituting the core
complex. Proteins of the core complex play distinct roles; recent studies have
described yCAF1 (Daugeron et al.,
2001
) and yCCR4 (Chen et al.,
2002
; Tucker et al.,
2002
; Tucker et al.,
2001
) as nucleases involved in mRNA deadenylation.
Several components of the yCCR4-NOT complex (named CNOT, for
CCR4-NOT, by the HUGO Gene Nomenclature Committee) have
already been identified in humans: two homologs of yCAF1, hCAF1/CNOT7 and
hPOP2/CALIF/CNOT8 (Albert et al.,
2000
; Bogdan et al.,
1998
; Fidler et al.,
1999
; Rouault et al.,
1998
), four homologs of NOT proteins (CNOT1, CNOT2, CNOT3, CNOT4)
(Albert et al., 2000
), and the
human homolog of yCCR4 (Dupressoir et al.,
2001
). Additionally, CNOT4 has been described as a ubiquitin
protein ligase (Albert et al.,
2002
). Use of a tandem affinity purification (TAP) strategy in a
large-scale approach permitted to show that human and yeast CCR4NOT
complexes have comparable subunit compositions
(Gavin et al., 2002
). Despite
significant advances in understanding the relationship between yeast and human
CCR4 complexes, the characterization of the subunit composition and
stoichiometry of human complexes has not yet been achieved. We do not know
whether multiple, distinct CCR4-NOT complexes exist in mammals, and which
molecular pathways they are involved in. To estimate the number of different
complexes containing CCR4-NOT subunits in mammalian cells, HeLa and MRC5 cell
lysates were subjected to biochemical fractionation. Protein complexes present
in eluted fractions were characterized by immunoblotting using antibodies
specific for hCCR4, hCAF1 and hPOP2, whose yeast orthologs are components of
the CCR4-NOT complex. We report that these proteins exist in mammalian cells
as three distinct complexes, with estimated sizes of
1.9 MDa,
1-1.2
MDa and
650 kDa, which are able to associate with the antiproliferative
protein BTG2. Finally, we show that the subcellular localization of hCAF1 is
regulated in vivo in a cell cycle-dependent manner: for both G0 and G1 stages
we found that hCAF1 concentrated almost exclusively in the nucleus, but by the
time cells entered S phase a majority of hCAF1 had become cytoplasmic.
Interestingly, we also show that the cellular content in hCAF1-containing
complexes changes over the course of the cell cycle, suggesting that this
protein, and perhaps also the CCR4-NOT complexes in which it is found, may
play different regulatory roles during cell-cycle progression in mammals.
| Materials and Methods |
|---|
|
|
|---|
Cell-extract preparation and chromatography on Superose 6
Subconfluent HeLa cells (5x108) were washed and harvested
in PBS, then lysed with a manual Dounce B homogenizer in 5 ml of lysis buffer
(20 mM Hepes pH 7.9, 150 mM NaCl, 20 mM KCl, 0.2 mM EDTA, 10 µM
ZnCl2, 1 mM MgCl2, 0.1% Triton X-100) containing a
mixture of protease inhibitors (Roche Molecular Biochemicals). The lysate was
clarified by centrifugation at 22,000 g at 4°C for 20
minutes, and then concentrated by centricons (Millipore). Protein
concentration was determined by Bradford assay (Bio-Rad). 4 mg of the clear
extract in a total volume of 300 µl were directly loaded onto a 24 ml
Superose 6 column (HR 10/30, Amersham Pharmacia Biotech) preequilibrated with
Tris buffer (50 mM Tris, pH 7.5, 150 mM NaCl, 0.1% Triton X-100) and run in
the same buffer. The flow rate was 0.4 ml/minute, and volumes indicated in the
figure legends were collected for each fraction. The molecular weight of each
fraction was calculated from the elution volumes of the standard molecular
weight mixture used for calibrating the Superose 6 column: blue dextran (2000
kDa) at 7.5 ml, thyroglobulin (669 kDa) at 12.3 ml, bovine gammaglobulin (158
kDa) at 15.5 ml, chicken ovalbumin (44 kDa) at 16.9 ml and equine myoglobin
(17 kDa) at 18.5 ml.
Purification of recombinant protein and generation of antibodies
Purification of GSTCAF1 was obtained as described previously
(Rouault et al., 1998
). Rabbit
polyclonal antibody was generated by using the corresponding purified
recombinant protein as antigen. Rabbit polyclonal antibodies against hPOP2 and
hCCR4 proteins were produced using specific peptides (hPOP2, VAQKQNEDVDSAQEK
residues 266-280; hCCR4, ETNHKDFKELRYNES residues 431-445).
All rabbit polyclonal antibodies were generated at Agrobio Laboratory (France). The antibodies were purified from immunized-rabbit serum by affinity chromatography using NHS columns (Amersham Pharmacia Biotech) coupled with specific antigens.
Immunoblotting
The Superose 6 column fractions (50 µl) were diluted in sodium dodecyl
sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) sample buffer, then
resolved on SDS-PAGE gel as indicated in the figure legends. The gels were
electroblotted onto a PVDF membrane, blocked by incubation at room temperature
for 1 hour in TBS (150 mM NaCl, 10 mM Tris, pH 7.4) containing 5% non-fat dry
milk. The rabbit polyclonal antibodies described above were used to detect
hCAF1, hPOP2 and hCCR4. M2 monoclonal antibody (Sigma) was used to detect
CCR4FLAG, CCR4His-FLAG and BTG2FLAG fusion
proteins. The membranes were then incubated with horseradish
peroxidase-conjugated goat anti-rabbit immunoglobulins or
peroxidase-conjugated rabbit anti-mouse immunoglobulins (Dako). The proteins
were visualized by means of an enhanced chemiluminescence kit (Roche Molecular
Biochemicals), following the manufacturer's instructions.
Mammalian expression vectors
GAL4 and VP16 mammalian expression vectors were derived from the SV40
promoter-driven expression vector pSG5 (Stratagene). GAL4 fusion plasmids were
obtained by subcloning the appropriate cDNA into the pGal4PolyII plasmid
(Green et al., 1988
) in-frame
with the yeast GAL4 binding domain coding sequence. pGal4-hCCR4 was previously
described (Dupressoir et al.,
2001
), as well as pVP16-hCAF1, pVP16-hPOP2, pVP16-BTG1,
pVP16-BTG2, pSG5Foll and pSG5FlagBTG2 constructs
(Prévôt et al.,
2001
; Prévôt et
al., 2000
). pSG5FlaghCCR4 was obtained by cloning the full-length
cDNA of hCCR4 into pSG5Flag plasmid in-frame with the Flag-coding sequence.
pSG5HisFlag plasmid was generated by inserting the following
EcoRI/EcoRI double-stranded oligonucleotide, containing the
6xhis and the thrombine protease recognition site coding sequence, into
the EcoRI site of pSG5Flag plasmid in-frame with the Flag coding
sequence: 5'AATTCATGAGAGGATCCGCATCACCATCACCATCACCTGGTTCCGCGTGGATCTTGG
3'; 3'GTACTCTCCTAGGCGTAGTGGTAGTGGTAGTGGTCCAAGGCGCACCTAGAACCAATT
5'. pSG5HisFlaghCCR4 plasmid was constructed by inserting the hCCR4
full-length cDNA into pSG5HisFlag plasmid.
Transfection, reporter activity and mammalian two-hybrid assay
The plasmids used for transfection were prepared using the
alkaline/PEG/LiCl method. To obtain cells expressing low amounts of
hCCR4FLAG, CCR4His-FLAG and BTG2FLAG
proteins, HeLa cells were transfected with hCCR4FLAG-,
CCR4His-FLAG- and BTG2FLAG-expressing plasmids and pUC
at 1:10 molar ratio to bring the total plasmid DNA to concentrations typically
used for protein expression assays. For the two-hybrid assay, HeLa cells were
grown in DMEM (Invitrogen Life Technologies) supplemented with 10% fetal calf
serum, seeded at 104 cells/well in 96-well microtiter plates, then
transfected 8 hours later using Exgen 500 (Euromedex, Souffelweyersheim,
France). The transfected DNA included 100 ng of pG4-TK-Luc reporter plasmid,
together with 50 ng of GAL4 and/or VP16 fusion vectors in the presence or not
of pSG5FlaghCAF1 and pSG5FlaghPOP2. For ER
transcription assay, HeLa
cells were seeded at 0.8x105 cells/well in 24-well microtiter
plates, then transfected 8 hours later using 5 µl of Exgen 500/µg DNA.
The transfected DNA included various amounts of reporter and expression
vectors, as detailed in the figure legends. The amount of transfected SV40
promoter was kept constant by addition of pSG5 to the transfection mixture.
pTK-RL vector (Promega) (25 ng) was used as internal control for transfection
efficiency. After 24 hours, the cells were washed and, where necessary,
treated for 24 hours with a medium containing 10 nM 17ß-estradiol.
Transfected cells were washed and collected 48 hours after transfection.
Luciferase activity was measured in the cell lysates using the Dual Luciferase
Kit (Promega), following the manufacturer's instructions. In all experiments,
luciferase activity was normalized with reference to the renilla luciferase
activity expressed by the pTK-RL vector. Reporter activity was expressed as a
ratio of fold induction to the activity of the reporter vector alone. Each set
of experiments was performed in quadruplicate and repeated at least three
times.
Flag-tagged and Ni2+-NTA agarose columns
Cells were lysed on ice in lysis buffer (20 mM Hepes pH 7.9, 150 mM NaCl,
20 mM KCl, 10 µM ZnCl2, 1 mM MgCl2, 0.1% Triton
X-100) and a cocktail of protease inhibitors. Lysates were centrifuged in
order to separate insoluble proteins. Approximately 0.2 mg of total proteins
were incubated with 40 µl of anti-Flag M2 affinity gel (Sigma) or with 40
µl of Ni2+-NTA agarose (Quiagen) at 4°C for 8-12 hours.
Beads were then loaded onto a column and washed extensively several times with
buffers containing 150 mM NaCl and, for Ni2+-NTA agarose columns,
increasing imidazole concentrations (5 to 20 mM). Bound proteins were then
eluted with the sample buffer and boiled. Western blots were performed as
described previously.
Cell synchronization
Early-passage MRC5 human diploid cells were seeded onto 15 cm plates at a
density of 3x106 cells per plate. Synchronized G0-G1 MRC5
cells were obtained by cell starvation in 0.1% serum for 72 hours. Populations
in early G1, mid-G1 and late G1 stages, at the G1/S transition and in S phase
were generated by addition of 10% serum to arrested cells. Cells were
collected at the times indicated and processed for immunofluorescence,
fluorescence-activated cell sorting (FACS) analysis, or Superose 6
fractionation.
FACS analysis
At the times indicated, cells were detached from the plates by trypsin
incubation, rinsed with PBS, and fixed in 70% (v/v) ethanol. They were
rehydrated in PBS and incubated with 2 ml of 2N HCl, then with RNase (1 mg/ml)
and propidium iodide (Sigma). Cells were analyzed using a flow cytometer
(FACScalibur, Becton-Dickinson), and the cell cycle was determined by Cell
Quest analysis.
Immunofluorescence microscopy
At the times indicated, MRC5 cells on microscope slides were fixed with 4%
paraformaldeyde for 15 minutes, then permeabilized for 5 minutes with 0.1%
Triton X-100 in PBS. Non-specific staining was blocked by 30 minutes
incubation with 0.2% gelatine in PBS. Anti-hCAF1 purified antibodies were used
for immunodetection, followed by a fluorescein isothiocyanate
(FITC)-conjugated goat anti-rabbit secondary antibody. The coverslips
containing the stained cells were mounted on microscope slides and
immunofluorescence was recorded using a Zeiss Axioplan 2 microscope. HeLa
cells were seeded onto microscope slides in 6-well plates at a density of
2x105 cells per well. After two days, the cells were fixed
and analyzed as described above.
| Results |
|---|
|
|
|---|
Mouse CAF1 has been identified as interacting with, and being a component
of, the yeast general transcriptional complex CCR4-NOT, which is likely to
play fundamental roles in gene regulation
(Bai et al., 1999
;
Collart and Struhl, 1994
;
Liu et al., 1998
;
Liu et al., 1997
). We
previously showed that CCR4/CAF1 interaction is evolutionarily conserved, and
that hCCR4 can bind directly to hCAF1 and hPOP2 both in vivo and in vitro
(Dupressoir et al., 2001
).
Biochemical fractionation was performed in order to determine whether single
or multiple complexes containing CCR4-NOT subunits exist in mammals. HeLa
cells were solubilized in nondenaturing buffer, and then extracted proteins
were directly fractionated by size on a gel filtration column with low-salt
buffer. This procedure permitted to avoid ion-exchange chromatography and
exposure to high salt concentrations that might have caused subunits to break
off from large, multiprotein complexes. HeLa cellular extracts were
fractionated by gel filtration chromatography using a Superose 6 column. Using
polyclonal antibodies directed against hCCR4, hCAF1 and hPOP2, we examined the
relative migration profiles of endogenous proteins. As shown in
Fig. 1A, two major peaks were
observed at
1.9 MDa (fractions 6-9) and
1-1.2 MDa (fractions 16-20)
for hCCR4, hCAF1 and hPOP2, although the elution patterns of hCAF1 and hCCR4
covered a wider range of fractions than hPOP2. In addition, a smaller peak was
observed at
650 kDa (fractions 25-26) that contained only hCCR4 and
hCAF1. The relative broad elution profiles of hCCR4 and hCAF1 suggest that
they may form a greater variety of complexes than hPOP2. No significant
monomeric forms of hCAF1, hCCR4 and hPOP2 were found in the cell lysates,
suggesting either that the formation kinetics of the complexes strongly favors
the sequestration of the proteins in the complexes, or that the monomeric
forms of the proteins are unstable. We obtained similar results using cellular
extracts treated with DNAse and RNAse to remove high-molecular-mass nucleic
acids (data not shown). In summary, this analysis revealed the presence of
multiple large CCR4-containing complexes in HeLa cells ranging in size from
1.9 MDa to 650 kDa.
|
The co-elution of hCAF1, hPOP2 and hCCR4 was not conclusive evidence that these proteins exist in the same multiprotein complex in vivo. To address this point, we used HeLa cells expressing Flag-tagged-CCR4 by transfection, since previous experiments had indicated that endogenous hCCR4, when associated in multiprotein complexes, was inaccessible to anti-hCCR4 antibody (data not shown). Transfection conditions permitting to obtain a very low expression of exogenous proteins were used to prevent spurious associations upon overexpression. Cellular extracts from transfected cells were fractionated as described before, and subjected to immunoblot analysis using anti-Flag antibody. As shown in Fig. 1B, CCR4FLAG was eluted from the column at the same position as the endogenous protein. Fractions 6-9 (Fig. 1B) were pooled then subjected to immunoprecipitation using anti-Flag antibody that co-precipitated the endogenous hCAF1 protein, as revealed by anti-hCAF1 (Fig. 1B). We also tested the immunoprecipitate for the presence of hPOP2; a very weak signal could be detected after a long exposition (data not shown). These results indicate that hCCR4 associates with hCAF1 in the same 1.9 MDa complex in vivo. However, we could not conclude whether hCAF1 and hPOP2 occur in the same or in different CCR4-containing complexes. Further studies will be necessary to clarify this point.
BTG2 may form complexes with hCCR4, hCAF1 and hPOP2 in mammalian
cells
We previously reported that BTG1 and BTG2 proteins directly interact with
mammalian CAF1 and POP2
(Prévôt et al.,
2001
; Rouault et al.,
1998
). Physical interactions between BTG2 and components of
CCR4-NOT complexes were examined in a number of assays. Following transient
transfection of CCR4His-FLAG and BTG2FLAG expression
constructs, cellular extracts were bound with Ni2+NTA agarose.
After several washes with buffers containing increasing imidazole
concentrations, bound proteins were eluted and analyzed by western blotting
using anti-Flag and anti-hCAF1 antibodies. As shown in
Fig. 2A, Ni+2-NTA
agarose retained CCR4His-FLAG- and BTG2FLAG detected by
anti-Flag antibodies and hCAF1 detected by anti-hCAF1 antibodies. These
results indicate that hCCR4, hCAF1 and BTG2 form a complex in vivo.
|
To better define the physical relationship between these proteins,
two-hybrid assays were performed in HeLa cells. As shown in
Fig. 2B, GAL4hCCR4 strongly
interacts with both VP16hCAF1 and VP16hPOP2, as already reported
(Dupressoir et al., 2001
), but
not with VP16BTG2, indicating that the binding of BTG2 to hCCR4 does not
result from direct interactions. Knowing that BTG2 interacts with hCAF1 and
hPOP2, we tested whether these proteins are required for the interaction with
hCCR4. The coexpression of hCAF1 or hPOP2 with fusion proteins GAL4hCCR4 and
VP16BTG2 increased the expression of the pG4-TK-LUC reporter, indicating that
the interaction of BTG2 with hCCR4 is dependent on the presence of hCAF1 or
hPOP2, acting as bridges. The cotransfection of pSG5FlagFOLL, which encodes an
unrelated protein that was used as a control, failed to bridge BTG2 and CCR4
(Fig. 2B). When hCAF1 or hPOP2
are expressed, either alone or in combination with GAL4hCCR4, the basal
promoter activity is not increased (Fig.
2B). Together, these results strongly indicate that BTG2 forms
complexes with hCCR4, hCAF1 and hPOP2 in vivo. We obtained comparable results
using BTG1 protein (data not shown).
BTG2 cofractionates with CCR4-containing complexes
We thus examined the possible occurrence of BTG2 protein in
high-molecular-mass CCR4 complexes. Cellular extracts from HeLa cells
transfected at low efficacy with BTG2FLAG and
CCR4His-FLAG expressing plasmids were fractionated by gel
filtration chromatography using a Superose 6 column, and subjected to
immunoblot analysis. As shown in Fig.
3, BTG2 migrated through the Superose 6 column as
high-molecular-mass complexes and appeared to co-elute with hCCR4, hCAF1 and
hPOP2 in fractions containing the 1.9 MDa and 1-1.2 complexes
(Fig. 3, fractions 6-10 and
16-20) and with hCCR4 and hCAF1 in fractions containing the
650 kDa
complex (fractions 26-28). It is important to note that the monomeric forms of
both transfected proteins were weakly detected, indicating that they are
expressed at physiological concentration. The overlap between the elution
patterns of BTG2, hCAF1, hPOP2 and hCCR4 suggests that BTG2 protein interacts
with the native CCR4 complexes. We obtained similar results using BTG1 protein
(data not shown).
|
CCR4 enhances the transcriptional activity of ER
in mammalian
cells
The above results revealed that BTG2, hCAF1 and hCCR4 are present in the
same complexes, suggesting that these proteins may be involved in common
regulation pathways. Our previous observations that BTG proteins and hCAF1,
probably through a CCR4-like complex, regulate the transcriptional activity of
nuclear receptors, notably Estrogen Receptor
(ER
incited us to
study the capacity of hCCR4 to regulate ER
transcription. HeLa cells,
that lack endogenous ER
, were transfected with a vector expressing
ER
and a Luciferase reporter gene linked to multimer palindromic ERE
sequence, pERE-Luc, along with either a control plasmid or vectors expressing
hCCR4, BTG2 and hCAF1 in the presence of 17ß-estradiol. As shown in
Fig. 4, hCCR4, as BTG2 and
hCAF1, significantly enhanced the ER
-mediated activation of the
Luciferase reporter gene. No effect of hCCR4 on reporter-gene activity was
observed in the absence of ER
(data not shown). Besides, cotransfection
with pSG5FlagFOLL, which encodes an unrelated protein used as a control, had
no effect on reporter gene activation
(Prévôt et al.,
2001
). These results reveal that mammalian CCR4, CAF1 and BTG2
regulate the transcription mediated by ER
, suggesting that mammalian
CCR4 complexes may participate in this regulation pathway.
|
The cell-cycle-dependent localization of hCAF1
Although a substantial body of evidence supports the conclusion that both
yCAF1 and yCCR4 are components of transcriptional complexes, recent work has
shown that they exhibit poly(A)-specific 3' to 5' exonuclease
activity in yeast (Chen et al.,
2002
; Daugeron et al.,
2001
; Tucker et al.,
2002
; Tucker et al.,
2001
). In addition, Tucker et al. have shown that both proteins
are localized primarily in the cytoplasm of yeast cells, which is consistent
with their role in cytoplasmic deadenylation but conflicts with their role in
transcription regulation. Thus we analyzed the subcellular localization of
hCAF1 on asynchronously growing HeLa cells by indirect immunofluorescence
using the purified antibody described before. hCAF1 staining was either
predominant in the nucleus, or present in both the cytoplasm and the nucleus
(Fig. 5A). This dual staining
of asynchronous cells suggests that the localization of hCAF1 changes over the
course of the cell cycle. To test this idea, we examined the localization of
hCAF1 in primary human diploid fibroblast cells at different stages of the
cell cycle. Human cell lines are notoriously difficult to synchronize by
methods other than drug blocking, so we chose to use normal human diploid
fibroblasts, MRC5 that could be efficiently synchronized by serum deprivation.
MRC5 cells have the same growth-arrest mechanisms as normal cells, including
density-mediated growth inhibition and the induction of quiescence in response
to serum deprivation. They are arrested in G0 by 3-day culture in 0.1% serum.
As shown in Fig. 5B1, serum
starvation results in the accumulation of a quiescent population that
synchronously progresses through G1 and S phase after serum restimulation,
allowing for the isolation of populations in mid-G1 (after 12 hours), at G1/S
transition (17 hours), and in S phase (24 hours) (henceforth, all cell-cycle
phase designations will refer to these time points). We compared the
localization of hCAF1 at different cell-cycle stages by indirect
immunofluorescence (Fig. 5B2).
In G0 or G1, almost all the hCAF1 present in cells was detected in the
nucleus; by the time the cells had entered S phase, most of the hCAF1 had
become cytoplasmic. These observations indicate that the sub-cellular
localization of hCAF1 is dependent on cell-cycle progression, and that this
might influence its biological activity.
|
Distinct steady-state of hCAF1-containing complexes during cell-cycle
progression
The above results demonstrate that hCAF1 localizes in different cellular
compartments as the cell cycle progresses, raising the possibility that
changes in the localization of hCAF1 strictly mirror those of hCAF1-containing
complexes. Thus, we examined the occurrence of hCAF1-containing complexes in
MRC5 cells during cell-cycle progression and followed the migration profile of
hCAF1. Lysates of MRC5 cells arrested in G0 by serum starvation, or in G1-S 17
hours after serum re-stimulation (see above), were fractionated on Superose 6
columns. The elution profiles of endogenous hCAF1 were analyzed by Western
analysis using anti-hCAF1 specific antibody. The analysis revealed that the
hCAF1 found in extracts from G1-S-enriched cells occurred in complexes
identical to those described for exponentially growing HeLa cells (compare
Fig. 5C with
Fig. 1). Remarkably, when cells
were blocked in G0, hCAF1 was undetectable in fractions containing complexes
of
1-1.2 MDa and 650 kDa (Fig.
5C). In addition, in these particular extracts, the 1.9 MDa
complex seems to be reduced to
1.8-1.7 MDa, as indicated by the detection
of a hCAF1 peak in fraction 8 (Fig.
5C). These data suggest that, in vivo, hCAF1 is present in
different CCR4-NOT complexes, depending on the cell-cycle stage.
| Discussion |
|---|
|
|
|---|
1.9 MDa and
1-1.2 MDa include hCCR4, hCAF1 and its paralog hPOP2,
and a smaller peak at
650 kDa contains only hCCR4 and hCAF1. It is
however unclear whether hCAF1 and hPOP2 occur in the same or in different
CCR4-containing complexes. The fact that hPOP2, but not hCAF1, is able to
interact with hNOT2 and hNOT3 (Albert et
al., 2000
One important implication of the work presented here is that the
antiproliferative protein BTG2 can participate in the formation of mammalian
CCR4-like complexes. We do not yet know whether BTG2 is a stable constituent
of the `core' CCR4-NOT complex or whether its interaction with the CCR4-NOT
complex is transient and dynamic. We found that hCAF1, hPOP2, hCCR4, and BTG2
have similar fractionation profiles (Fig.
3), and we confirmed on an affinity column that BTG2 forms
complexes with hCCR4 and hCAF1 (Fig.
2A). In addition, by a modification of the mammalian two-hybrid
assay, we were able to provide evidence that hCCR4 interacts in vivo with BTG2
via CAF1 and POP2 (Fig. 2B).
All described components of human CCR4NOT complexes have yeast
orthologs, indicating that the biological functions of these complexes are
conserved through eukaryotic evolution. In contrast, proteins homologous to
BTG/TOB have been detected in all animals
(Chen et al., 2000
) but not in
the yeast S. cerevisiae. The presence of BTG2 in CCR4NOT complexes
might thus indicate the metazoan evolution of regulatory or signal domains of
signal transduction. We can speculate that these complexes have acquired new
specificities through the recruitment of metazoa-specific proteins, such as
proteins of the BTG/TOB family.
However, understanding the biological functions of these complexes in
mammals is limited due to the lack of knowledge of their target genes and
pathways. To begin to address these questions we investigated whether hCCR4 is
involved in the transcriptional regulation of estrogen nuclear receptor
ER
as was demonstrated for BTG proteins and hCAF1. Our results indicate
that hCCR4 can function as a coactivator of ER
(Fig. 4), thus opening the
attractive possibility of a link between mammalian CCR4-NOT complexes and
nuclear receptor regulation pathways.
Although both yCAF1 and yCCR4 have been described as components of nuclear
transcriptional complexes, recent studies indicated that they are also
involved in cytoplasmic mRNA degradation
(Chen et al., 2002
;
Daugeron et al., 2001
;
Tucker et al., 2002
;
Tucker et al., 2001
). In
addition, Chen et al., and our unpublished data have shown that hCCR4 and both
hCAF1 and hPOP2 also exhibit poly(A)-specific 3' to 5' exonuclease
activity in vitro. We further analyzed the cellular localization of hCAF1 and
of hCAF1-containing complexes during cell-cycle progression. To this end, MRC5
cells were made quiescent by serum starvation, which resulted in the arrest of
a majority of cells, as determined by FACS analysis
(Fig. 5B1). The cells
stimulated to re-enter the cell cycle by addition of 10% serum entered S phase
between 16 and 20 hours after restimulation
(Fig. 5B1). We found that hCAF1
was concentrated almost exclusively in the nucleus of both G0 and G1 cells,
but by the time the cells entered S phase, a majority of hCAF1 had become
cytoplasmic (Fig. 5B2). We have
also examined the occurrence of hCAF1-containing complexes as a function of
the cell cycle. Using whole cell lysates from MRC5 cells blocked at G0, when
hCAF1 was localized exclusively in the nucleus, we detected hCAF1 only in the
1.9 MDa complex (Fig. 5C). When
we analyzed extracts of MRC5 cells in G1-to-S transition (17 hours after serum
restimulation, see Fig. 5B1,B2)
hCAF1 was present in all complexes described for exponentially growing HeLa
cells (compare Fig. 5C with
Fig. 1). We can speculate that,
during G0, the hCAF1 associated to the 1.9 MDa complex is localized to the
nucleus where it is involved in the transcriptional regulation of
CAF1-responsive genes. By the time re-stimulated cells have entered S phase,
most hCAF1 is present in the cytoplasm where it associates with complexes
regulating cytoplasmic pathways, mRNA turnover for instance. We are currently
investigating the localization and the biological functions of
hCAF1-containing complexes in the course of cell-cycle progression.
Collectively, these results provide the first indication of a link between the antiproliferative protein BTG2 and mammalian CCR4 complexes. In addition, we show that different classes of CCR4-containing complexes exist in vivo, and that their composition and cellular compartmentalization are regulated during the mammalian cell cycle. Furthermore, both the variable subunit composition and stoichiometry of the complexes are consistent with multiple functional roles in a variety of regulatory contexts.
| Acknowledgments |
|---|
| References |
|---|
|
|
|---|
Albert, T. K., Lemaire, M., van Berkum, N. L., Gentz, R.,
Collart, M. A. and Timmers, H. T. (2000). Isolation and
characterization of human orthologs of yeast CCR4-NOT complex subunits.
Nucleic Acids Res. 28,809
-817.
Albert, T. K., Hanzawa, H., Legtenberg, Y. I., de Ruwe, M. J., van den Heuvel, F. A., Collart, M. A., Boelens, R. and Timmers, H. T. (2002). Identification of a ubiquitin-protein ligase subunit within the CCR4-NOT transcription repressor complex. EMBO J. 21,355 -364.[CrossRef][Medline]
Bai, Y., Salvadore, C., Chiang, Y. C., Collart, M. A., Liu, H.
Y. and Denis, C. L. (1999). The CCR4 and CAF1 proteins of the
CCR4-NOT complex are physically and functionally separated from NOT2, NOT4,
and NOT5. Mol. Cell Biol.
19,6642
-6651.
Berthet, C., Guehenneux, F., Revol, V., Samarut, C., Lukaszewicz, A., Dehay, C., Dumontet, C., Magaud, J. P. and Rouault, J. P. (2002). Interaction of PRMT1 with BTG/TOB proteins in cell signalling: molecular analysis and functional aspects. Genes Cells 7,29 -39.[Abstract]
Bogdan, J. A., Adams-Burton, C., Pedicord, D. L., Sukovich, D. A., Benfield, P. A., Corjay, M. H., Stoltenborg, J. K. and Dicker, I. B. (1998). Human carbon catabolite repressor protein (CCR4)-associative factor 1: cloning, expression and characterization of its interaction with the B-cell translocation protein BTG1. Biochem. J. 336,471 -481.[Medline]
Bradbury, A., Possenti, R., Shooter, E. M. and Tirone, F.
(1991). Molecular cloning of PC3, a putatively secreted protein
whose mRNA is induced by nerve growth factor and depolarization.
Proc. Natl. Acad. Sci. USA
88,3353
-3357.
Chen, J., Chiang, Y. C. and Denis, C. L. (2002). CCR4, a 3'-5' poly(A) RNA and ssDNA exonuclease, is the catalytic component of the cytoplasmic deadenylase. EMBO J. 21,1414 -1426.[CrossRef][Medline]
Chen, P. J., Singal, A., Kimble, J. and Ellis, R. E. (2000). A novel member of the tob family of proteins controls sexual fate in Caenorhabditis elegans germ cells. Dev. Biol. 217,77 -90.[CrossRef][Medline]
Collart, M. A. and Struhl, K. (1994).
NOT1(CDC39), NOT2(CDC36), NOT3, and NOT4 encode a global-negative regulator of
transcription that differentially affects TATA-element utilization.
Genes Dev. 8,525
-537.
Daugeron, M. C., Mauxion, F. and Seraphin, B.
(2001). The yeast POP2 gene encodes a nuclease involved in mRNA
deadenylation. Nucleic Acids Res.
29,2448
-2455.
Draper, M. P., Salvadore, C. and Denis, C. L. (1995). Identification of a mouse protein whose homolog in Saccharomyces cerevisiae is a component of the CCR4 transcriptional regulatory complex. Mol. Cell. Biol. 15,3487 -3495.[Abstract]
Dupressoir, A., Morel, A. P., Berbot, W., Loireau, M.-P., Corbo, L. and Heidmann, T. (2001). Identification of four families of yCCR4- and Mg2+-dependent endonuclease-related proteins in higher eukaryotes, and characterization of orthologs of yCCR4 with a conserved leucine-rich repeat essential for hCAF1/hPOP2 binding. BMC Genomics 2,9 .[CrossRef][Medline]
el-Ghissassi, F., Valsesia-Wittmann, S., Falette, N., Duriez, C., Walden, P. D. and Puisieux, A. (2002). BTG2(TIS21/PC3) induces neuronal differentiation and prevents apoptosis of terminally differentiated PC12 cells. Oncogene 21,6772 -6778.[Medline]
Fidler, C., Wainscoat, J. S. and Boultwood, J. (1999). The human POP2 gene: identification, sequencing, and mapping to the critical region of the 5q-syndrome. Genomics 56,134 -136.[CrossRef][Medline]
Fletcher, B. S., Lim, R. W., Varnum, B. C., Kujubu, D. A.,
Koski, R. A. and Herschman, H. R. (1991). Structure and
expression of TIS21, a primary response gene induced by growth factors and
tumor promoters. J. Biol. Chem.
266,14511
-14518.
Gavin, A. C., Bosche, M., Krause, R., Grandi, P., Marzioch, M., Bauer, A., Schultz, J., Rick, J. M., Michon, A. M., Cruciat, C. M. et al. (2002). Functional organization of the yeast proteome by systematic analysis of protein complexes. Nature 415,141 -147.[CrossRef][Medline]
Green, S., Issemann, I. and Sheer, E. (1988). A
versatile in vivo and in vitro eukaryotic expression vector for protein
engineering. Nucleic Acids Res.
16, 369.
Guardavaccaro, D., Corrente, G., Covone, F., Micheli, L.,
D'Agnano, I., Starace, G., Caruso, M. and Tirone, F. (2000).
Arrest of G(1)-S progression by the p53-inducible gene PC3 is Rb dependent and
relies on the inhibition of cyclin D1 transcription. Mol. Cell
Biol. 20,1797
-1815.
Iacopetti, P., Michelini, M., Stuckmann, I., Oback, B.,
Aaku-Saraste, E. and Huttner, W. B. (1999). Expression of the
antiproliferative gene TIS21 at the onset of neurogenesis identifies single
neuroepithelial cells that switch from proliferative to neuron-generating
division. Proc. Natl. Acad. Sci. USA
96,4639
-4644.
Ikematsu, N., Yoshida, Y., Kawamura-Tsuzuku, J., Ohsugi, M., Onda, M., Hirai, M., Fujimoto, J. and Yamamoto, T. (1999). Tob2, a novel anti-proliferative Tob/BTG1 family member, associates with a component of the CCR4 transcriptional regulatory complex capable of binding cyclin-dependent kinases. Oncogene 18,7432 -7441.[CrossRef][Medline]
Liu, H. Y., Toyn, J. H., Chiang, Y. C., Draper, M. P., Johnston, L. H. and Denis, C. L. (1997). DBF2, a cell cycle-regulated protein kinase, is physically and functionally associated with the CCR4 transcriptional regulatory complex. EMBO J. 16,5289 -5298.[CrossRef][Medline]
Liu, H. Y., Badarinarayana, V., Audino, D. C., Rappsilber, J., Mann, M. and Denis, C. L. (1998). The NOT proteins are part of the CCR4 transcriptional complex and affect gene expression both positively and negatively. EMBO J. 17,1096 -1106.[CrossRef][Medline]
Matsuda, S., Rouault, J., Magaud, J. and Berthet, C. (2001). In search of a function for the TIS21/PC3/BTG1/TOB family. FEBS Lett. 497,67 -72.[CrossRef][Medline]
Prévôt, D., Voeltzel, T., Birot, A. M., Morel, A.
P., Rostan, M. C., Magaud, J. P. and Corbo, L. (2000). The
leukemia-associated protein Btg1 and the p53-regulated protein Btg2 interact
with the homeoprotein Hoxb9 and enhance its transcriptional activation.
J. Biol. Chem. 275,147
-153.
Prévôt, D., Morel, A. P., Voeltzel, T., Rostan, M.
C., Rimokh, R., Magaud, J. P. and Corbo, L. (2001).
Relationships of the antiproliferative proteins BTG1 and BTG2 with CAF1, the
human homolog of a component of the yeast CCR4 transcriptional complex:
involvement in estrogen receptor alpha signaling pathway. J. Biol.
Chem. 276,9640
-9648.
Rouault, J. P., Falette, N., Guéhenneux, F., Guillot, C., Rimokh, R., Wang, Q., Berthet, C., Moyret-Lalle, C., Savatier, P., Pain, B. et al. (1996). Identification of BTG2,an antiproliferative p53-dependent component of the DNA damage cellular response pathway. Nat. Genet. 14,482 -486.[CrossRef][Medline]
Rouault, J. P., Prévôt, D., Berthet, C., Birot, A.
M., Billaud, M., Magaud, J. P. and Corbo, L. (1998).
Interaction of BTG1 and p53-regulated BTG2 gene products with mCaf1, the
murine homolog of a component of the yeast CCR4 transcriptional regulatory
complex. J. Biol. Chem.
273,22563
-22569.
Tirone, F. (2001). The gene PC3(TIS21/BTG2), prototype member of the PC3/BTG/TOB family: Regulator in control of cell growth, differentiation, and DNA repair? J. Cell Physiol. 187,155 -165.[CrossRef][Medline]
Tucker, M., Valencia-Sanchez, M. A., Staples, R. R., Chen, J., Denis, C. L. and Parker, R. (2001). The transcription factor associated Ccr4 and Caf1 proteins are components of the major cytoplasmic mRNA deadenylase in Saccharomyces cerevisiae. Cell 104,377 -386.[CrossRef][Medline]
Tucker, M., Staples, R. R., Valencia-Sanchez, M. A., Muhlrad, D. and Parker, R. (2002). Ccr4p is the catalytic subunit of a Ccr4p/Pop2p/Notp mRNA deadenylase complex in Saccharomyces cerevisiae. EMBO J. 21,1427 -1436.[CrossRef][Medline]
Yoshida, Y., Tanaka, S., Umemori, H., Minowa, O., Usui, M., Ikematsu, N., Hosoda, E., Imamura, T., Kuno, J., Yamashita, T. et al. (2000). Negative regulation of BMP/Smad signaling by Tob in osteoblasts. Cell 103,1085 -1097.[CrossRef][Medline]
Yoshida, Y., Hosoda, E., Nakamura, T. and Yamamoto, T. (2001). Association of ANA, a member of the antiproliferative Tob family proteins, with a Caf1 component of the CCR4 transcriptional regulatory complex. Jpn J. Cancer Res. 92,592 -596.[CrossRef][Medline]
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati
Twitter What's this?
This article has been cited by other articles:
![]() |
X. Yang, M. Morita, H. Wang, T. Suzuki, W. Yang, Y. Luo, C. Zhao, Y. Yu, M. Bartlam, T. Yamamoto, et al. Crystal structures of human BTG2 and mouse TIS21 involved in suppression of CAF1 deadenylase activity Nucleic Acids Res., December 1, 2008; 36(21): 6872 - 6881. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. C. Kim, M. S. Ryu, S. P. Oh, and I. K. Lim TIS21/BTG2 Negatively Regulates Estradiol-Stimulated Expansion of Hematopoietic Stem Cells by Derepressing Akt Phosphorylation and Inhibiting mTOR Signal Transduction Stem Cells, September 1, 2008; 26(9): 2339 - 2348. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Garapaty, M. A. Mahajan, and H. H. Samuels Components of the CCR4-NOT Complex Function as Nuclear Hormone Receptor Coactivators via Association with the NRC-interacting Factor NIF-1 J. Biol. Chem., March 14, 2008; 283(11): 6806 - 6816. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Ezzeddine, T.-C. Chang, W. Zhu, A. Yamashita, C.-Y. A. Chen, Z. Zhong, Y. Yamashita, D. Zheng, and A.-B. Shyu Human TOB, an Antiproliferative Transcription Factor, Is a Poly(A)-Binding Protein-Dependent Positive Regulator of Cytoplasmic mRNA Deadenylation Mol. Cell. Biol., November 15, 2007; 27(22): 7791 - 7801. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Robin-Lespinasse, S. Sentis, C. Kolytcheff, M.-C. Rostan, L. Corbo, and M. Le Romancer hCAF1, a new regulator of PRMT1-dependent arginine methylation J. Cell Sci., February 15, 2007; 120(4): 638 - 647. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. J. Donato, J. H. Suh, and N. Noy Suppression of Mammary Carcinoma Cell Growth by Retinoic Acid: the Cell Cycle Control Gene Btg2 Is a Direct Target for Retinoic Acid Receptor Signaling Cancer Res., January 15, 2007; 67(2): 609 - 615. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. R. DeBella, A. Hayashi, and L. S. Rose LET-711, the Caenorhabditis elegans NOT1 Ortholog, Is Required for Spindle Positioning and Regulation of Microtubule Length in Embryos Mol. Biol. Cell, November 1, 2006; 17(11): 4911 - 4924. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Sentis, M. Le Romancer, C. Bianchin, M.-C. Rostan, and L. Corbo Sumoylation of the Estrogen Receptor {alpha} Hinge Region Regulates Its Transcriptional Activity Mol. Endocrinol., November 1, 2005; 19(11): 2671 - 2684. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. BIANCHIN, F. MAUXION, S. SENTIS, B. SERAPHIN, and L. CORBO Conservation of the deadenylase activity of proteins of the Caf1 family in human RNA, April 1, 2005; 11(4): 487 - 494. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Goldschneider, K. Million, A. Meiller, H. Haddada, A. Puisieux, J. Benard, E. May, and S. Douc-Rasy The neurogene BTG2TIS21/PC3 is transactivated by {Delta}Np73{alpha} via p53 specifically in neuroblastoma cells J. Cell Sci., March 15, 2005; 118(6): 1245 - 1253. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Park, Y. J. Lee, H.-J. Lee, T. Seki, K.-H. Hong, J. Park, H. Beppu, I. K. Lim, J.-W. Yoon, E. Li, et al. B-Cell Translocation Gene 2 (Btg2) Regulates Vertebral Patterning by Modulating Bone Morphogenetic Protein/Smad Signaling Mol. Cell. Biol., December 1, 2004; 24(23): 10256 - 10262. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Berthet, A.-M. Morera, M.-J. Asensio, M.-A. Chauvin, A.-P. Morel, F. Dijoud, J.-P. Magaud, P. Durand, and J.-P. Rouault CCR4-Associated Factor CAF1 Is an Essential Factor for Spermatogenesis Mol. Cell. Biol., July 1, 2004; 24(13): 5808 - 5820. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. G. M. Zwartjes, S. Jayne, D. L. C. van den Berg, and H. T. M. Timmers Repression of Promoter Activity by CNOT2, a Subunit of the Transcription Regulatory Ccr4-Not Complex J. Biol. Chem., March 19, 2004; 279(12): 10848 - 10854. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||